ID: 1150488936

View in Genome Browser
Species Human (GRCh38)
Location 17:65561407-65561429
Sequence TTTCTTTGAAGCGGCTCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488931_1150488936 -4 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488918_1150488936 30 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488934_1150488936 -7 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488924_1150488936 17 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488929_1150488936 1 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488932_1150488936 -5 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488933_1150488936 -6 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488921_1150488936 28 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488923_1150488936 22 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488919_1150488936 29 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488922_1150488936 23 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488936 Original CRISPR TTTCTTTGAAGCGGCTCCGC TGG Intronic