ID: 1150488938

View in Genome Browser
Species Human (GRCh38)
Location 17:65561409-65561431
Sequence TCTTTGAAGCGGCTCCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488924_1150488938 19 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488929_1150488938 3 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488932_1150488938 -3 Left 1150488932 17:65561389-65561411 CCCCTGTAAGAGGGGGGCTTTCT 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488921_1150488938 30 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488931_1150488938 -2 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488933_1150488938 -4 Left 1150488933 17:65561390-65561412 CCCTGTAAGAGGGGGGCTTTCTT 0: 1
1: 0
2: 1
3: 1
4: 130
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488934_1150488938 -5 Left 1150488934 17:65561391-65561413 CCTGTAAGAGGGGGGCTTTCTTT 0: 1
1: 0
2: 2
3: 6
4: 118
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488922_1150488938 25 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488923_1150488938 24 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488938 Original CRISPR TCTTTGAAGCGGCTCCGCTG GGG Intronic