ID: 1150488933

View in Genome Browser
Species Human (GRCh38)
Location 17:65561390-65561412
Sequence AAGAAAGCCCCCCTCTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488933_1150488938 -4 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488933_1150488942 27 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488942 17:65561440-65561462 CCACCCCCACCTTTTACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 187
1150488933_1150488943 28 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488943 17:65561441-65561463 CACCCCCACCTTTTACAGCAGGG 0: 1
1: 0
2: 3
3: 16
4: 161
1150488933_1150488937 -5 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488933_1150488936 -6 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488933 Original CRISPR AAGAAAGCCCCCCTCTTACA GGG (reversed) Intronic