ID: 1150488934

View in Genome Browser
Species Human (GRCh38)
Location 17:65561391-65561413
Sequence AAAGAAAGCCCCCCTCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488934_1150488938 -5 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488934_1150488937 -6 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488934_1150488942 26 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488942 17:65561440-65561462 CCACCCCCACCTTTTACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 187
1150488934_1150488943 27 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488943 17:65561441-65561463 CACCCCCACCTTTTACAGCAGGG 0: 1
1: 0
2: 3
3: 16
4: 161
1150488934_1150488936 -7 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488934 Original CRISPR AAAGAAAGCCCCCCTCTTAC AGG (reversed) Intronic
900382134 1:2390237-2390259 CAAGCCAGCCCTCCTCTTACTGG - Intronic
902759725 1:18573287-18573309 AGAGGAAGCCCTCCTCTTCCAGG + Intergenic
903766727 1:25739961-25739983 AAAGAAAGGCCCCCTCCAACTGG - Intronic
905332346 1:37213992-37214014 AAAGAAAACCCTGCTCTTAGAGG + Intergenic
907721929 1:56980215-56980237 GAAGAAAGCCCCCGTCCTTCTGG - Intergenic
907813233 1:57893299-57893321 AAATAAAGCCAGCCTCTGACTGG - Intronic
918247463 1:182672311-182672333 CAAGACAGCCCCCCTCCTCCTGG - Intronic
919081690 1:192874858-192874880 AAGGCAAGTTCCCCTCTTACTGG + Intergenic
922674176 1:227540975-227540997 AATGAAAGCCCCTCCCTGACTGG - Intergenic
922936925 1:229430371-229430393 AAAGAAACACCCCCTCGTGCAGG - Intergenic
1063497566 10:6524608-6524630 TGAGAAAGGTCCCCTCTTACAGG + Intronic
1067532580 10:47085350-47085372 AATGCAAGACCCCCTCTCACAGG - Intergenic
1070625105 10:78045465-78045487 AAAGAAAGCCCCCACCTGCCAGG - Intronic
1071439073 10:85674308-85674330 ATAGAAAGCCCCCCTCAGAACGG + Intronic
1071698707 10:87905433-87905455 AAAGAAAGCCCTGTTCTTATTGG + Intronic
1071844358 10:89506086-89506108 AGATAAAGCCCCCATCTTCCTGG + Intronic
1073327131 10:102649565-102649587 AGAGAAAGCCCCCCTTTGTCTGG - Intronic
1078458170 11:11491897-11491919 AAAGAAAGCCTACCCATTACAGG + Intronic
1080667695 11:34350239-34350261 AATCAAAGCCCCCTTCATACAGG + Intronic
1082279063 11:50250852-50250874 AAAGATGGCTCTCCTCTTACCGG + Intergenic
1082805463 11:57446632-57446654 AAAGAAAACCCAGCTCTAACTGG - Intergenic
1084039991 11:66537079-66537101 AGAGAAACCCACCCTCTGACAGG - Intronic
1084762387 11:71282402-71282424 AATGAAAGCCCACCTCTTCCAGG + Intergenic
1084996799 11:72988104-72988126 AAAGATAGCCCCCTCCTTACTGG + Intronic
1085196377 11:74674525-74674547 AAAAAAAGCACCACACTTACCGG + Intergenic
1086468691 11:87083140-87083162 TAAGTAAGCTGCCCTCTTACTGG - Intronic
1088915123 11:114221741-114221763 AAAGACTGCCTCCCTCTGACAGG - Intronic
1094808021 12:34109467-34109489 AATGAAAGCCCCTCCCTGACTGG + Intergenic
1095926985 12:47588330-47588352 AATGAAAGCCCACCACTTCCTGG - Intergenic
1098882879 12:75934726-75934748 AAAAAAAGCCTCCCTCTCTCAGG + Intergenic
1100164932 12:91906514-91906536 AAAGTAAGCCCTCCTCTCTCCGG + Intergenic
1105916108 13:24917854-24917876 AAAGAGAGCCTCTCTCTCACAGG - Intronic
1106836978 13:33645081-33645103 AAAGAGACTCCCCCTCTTAGTGG - Intergenic
1113248324 13:108423589-108423611 AAAGTAAACACTCCTCTTACAGG - Intergenic
1120882986 14:89428962-89428984 AAAGAAATCCCACCTGCTACTGG + Intronic
1122097109 14:99380412-99380434 AATGAAGACCCTCCTCTTACTGG - Intergenic
1122477041 14:102017483-102017505 GAAGAAAGCCCCTCTCACACAGG + Exonic
1123695993 15:22879834-22879856 AAAGAAAGCCCTCCCCTGGCCGG + Intronic
1125465550 15:39948128-39948150 AAAGAAAGCACAGCTCTTGCTGG - Intronic
1128577896 15:68788898-68788920 ATAAAAAGCCACCCTCTCACAGG + Intronic
1133452846 16:5918022-5918044 TAAGAAAGCCCTCCTTTCACAGG + Intergenic
1139275434 16:65723544-65723566 ACAGAAAGTCTCCCTTTTACTGG - Intergenic
1141150912 16:81564178-81564200 AAAGAATGCCGCCCTCACACAGG + Intronic
1141157512 16:81607401-81607423 AAAGCAAGCCTCCCTGTTTCTGG - Intronic
1141230109 16:82159117-82159139 AAAGAAAATCCCCCTCACACAGG - Intronic
1142247389 16:88976289-88976311 AAAGAGAGCCCTCCTCCTCCTGG - Intronic
1144433634 17:15219414-15219436 AAATAAAGTCCCCTTCTTATTGG - Intergenic
1148247575 17:46044642-46044664 AAACAAAGCCCCCTTCCTGCTGG + Intronic
1149333069 17:55606505-55606527 AAAGCAAGCCCCCCTTTTCTGGG + Intergenic
1149417932 17:56479773-56479795 AAGGAAAGCCCTCCTCTCAGGGG - Intronic
1150488934 17:65561391-65561413 AAAGAAAGCCCCCCTCTTACAGG - Intronic
1153547076 18:6219003-6219025 AATGAAAACCCACCTCTAACTGG + Intronic
1155378102 18:25184353-25184375 AAAGAAAACCCCCTTTCTACTGG + Intronic
1163785483 19:19272935-19272957 GAAGAACACCCCCCTCTAACCGG - Intronic
1164595632 19:29529305-29529327 AAGGAAAGCCACCCTGTCACCGG - Intronic
1164907513 19:31979250-31979272 AAATAAAGCCACCTTCTTCCCGG - Intergenic
1165232151 19:34393943-34393965 GAAGAACGCCCCCGTCTTGCTGG + Exonic
1166529895 19:43535730-43535752 TTAGAAATCCCACCTCTTACTGG - Exonic
1167884822 19:52492216-52492238 AAAGTAACACCCCCTCTCACAGG - Intronic
1167995281 19:53396834-53396856 ATAGAAAGCACCACTATTACTGG + Intronic
925580820 2:5408767-5408789 ATAAAAAGCCACCTTCTTACTGG + Intergenic
927478621 2:23433173-23433195 ATAGAAATCCACCCTCTTAGAGG - Intronic
931121734 2:59227071-59227093 CAAGAAAGCACCCCACTGACAGG - Intergenic
932619605 2:73257964-73257986 AAAGCAAGCCACCCTCCTCCTGG + Exonic
938772716 2:134513958-134513980 AAAGACAGCCCGCCTGCTACAGG - Intronic
940430458 2:153584091-153584113 AATGTAAGTCCCACTCTTACTGG + Intergenic
942120949 2:172776347-172776369 AAATAAATCCCACCTCTTAATGG + Intronic
945026855 2:205627929-205627951 AAAGTCAGCCTCCCTCTTGCAGG - Intergenic
946696802 2:222368149-222368171 AAAGAAACAACACCTCTTACAGG - Intergenic
948341860 2:237259330-237259352 AAAGCAAGACTCCGTCTTACAGG - Intergenic
1168957672 20:1845966-1845988 AAAGGAAGTGCCCCTCTTCCAGG + Intergenic
1171173077 20:23032962-23032984 AAAGAGAGGCCCCTGCTTACAGG - Intergenic
1176231142 20:64033542-64033564 AAAGAAAGAACGCCTCTTACTGG - Intronic
1176264204 20:64200223-64200245 AAAACAAGCCGCTCTCTTACCGG + Intronic
1180244443 21:46537690-46537712 AGAGAAAGCCCCCATATTCCTGG - Intronic
1181862315 22:25828666-25828688 AAACCAAGCTCACCTCTTACAGG - Intronic
949312910 3:2720344-2720366 AAAGAAAGCCACCTTCAGACAGG - Intronic
950332462 3:12167340-12167362 TAAGGAAGCCTCCCTCTCACTGG - Intronic
953095979 3:39777688-39777710 AAGGAATGACCACCTCTTACTGG - Intergenic
953149726 3:40313959-40313981 AAAGAAAGCACCCCTCATCCTGG + Intergenic
953900447 3:46838039-46838061 AAAGAAAGCCCCCCAGTACCAGG + Intergenic
958803554 3:98783077-98783099 AAAAAAAGCCCTTCTCTTTCGGG - Intronic
961166116 3:124765044-124765066 AAACAAAGCCTCATTCTTACAGG + Intronic
961349457 3:126290376-126290398 ACAGACAGACCCCCTCTTCCAGG - Intergenic
966043503 3:175520899-175520921 AAACAAAGCCCTACTTTTACGGG + Intronic
969449177 4:7263390-7263412 AAAGAAAGCACCCGTCATTCTGG + Intronic
971817609 4:31508810-31508832 AAAAAAAACACACCTCTTACTGG - Intergenic
973037418 4:45423662-45423684 TCAGAAAGCCCCACTCTTAGGGG - Intergenic
975318895 4:72987026-72987048 AAAGAAAGCCAGTCTCTTTCTGG - Intergenic
975537938 4:75471769-75471791 AAAGAAAGCCTCCCTCTTTCAGG + Intergenic
977848044 4:101789998-101790020 AAAGAAAGCCTTCCTTTTATAGG + Intronic
979483073 4:121240485-121240507 AAAGAAAGTCCAAATCTTACAGG - Intergenic
986028306 5:3871610-3871632 AAAGAAAGCCCCTCTGGCACAGG - Intergenic
986374503 5:7116201-7116223 AAAGAAAGAACACCTCTTATGGG - Intergenic
987294493 5:16537910-16537932 AAAGAAAGCCCACTTGATACAGG + Intronic
992452934 5:76889713-76889735 AAAGAAAGCCTCTCCTTTACTGG - Intronic
999044080 5:148448746-148448768 TAAGAAGGCCACCCTCTTCCAGG - Intergenic
1004471711 6:15935247-15935269 AAAGCAAGCCCACCACTTGCTGG - Intergenic
1008069125 6:47081610-47081632 AAATAAAGTCCCCCTCATATTGG + Intergenic
1012525288 6:100170026-100170048 GCAGAAAGACCCCCACTTACAGG + Intergenic
1016384246 6:143515456-143515478 AAAGAAAACCCGCCTTTTTCAGG + Intergenic
1016812474 6:148274489-148274511 AAAGAAAGCCTCTGTCTTGCTGG - Intronic
1022860295 7:34360283-34360305 AAAGAGAGCCTCCCTCCTGCAGG + Intergenic
1023007917 7:35894106-35894128 AAAGACGGCCCTCCTCTTATTGG - Intronic
1026425683 7:70290456-70290478 AAAGAAACTCTCCCTATTACTGG - Intronic
1027632734 7:80627448-80627470 AAAAAAAGCCCCTCTTTTAAGGG - Intronic
1028968365 7:96827919-96827941 AAATAAAGGCACCCTCTTCCTGG - Intergenic
1029422020 7:100476803-100476825 AAAGAAAGACCCCCACATTCAGG + Intronic
1034255491 7:149722551-149722573 AAGGAAAGCCCGCCTCTCACCGG - Exonic
1034958952 7:155352380-155352402 AAAGACAGCCCTCCTCTTACAGG - Intergenic
1037122035 8:15300229-15300251 ACAGAAAGTCCCCATCTTATGGG - Intergenic
1037629782 8:20644295-20644317 AAAGAAAGACATCCTCTCACAGG - Intergenic
1038497549 8:28014545-28014567 AGAGTAAGCCCTCCTCATACAGG + Intergenic
1043270435 8:78326605-78326627 AAAGAAAGCTCCCCTCTGCAGGG - Intergenic
1044226133 8:89720744-89720766 AAAGAAATCCCCATTCTAACTGG + Intergenic
1045118919 8:99014062-99014084 AAATAAAGCCCCCTTGTTTCAGG - Intronic
1050697550 9:8295776-8295798 AAAGAAAGCGATCCTTTTACAGG + Intergenic
1058099596 9:100904442-100904464 AAAAAAAGCCACCCTTTTTCAGG + Intergenic
1059259757 9:112964239-112964261 AAAACAAGCCCCACTCTTCCTGG + Intergenic
1061651637 9:132054989-132055011 AAAGAAAGCGCCCTTCTGAGAGG - Intronic
1192553415 X:72071135-72071157 AAACAAAGCCCTGCTCTGACAGG - Intergenic
1196175608 X:112636180-112636202 AAAGCAACCTCCCCTCATACCGG - Intronic
1198045959 X:132902629-132902651 CAAGAAGGCCCTCCTCTAACTGG + Intronic
1201422281 Y:13812468-13812490 AAAGAAAGCCACCAGCTAACTGG - Intergenic
1202086983 Y:21148520-21148542 AAAGAATGTCCCTCTCTAACAGG + Intergenic
1202335213 Y:23801516-23801538 AAATAAATCCCCCCTCTCCCTGG + Intergenic
1202535554 Y:25868543-25868565 AAATAAATCCCCCCTCTCCCTGG - Intergenic