ID: 1150488932

View in Genome Browser
Species Human (GRCh38)
Location 17:65561389-65561411
Sequence AGAAAGCCCCCCTCTTACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488932_1150488943 29 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488943 17:65561441-65561463 CACCCCCACCTTTTACAGCAGGG 0: 1
1: 0
2: 3
3: 16
4: 161
1150488932_1150488937 -4 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488932_1150488942 28 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488942 17:65561440-65561462 CCACCCCCACCTTTTACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 187
1150488932_1150488936 -5 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488932_1150488938 -3 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488932 Original CRISPR AGAAAGCCCCCCTCTTACAG GGG (reversed) Intronic
906884471 1:49629587-49629609 AGAAACCTCCGCTCTAACAGAGG + Intronic
912964787 1:114228090-114228112 AGACAGTCCCACTCTTTCAGGGG + Intergenic
916186503 1:162138712-162138734 AGAAAGCCCTTCTCTAAGAGAGG + Intronic
916248296 1:162710062-162710084 AGAAAACATCCCTCTTCCAGGGG - Intronic
919089607 1:192962092-192962114 AGAAAGCTCCCTTCGTATAGGGG + Intergenic
921149065 1:212385592-212385614 AGAAAGCCCCGCTGTAGCAGAGG + Intronic
923518957 1:234721273-234721295 AGAAAGCTGCCCTCTCCCAGAGG + Intergenic
1063382666 10:5595982-5596004 AGATACCACCCCTCTTAGAGGGG + Intergenic
1064265640 10:13823097-13823119 AGAAAGCCTCCCTCCCACATGGG - Intronic
1068142966 10:53029056-53029078 AGTAAGCCCCTCTCTTAAGGTGG + Intergenic
1069720238 10:70545078-70545100 AGAAAGCCCCTCACTTAGTGGGG + Intronic
1070009841 10:72462129-72462151 AGACAGCCCCCAACTTACAATGG + Intronic
1074867633 10:117554056-117554078 AGAAAGCTCCCCTTTTACTCTGG + Intergenic
1075447084 10:122520573-122520595 AGACAGCCCCCAACTTACAACGG - Intergenic
1076027372 10:127126938-127126960 GGAAACCTCACCTCTTACAGGGG + Intronic
1076266892 10:129115673-129115695 AGATAGGCCCCCACTTACAGTGG + Intergenic
1077133577 11:987307-987329 AGAAAATCCCCCTTTTACAAAGG + Intronic
1079400389 11:20102233-20102255 AAAAAGCCCACCTTTTAAAGTGG - Intronic
1079655685 11:22984055-22984077 AGAATGACTCCCTCTTCCAGAGG + Intergenic
1086442947 11:86847099-86847121 AGTAAGCCCCCCTCTCAAGGTGG - Intronic
1088083219 11:105945497-105945519 AGAAAACTCCCCTCTTACCTTGG - Intronic
1089514691 11:119025064-119025086 AGAAAGCCGCCCACTGTCAGGGG + Exonic
1089794142 11:120966993-120967015 AGAATGCCCCGCTCTTCCGGGGG + Intronic
1093202895 12:16210921-16210943 GCAAAGCCCCCCTCATACAATGG - Intronic
1096730089 12:53602762-53602784 AGAAAACCCCCCTCATCCTGGGG - Intronic
1101844256 12:108349718-108349740 AGAAAGCCCTCACCTTATAGTGG + Intergenic
1105639576 13:22248287-22248309 AGACAGCCCCACTCTCAAAGGGG - Intergenic
1107459585 13:40588585-40588607 AGAAGACCCCTCACTTACAGGGG + Intronic
1109272125 13:60267112-60267134 AGTAAGCCCCCCTCTCAAGGCGG + Intergenic
1112632054 13:101172491-101172513 AGGAAGCAGCCCTCATACAGGGG - Intronic
1115075377 14:29383430-29383452 ATAAAGTCCTCCTCTTATAGAGG - Intergenic
1115408479 14:33046384-33046406 AGAAAGCCCATTTCTGACAGAGG + Intronic
1115480572 14:33857402-33857424 AGACAGCCCCCTACTTACAGTGG + Intergenic
1117072064 14:52066675-52066697 AGCAACCTCACCTCTTACAGGGG + Intronic
1119675230 14:76548359-76548381 AGAGACCCTCCCTTTTACAGTGG - Intergenic
1121409975 14:93743139-93743161 ATAAAGCCTCCATCTCACAGTGG - Intronic
1121587354 14:95071289-95071311 AGAAAGACCCCCTCTGTGAGGGG - Intergenic
1122195142 14:100079072-100079094 AGAAAGACCCGCTCCTCCAGAGG - Intronic
1126097915 15:45102209-45102231 AGAAAGCAGCCCTCAAACAGGGG + Intronic
1132495799 16:262773-262795 AGAAAGACCCCCACTTTCCGTGG - Intronic
1135861218 16:26057880-26057902 GTAAAGCCTCCCTCTTACTGTGG + Intronic
1137547245 16:49412898-49412920 AGAAGGCCCTCCTTTTAAAGAGG + Intergenic
1139350920 16:66334820-66334842 AGAAAGACCCCCAATTACAGAGG + Intergenic
1140947184 16:79779899-79779921 AGAAGGCTCCCCTCTTCAAGTGG + Intergenic
1141392703 16:83678055-83678077 AGATAGCCCCCCAGTTACACAGG + Intronic
1142782458 17:2191762-2191784 AGAAAGTCTCCCTGTTACATAGG - Intronic
1148022469 17:44562525-44562547 ACAAAGCCTCGCTCTTCCAGAGG - Intergenic
1148893853 17:50828435-50828457 AGAAAACCCCTCTGTGACAGGGG - Intergenic
1150488932 17:65561389-65561411 AGAAAGCCCCCCTCTTACAGGGG - Intronic
1154385991 18:13892254-13892276 TGAAAGCCACCCTCTGAAAGGGG + Intronic
1155024954 18:21932915-21932937 AGAAAATCCCTCTCTTACATGGG - Intergenic
1157862772 18:51156238-51156260 AGCAAGCCTCCCTCATAAAGAGG + Intergenic
1158677494 18:59534489-59534511 AGGAAGCCCCTCTCAGACAGAGG - Intronic
1161109648 19:2462184-2462206 AGAAAGCCCCGCGCTTCCCGTGG + Intergenic
1168598678 19:57700436-57700458 AGAATGTGCCCCTTTTACAGAGG - Exonic
927214014 2:20656029-20656051 AGTAGGGCCCCCTCTTCCAGAGG + Intergenic
933495664 2:83047296-83047318 AGAAAGCCACCCTCTAGCACTGG + Intergenic
938069304 2:128300109-128300131 AGAAGCCCCCCATTTTACAGAGG - Intronic
938807774 2:134822652-134822674 AAAAAGCACCTCACTTACAGTGG - Intergenic
938827734 2:135023041-135023063 AAAAACTCCCCCTCTTTCAGTGG + Intronic
939961495 2:148569546-148569568 AGAAAGGCCGCATCTCACAGTGG - Intergenic
940074200 2:149722304-149722326 AGAAAGTCCCTCACTTACAATGG - Intergenic
940113076 2:150176313-150176335 AGAGAGCCACTCTCTTACATGGG - Intergenic
947855843 2:233323995-233324017 AGAAAGCCACACTCTCCCAGGGG + Intronic
1172648189 20:36484510-36484532 AGACAGCCACCCTCCTTCAGGGG - Intronic
1184221693 22:43104840-43104862 AGAAAGCCACCCAGTTGCAGAGG - Intergenic
950178477 3:10893989-10894011 AGACAGCCCCTCCCTCACAGTGG + Intronic
950409502 3:12826088-12826110 AGACAGCCCCCGCCTTACAATGG + Intronic
952253164 3:31673637-31673659 AGATAGCCCCCAACTTACTGTGG + Intronic
954091014 3:48284198-48284220 AGAAAGTCCCCCACTTACAGTGG + Intronic
955234390 3:57126693-57126715 ATATAGCGCCCCTCTTCCAGTGG + Intronic
955339735 3:58116246-58116268 AGAAAGCCACCCCCTGACACGGG + Intronic
955559171 3:60170161-60170183 AGAAAGCCACTCTCTTCCAGTGG - Intronic
956339348 3:68204360-68204382 GGAAAGCCCCCCACTTACACTGG + Intronic
956488560 3:69747298-69747320 AAAAAGCCCCCTTCTTTCATAGG - Intronic
956832920 3:73070994-73071016 AGCACACCCGCCTCTTACAGGGG + Intergenic
957445333 3:80308543-80308565 AGTAAGCCCCTCTCTTAAGGTGG - Intergenic
960199843 3:114818980-114819002 AGATAGTCCCCAACTTACAGTGG + Intronic
961349455 3:126290374-126290396 AGACAGACCCCCTCTTCCAGGGG - Intergenic
965280340 3:166743648-166743670 ACAAAGCCCCACACTTGCAGAGG + Intergenic
967229479 3:187323966-187323988 AGAAAGCCAAACCCTTACAGTGG - Intergenic
968314568 3:197712491-197712513 TGAAAGCCCTCATCTTTCAGAGG + Intronic
969461155 4:7329698-7329720 AGACAGCCCCCAACTTACAATGG + Intronic
970549946 4:17169586-17169608 AGGCAGCTCCCATCTTACAGAGG + Intergenic
971137662 4:23887453-23887475 ATAAAGCACACCTGTTACAGAGG - Intronic
971554950 4:28002107-28002129 AGAAAGCCCCACTCAAAAAGAGG - Intergenic
974968839 4:68801487-68801509 AGTAAGCCCCTCTCTTACGGCGG - Intergenic
975001055 4:69223769-69223791 AGTAAGCCCCTCTCTTACGGTGG + Intergenic
975012800 4:69377465-69377487 AGCAAGCCCCTCTCTTACGGCGG - Intronic
976089963 4:81446875-81446897 TGAAAGCCCCCTTCTGAGAGTGG - Intronic
976142484 4:82006937-82006959 AGAAAGCAACCCTCTCACACAGG + Intronic
987884094 5:23790349-23790371 AGAAAGCTGCCTTCTTACTGCGG + Intergenic
989558386 5:42823646-42823668 AGAAAGCCCACCACTCAGAGTGG + Intronic
992428586 5:76685049-76685071 AAACAGCCCCTGTCTTACAGGGG + Intronic
993029969 5:82694621-82694643 AGAAGGGCCCCCTCTTACTAGGG + Intergenic
996646046 5:125818089-125818111 AGACAGTCCCCATCTTACAAAGG - Intergenic
997161291 5:131611941-131611963 AGACAGTCCCCATCTTACAATGG + Intronic
1002701214 5:181126374-181126396 ATAAAGCCCAGTTCTTACAGTGG + Intergenic
1004361467 6:14974952-14974974 AACATGCCCACCTCTTACAGGGG - Intergenic
1004512057 6:16291174-16291196 AGTAAGCCCCACTTCTACAGTGG - Intronic
1005825623 6:29630248-29630270 AGGAAGCCCCCAACCTACAGAGG + Intronic
1012133047 6:95519952-95519974 AGGAAGCCCCCTTCTTCCACAGG - Intergenic
1013426484 6:110017413-110017435 AGACAGGCCTCCTCTTACGGGGG - Intergenic
1013660800 6:112294822-112294844 AGAAAGCCCAAGTCCTACAGTGG - Intergenic
1014202021 6:118618660-118618682 AGTAAGCCCCCATCTTAAGGTGG - Intronic
1014505685 6:122251986-122252008 AGACAGTCCCCAACTTACAGGGG + Intergenic
1015789012 6:136947552-136947574 AGAATCCCCATCTCTTACAGAGG - Intergenic
1021335383 7:19395016-19395038 AGAGAGCCCTGCTCTTAGAGTGG - Intergenic
1022410845 7:30137119-30137141 AGAAAGCCCCCAGGATACAGTGG + Intronic
1023346066 7:39272364-39272386 AGAAAGGCCCCCTGGTCCAGAGG - Intronic
1025251102 7:57352197-57352219 ACACAGCCCCCATCTAACAGAGG + Intergenic
1029202218 7:98846806-98846828 AGAATGCCCCCCTCACACACAGG + Exonic
1030154167 7:106436278-106436300 AGAAAGGCACTCTCCTACAGTGG - Intergenic
1033507870 7:142023890-142023912 TGAAAGCCCACCTCTCTCAGAGG - Intronic
1036066432 8:5386128-5386150 AGAATGCTTCCTTCTTACAGGGG + Intergenic
1037122033 8:15300227-15300249 AGAAAGTCCCCATCTTATGGGGG - Intergenic
1038344105 8:26716288-26716310 ACAAAGCTCCCCACTCACAGAGG - Intergenic
1043393729 8:79816392-79816414 AGATAGTCCCCAACTTACAGTGG + Intergenic
1044756278 8:95465299-95465321 GGACAGCCCACCTCTTTCAGCGG + Intergenic
1049995955 9:1033770-1033792 AGAAAGCCCCCATGTGAAAGAGG - Intergenic
1051249592 9:15145975-15145997 AGGAAGCCACCCTCCTACCGAGG - Intergenic
1055726433 9:79234860-79234882 AGAAAAACCACCTCTTACATAGG + Intergenic
1056933395 9:90897161-90897183 AGCAGGCCCTCCTCTAACAGGGG + Exonic
1057551897 9:96057260-96057282 AAAAGGCCCCACTCTCACAGGGG + Intergenic
1062707333 9:137952858-137952880 AGAGAGCCCCTCTGTTACTGTGG + Intronic
1188400849 X:29742145-29742167 GGAAAGCTACCCTCATACAGAGG + Intronic
1189849757 X:45166470-45166492 TGTCATCCCCCCTCTTACAGAGG - Intronic
1190253829 X:48747764-48747786 AGAGAGCTCCCCTGTCACAGGGG - Intergenic
1196786438 X:119425257-119425279 AGAAAGCCCGCCTACCACAGGGG + Intronic
1199262715 X:145794311-145794333 AGAAAAACCCCCTGTCACAGAGG - Intergenic
1201750150 Y:17422962-17422984 AGTAAGCCCCTCTCTTAAGGTGG + Intergenic