ID: 1150488933

View in Genome Browser
Species Human (GRCh38)
Location 17:65561390-65561412
Sequence AAGAAAGCCCCCCTCTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488933_1150488943 28 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488943 17:65561441-65561463 CACCCCCACCTTTTACAGCAGGG 0: 1
1: 0
2: 3
3: 16
4: 161
1150488933_1150488938 -4 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488933_1150488942 27 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488942 17:65561440-65561462 CCACCCCCACCTTTTACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 187
1150488933_1150488937 -5 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488933_1150488936 -6 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488933 Original CRISPR AAGAAAGCCCCCCTCTTACA GGG (reversed) Intronic
900382133 1:2390236-2390258 AAGCCAGCCCTCCTCTTACTGGG - Intronic
901188106 1:7388007-7388029 AAGAAAGCCCATCTCTGACTTGG - Intronic
902759726 1:18573288-18573310 GAGGAAGCCCTCCTCTTCCAGGG + Intergenic
905208103 1:36354476-36354498 TGGAGAGCCCCCATCTTACAGGG - Intronic
905332347 1:37213993-37214015 AAGAAAACCCTGCTCTTAGAGGG + Intergenic
906001016 1:42425007-42425029 AACAAACCTCCCCTCTTTCAGGG + Intergenic
910625800 1:89305181-89305203 AAGAAAGCTCTCCTCTTTCCTGG - Intergenic
911506459 1:98758317-98758339 AAGAATGGCCTCCTCTTAGACGG - Intronic
913400681 1:118429443-118429465 AGGAAAGCCCCACTTTTTCAAGG - Intergenic
920386701 1:205575013-205575035 AAAAAGGCCCCCCTCTAACTTGG - Intronic
1063382665 10:5595981-5596003 AAGATACCACCCCTCTTAGAGGG + Intergenic
1064265641 10:13823098-13823120 GAGAAAGCCTCCCTCCCACATGG - Intronic
1066656695 10:37703998-37704020 ATCACAGCCCCCCTCTCACAGGG + Intergenic
1067041219 10:42954255-42954277 ATCACAGCCCCCCTCTCACAGGG + Intergenic
1067349946 10:45466555-45466577 AAGGAAGCCCCCTTCCTTCAAGG + Intronic
1067532579 10:47085349-47085371 ATGCAAGACCCCCTCTCACAGGG - Intergenic
1068960684 10:62863663-62863685 AAGAAAGCTCACTTCTGACAAGG - Intronic
1070704917 10:78630660-78630682 AACAAACACCCCCTCTCACAAGG - Intergenic
1072164796 10:92802745-92802767 AAGCAAGCCCACCTGTTCCATGG - Intergenic
1072614332 10:97039402-97039424 AAGAAGGCCACCTTCTCACATGG + Intronic
1078431244 11:11290367-11290389 TTGAAAGCCCCCCTCTGGCAGGG - Intronic
1083723040 11:64612792-64612814 AAGAAAGCCACCAGCCTACAGGG + Intronic
1086468690 11:87083139-87083161 AAGTAAGCTGCCCTCTTACTGGG - Intronic
1090896329 11:130979015-130979037 ACGAAGGACCCCTTCTTACATGG - Intergenic
1090901860 11:131038976-131038998 AAGATGGTCACCCTCTTACATGG - Intergenic
1091549499 12:1527347-1527369 AAGAAAGTACCCCTGTTGCAGGG - Intergenic
1092520109 12:9262874-9262896 AAGAAAGCAGCCTTCTTATATGG - Intergenic
1096943741 12:55380597-55380619 AAGAAAGCAGCCCTCTACCAGGG - Intergenic
1100950040 12:99837570-99837592 ATAAAAGCCCCCGTCTCACATGG - Intronic
1106279307 13:28249889-28249911 AAGGAAACTCCCCTCTTAAAAGG - Intronic
1106697934 13:32198207-32198229 GACAAAGCCTCCCTCTTACTAGG - Intronic
1107459584 13:40588584-40588606 AAGAAGACCCCTCACTTACAGGG + Intronic
1110093814 13:71489529-71489551 TACAAAGCCCCTCTCTTATATGG - Intronic
1116473926 14:45317984-45318006 AAAAAAGCCCCCTTCTTGCCTGG - Intergenic
1116627912 14:47290352-47290374 AAGCAAGCCCTCATCATACATGG + Intronic
1117072063 14:52066674-52066696 AAGCAACCTCACCTCTTACAGGG + Intronic
1118173251 14:63410602-63410624 AATTAAGGCCCCCTCTTAGAAGG + Intronic
1120832160 14:89007207-89007229 AAGAAAGTTCCCCTCATCCAAGG - Intergenic
1120960115 14:90116757-90116779 AGGAAATCCCCAGTCTTACAAGG + Intronic
1122821877 14:104350977-104350999 AGGAAAGGGCCCCTGTTACATGG - Intergenic
1128577897 15:68788899-68788921 TAAAAAGCCACCCTCTCACAGGG + Intronic
1129751285 15:78066352-78066374 TAGAAAGCCACCATCATACAGGG + Intronic
1138618644 16:58194114-58194136 AAGAAAGCCACCCTCTATCTTGG + Intronic
1140278553 16:73532914-73532936 CAGAAGGCCCCCCCTTTACAGGG - Intergenic
1142921556 17:3191756-3191778 TAGAAAGCTACTCTCTTACAGGG - Intergenic
1144696233 17:17305610-17305632 AAGACAGCCACCCTGTCACATGG - Intronic
1148893854 17:50828436-50828458 AAGAAAACCCCTCTGTGACAGGG - Intergenic
1149969980 17:61207742-61207764 AGAAAATCCGCCCTCTTACATGG + Intronic
1150488933 17:65561390-65561412 AAGAAAGCCCCCCTCTTACAGGG - Intronic
1151464325 17:74274727-74274749 CAGAAAGCTCTCCTCTTAAAGGG - Intronic
1152755551 17:82085578-82085600 CAGAAAGCCCCCTTCTCTCAGGG + Exonic
1155024955 18:21932916-21932938 GAGAAAATCCCTCTCTTACATGG - Intergenic
1159648825 18:70953003-70953025 AAGCAAGGCACCATCTTACATGG - Intergenic
1166803886 19:45473582-45473604 AAGTGAGCCCCCCCCTTAAAGGG + Exonic
1167672078 19:50859215-50859237 AAGAAAGGACCCCTCCTGCAGGG + Intronic
1167884821 19:52492215-52492237 AAGTAACACCCCCTCTCACAGGG - Intronic
925170719 2:1748768-1748790 AAGCAAGCACCCCGCTCACAAGG + Intergenic
925898046 2:8488358-8488380 TGGAAAGCCCCCATCTCACAGGG + Intergenic
928143588 2:28751883-28751905 AAGAGAGGCCCCCTCGAACAGGG - Exonic
928777246 2:34780574-34780596 ATGAAAGGCACCTTCTTACATGG + Intergenic
930015561 2:46968223-46968245 AAGCAAGTCCTCCTCTTGCAAGG + Intronic
933707584 2:85303532-85303554 TAGAAAGCCCGCCTCATTCATGG - Intronic
934677525 2:96260168-96260190 AGGAAAACCCACCTGTTACATGG - Intronic
935574274 2:104692665-104692687 AAAAAAGCCCCAACCTTACAAGG + Intergenic
938452313 2:131432718-131432740 AAGAAAGCCTATCCCTTACATGG - Intergenic
940095085 2:149965690-149965712 AAGAGAGACCCCCTGTTACATGG - Intergenic
940113077 2:150176314-150176336 GAGAGAGCCACTCTCTTACATGG - Intergenic
942972689 2:181976791-181976813 AAGAAAGCCTCCTTCAAACATGG - Intronic
946003845 2:216506171-216506193 AAATAAGCCTTCCTCTTACAAGG - Intronic
947903589 2:233743396-233743418 AAGAAAGGCCCCCACTTCCCAGG + Intronic
947904974 2:233754750-233754772 AAGAAAGGCCCCCACTTCCCAGG + Intronic
948440087 2:237981156-237981178 AAGAACGCCACCCACCTACAAGG - Intronic
1168834212 20:866481-866503 TAGAAAGGACCCCTCCTACAAGG + Intergenic
1172610304 20:36246045-36246067 AATAATACCCCCATCTTACAAGG - Intronic
1175805187 20:61823893-61823915 AAGAAAGCCGCCCCACTACATGG - Intronic
1176144250 20:63558458-63558480 GAGAAAGGCCCCCTCTCCCAGGG + Intronic
949312909 3:2720343-2720365 AAGAAAGCCACCTTCAGACAGGG - Intronic
949886937 3:8702848-8702870 AAGTCAGTCCCCATCTTACATGG + Intronic
950332461 3:12167339-12167361 AAGGAAGCCTCCCTCTCACTGGG - Intronic
950870753 3:16226502-16226524 AAGCAAGCCCCGTCCTTACATGG + Intronic
950992584 3:17455984-17456006 AACAAACCCACCCTCCTACATGG + Intronic
951588116 3:24235826-24235848 AGCTATGCCCCCCTCTTACACGG - Intronic
953149727 3:40313960-40313982 AAGAAAGCACCCCTCATCCTGGG + Intergenic
953328375 3:42031760-42031782 CAGACAGCCCCACTCTTAAAAGG - Intronic
954595290 3:51819187-51819209 AATGAAGCCCCCCACTGACAAGG + Intronic
955214112 3:56970924-56970946 AACAAGACCCCCCTCTCACAGGG + Intronic
955339734 3:58116245-58116267 CAGAAAGCCACCCCCTGACACGG + Intronic
961349456 3:126290375-126290397 CAGACAGACCCCCTCTTCCAGGG - Intergenic
962928321 3:140015149-140015171 AGGAAACCCCTACTCTTACAAGG + Intronic
964055264 3:152447770-152447792 AAGAAACCCCACCCCTTACCTGG - Exonic
966435942 3:179884160-179884182 AAAAACGCCCCCCTCTAATATGG + Intronic
970370653 4:15402608-15402630 AATAAAACCCTCCTCTTTCATGG + Intronic
970467571 4:16342321-16342343 CAAAAAGCCCCCTTCTTTCAAGG - Intergenic
972658329 4:41088579-41088601 AGGAAACCCTCCCTCTTCCAGGG + Intronic
975537939 4:75471770-75471792 AAGAAAGCCTCCCTCTTTCAGGG + Intergenic
976364059 4:84213659-84213681 ATGAAAGCCCACATCTTTCAAGG + Intergenic
985325491 4:188763685-188763707 AACAAAGCATACCTCTTACAAGG + Intergenic
986568770 5:9143901-9143923 AAGAAAGGCAGCCTCTTCCATGG + Intronic
986576784 5:9221186-9221208 AAGAATGCTCCCCTTTCACATGG - Intronic
990736357 5:58867575-58867597 AAAATAGCCCCTATCTTACAGGG + Intergenic
993029968 5:82694620-82694642 TAGAAGGGCCCCCTCTTACTAGG + Intergenic
995480849 5:112591453-112591475 AAAATAGCCCCCCTCTGGCAAGG + Intergenic
1000410513 5:160932077-160932099 AGGAATGCACTCCTCTTACAGGG + Intergenic
1002852082 6:1005339-1005361 AAGAAAATCCCCATCTTATACGG - Intergenic
1005196263 6:23287692-23287714 AAGCAAGGGCCCATCTTACATGG - Intergenic
1007187462 6:39984428-39984450 GAGAAGGGCCCCCTCTTCCAAGG - Intergenic
1007491648 6:42227805-42227827 AAGCAAGCCCTCGTGTTACACGG - Exonic
1014489759 6:122047185-122047207 CAGAAAGCCTCCCTCTTGCCAGG + Intergenic
1015427079 6:133083311-133083333 AAGAAAGGCCCCTGCTTCCATGG - Intergenic
1018795018 6:167179157-167179179 AAGAAAGCCCCCCACTTTACAGG - Intronic
1018821300 6:167375905-167375927 AAGAAAGCCCCCCACTTTACAGG + Intronic
1022325732 7:29330433-29330455 AAGAGAGTCCCCCGCTTAGATGG + Intronic
1023541715 7:41273162-41273184 AGGAATGACCCCCTCATACACGG - Intergenic
1035240995 7:157529139-157529161 AAGAAAGCCCCCCTCGTGGCTGG + Intergenic
1035548214 8:499924-499946 AAGAAAGTTCTCCTCTTCCACGG + Intronic
1035959929 8:4125811-4125833 AAGAAGACCCCCATCTTACCTGG + Intronic
1036807827 8:11847434-11847456 ACCAAAGCCCTCCTTTTACAAGG - Intronic
1039906277 8:41788757-41788779 CAGAAAGCCCCCATCTGGCAGGG - Intronic
1041728667 8:61043067-61043089 CATAAAGCCCTCCTCTAACAGGG - Intergenic
1045118918 8:99014061-99014083 AATAAAGCCCCCTTGTTTCAGGG - Intronic
1046102689 8:109632828-109632850 AAGGAAGTCCCCCTCATTCATGG - Intronic
1057877147 9:98766840-98766862 CAGAAAGCCTCCCTCATCCATGG - Intronic
1058762441 9:108147985-108148007 TAGGAAGCCCACCTCTGACAGGG + Intergenic
1185520371 X:734126-734148 CATAAAGACCCCCTTTTACATGG + Intergenic
1187351988 X:18527357-18527379 AAGAAAGCTCCATTCTCACATGG - Intronic
1190027664 X:46940618-46940640 AGGAAAGCCCAACTCTTACCAGG + Intronic
1193433913 X:81448428-81448450 AAGCAAACCTCCCTCTTACCTGG + Intergenic
1194554340 X:95338571-95338593 AAGCAAGGCACCTTCTTACAGGG + Intergenic
1194554740 X:95342308-95342330 GAGCAAGTCCCCATCTTACATGG - Intergenic
1196053660 X:111332300-111332322 CAGAAATGCCACCTCTTACAGGG + Intronic
1196786437 X:119425256-119425278 AAGAAAGCCCGCCTACCACAGGG + Intronic
1198045960 X:132902630-132902652 AAGAAGGCCCTCCTCTAACTGGG + Intronic
1199364158 X:146958660-146958682 AAGTAAGCCCTCCTTTTAAAAGG + Intergenic