ID: 1150488936

View in Genome Browser
Species Human (GRCh38)
Location 17:65561407-65561429
Sequence TTTCTTTGAAGCGGCTCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488932_1150488936 -5 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488918_1150488936 30 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488923_1150488936 22 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488922_1150488936 23 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488929_1150488936 1 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488934_1150488936 -7 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488931_1150488936 -4 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488924_1150488936 17 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488919_1150488936 29 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488921_1150488936 28 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488933_1150488936 -6 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488936 Original CRISPR TTTCTTTGAAGCGGCTCCGC TGG Intronic
910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
919441703 1:197642353-197642375 TTTCTTTCAAGTGGCTCCAATGG + Intronic
1063497715 10:6525764-6525786 TTTCTTTGAGGGGGATCTGCTGG + Intronic
1092000938 12:5031777-5031799 TTTCTTTGAAGAGCCTTTGCAGG + Intergenic
1096938467 12:55311801-55311823 TTTCTTTCAAGAAGATCCGCTGG - Intergenic
1103206884 12:119136771-119136793 TTTCTTTGAAGCCTCTCCTGAGG - Intronic
1108056743 13:46492874-46492896 TTTCTTTAGAGCAACTCCGCAGG + Intergenic
1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG + Intronic
1113994577 14:16055687-16055709 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1124621023 15:31273970-31273992 TTTCTGTCAAGAGGCTCCCCTGG - Intergenic
1136913304 16:34161152-34161174 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1138196632 16:55057138-55057160 TTTCTTGGCAGAGGTTCCGCGGG - Intergenic
1148145463 17:45361827-45361849 TTTCTTTGAAGGGGCTTCTGGGG - Intergenic
1148376711 17:47154672-47154694 CTTTTTTGAAGGGGCTCCGGTGG + Exonic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1152736708 17:82000825-82000847 TGTCTTTGAAGTGCCTCCACTGG + Intronic
1153412351 18:4807935-4807957 TTTCTTTGTCGCTGCTTCGCAGG - Intergenic
1156588451 18:38459206-38459228 TTTCTTTGGAGCGGCTTCAAAGG + Intergenic
1161091387 19:2361451-2361473 TTACTCAGAAGCGGCTCCGAGGG - Intergenic
1164680110 19:30128508-30128530 TGTCTTGGAAGTGTCTCCGCAGG - Intergenic
932269592 2:70398089-70398111 TTTTTTTGAAACGGCTCAGTGGG - Intergenic
938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG + Intronic
941159982 2:162024873-162024895 TTTCTTTGCAGTGGCTCAGGAGG - Exonic
944920451 2:204407521-204407543 GTTCTTTGAAGCGGCTTCCTGGG - Intergenic
945200436 2:207275656-207275678 TGTCTTTGAAGGAGCTACGCTGG - Intergenic
945675301 2:212849081-212849103 TTTCTTTTATCCAGCTCCGCTGG - Intergenic
945889954 2:215419835-215419857 TTTCTTAGAAGCTGCTCAGCAGG - Intronic
1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG + Intronic
1171811490 20:29747113-29747135 CTTTTTTGAAGGGGCTCCGGTGG - Intergenic
1171865795 20:30486842-30486864 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1171867043 20:30493907-30493929 CTTTTTTGAAGGGGCTCCGGTGG - Intergenic
1175190313 20:57207602-57207624 GTCCTTTGAAGCGGCTGTGCAGG - Intronic
1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1180342738 22:11630668-11630690 TTTCTTGGAAGCTGCCCAGCGGG - Intergenic
1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG + Intronic
1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG + Intergenic
961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG + Exonic
966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG + Intergenic
969819737 4:9710757-9710779 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
985150909 4:186946169-186946191 TTTCTCTGATGCTGCTCTGCTGG - Intergenic
997191934 5:131945610-131945632 TTGCTGTGAGGCTGCTCCGCGGG - Intronic
1001070296 5:168579535-168579557 TTTGTTTGGAGCGGCTGCGGGGG - Exonic
1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG + Intronic
1011662223 6:89604477-89604499 TTTCTTTAAAGAGGCTATGCTGG + Intronic
1019998233 7:4738929-4738951 TTCCTTTGAAGCGGGTCCCTGGG + Intronic
1035764402 8:2094227-2094249 TTTCTTTGAAGCCTCTCGGTTGG + Intronic
1036381945 8:8241348-8241370 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
1042523416 8:69738832-69738854 TTTCTTGGAGGCAGCTCAGCAGG - Intronic
1054148471 9:61581607-61581629 TTTCTTTGAAGGAGCTTTGCTGG + Intergenic
1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG + Exonic
1058070787 9:100598812-100598834 TCTCTTGAAACCGGCTCCGCGGG + Intergenic
1203474692 Un_GL000220v1:141109-141131 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1203361015 Un_KI270442v1:219180-219202 TTTCTTGGAAGCTGCCCAGCGGG + Intergenic
1195957432 X:110346874-110346896 TTTCTTCGTAGCGGCGACGCTGG + Exonic
1200155263 X:153971704-153971726 GCTCTTTGAAGCGGCTCCTGTGG - Exonic
1201245557 Y:12000041-12000063 TTTCTTTGTAGTGTCTCTGCCGG + Intergenic