ID: 1150488972

View in Genome Browser
Species Human (GRCh38)
Location 17:65561540-65561562
Sequence CGGGCTGTTACTGAGTTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488966_1150488972 14 Left 1150488966 17:65561503-65561525 CCATCGCTCTGAGGGGTTATTTT 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1150488972 17:65561540-65561562 CGGGCTGTTACTGAGTTGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 133
1150488964_1150488972 21 Left 1150488964 17:65561496-65561518 CCGAAATCCATCGCTCTGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1150488972 17:65561540-65561562 CGGGCTGTTACTGAGTTGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 133
1150488962_1150488972 22 Left 1150488962 17:65561495-65561517 CCCGAAATCCATCGCTCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1150488972 17:65561540-65561562 CGGGCTGTTACTGAGTTGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 133
1150488960_1150488972 23 Left 1150488960 17:65561494-65561516 CCCCGAAATCCATCGCTCTGAGG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1150488972 17:65561540-65561562 CGGGCTGTTACTGAGTTGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488972 Original CRISPR CGGGCTGTTACTGAGTTGCC AGG Exonic
901016064 1:6231514-6231536 CAGGGTCTTACTGTGTTGCCTGG - Intronic
901156214 1:7141236-7141258 TGGGCTCTTCCTGACTTGCCAGG + Intronic
901457575 1:9372064-9372086 CGGGCTGATAATGATTTTCCTGG + Intergenic
903760196 1:25692415-25692437 CGGGGTCTTGCTGTGTTGCCTGG + Intronic
904817598 1:33217169-33217191 GGTGCTGTTACTGATTTGCTGGG - Intergenic
905226215 1:36480918-36480940 CAGGCTGTTCCCTAGTTGCCAGG - Intronic
907132885 1:52112415-52112437 CAGGGTGTTACTATGTTGCCTGG + Intergenic
910742470 1:90535074-90535096 CTGGCTGTTACTGAGTTGAGAGG - Intergenic
913027806 1:114863525-114863547 CGGGCTCTTGCTCTGTTGCCAGG - Intronic
915182344 1:154073266-154073288 CGGGGTCTCACTGTGTTGCCAGG + Intronic
915834817 1:159168289-159168311 CAGGCTGTTGCTGAGTGGACAGG + Intergenic
921011844 1:211149456-211149478 CGGGGTCTGACTGTGTTGCCAGG - Intergenic
921590268 1:216994776-216994798 CGGGCTTTCACTGTGTTACCGGG + Intronic
921902915 1:220467323-220467345 CGGGGTTTCACTGAGTTGGCCGG - Intergenic
923036817 1:230290302-230290324 AGGGTTATTACTGAGTTGCATGG + Intergenic
923881797 1:238111597-238111619 AGGGCTGTTACTGAATTTGCAGG + Intergenic
924830635 1:247590851-247590873 CGGAGTGTTACTCTGTTGCCAGG - Intergenic
1073289213 10:102405137-102405159 GGGGCTGGGACTGAGTTGGCTGG - Intronic
1073841132 10:107500442-107500464 TGGGGTGTTGCTGTGTTGCCCGG + Intergenic
1080538264 11:33243276-33243298 CGGGGTTTTACTGTGTTGGCCGG + Intergenic
1086368546 11:86133192-86133214 CGGGTTTTTGCTGTGTTGCCCGG - Intergenic
1088261173 11:107945289-107945311 CGGGGTTTTGCTGTGTTGCCAGG - Intronic
1089971975 11:122701091-122701113 CGGGCTGCTACTAATTTGCATGG + Intronic
1090800104 11:130165286-130165308 CAGGTTGTTTCTGAGATGCCTGG + Intronic
1093953480 12:25191220-25191242 CGGGGTCTTCCTGTGTTGCCCGG - Intronic
1094349470 12:29507718-29507740 ATAGCTGTGACTGAGTTGCCAGG - Intronic
1096338663 12:50778104-50778126 CGGGCTCTCACTATGTTGCCAGG + Intronic
1097373231 12:58809705-58809727 AGGGCTGGTACAGAGTGGCCTGG - Intronic
1098359740 12:69642729-69642751 CATGCTGTTCCTGAGTTGTCTGG + Intergenic
1101825813 12:108219124-108219146 CGGGCTCTCTCTGGGTTGCCTGG - Intronic
1102501867 12:113358693-113358715 CGGGCCGTTCCTGAGCGGCCTGG + Exonic
1103310115 12:119999034-119999056 CAGGCTGTCACTCTGTTGCCCGG - Intronic
1104720103 12:131040605-131040627 GGGGCTGTTTCTGAGCTGCCCGG - Intronic
1104989374 12:132616563-132616585 CGGGGTTTCACTGTGTTGCCTGG - Intergenic
1106257486 13:28034762-28034784 CGGGATTTCACTGTGTTGCCTGG - Intronic
1107124199 13:36828151-36828173 CTGGCTTTTAGTGAGTGGCCAGG + Exonic
1107636690 13:42399310-42399332 CATGCTGTAATTGAGTTGCCAGG + Intergenic
1108526058 13:51286990-51287012 CGGGGTTTCACTGTGTTGCCAGG - Intergenic
1110707701 13:78613676-78613698 CAGGCTGGTACTGAATTCCCAGG - Intergenic
1113859084 13:113469487-113469509 CGGAGTTTTACTGTGTTGCCCGG - Intronic
1115836245 14:37408061-37408083 CAGGCTCTTACTATGTTGCCTGG + Intronic
1116408988 14:44600967-44600989 CGGGGTTTTGCTGTGTTGCCCGG + Intergenic
1121799395 14:96761173-96761195 CGGGGTCTCACTGTGTTGCCTGG + Intergenic
1123022037 14:105403613-105403635 TGGGGTCTTACTGTGTTGCCTGG + Intronic
1125697703 15:41652561-41652583 CGGGGTCTCACTGTGTTGCCAGG + Intronic
1127394208 15:58530385-58530407 CAGGCTGTTTCTGAGTTTTCTGG - Intronic
1127729987 15:61790964-61790986 CTGGCTTTTACAGAGTTCCCAGG + Intergenic
1127929512 15:63583021-63583043 AGGGCTACTACTGAGTTGGCAGG - Intronic
1128560147 15:68659520-68659542 GGGGCTCTTACTGTGTTGCCTGG - Intronic
1128663217 15:69518199-69518221 TGGGCTGTTACTGAGCTCACTGG - Intergenic
1131232446 15:90669519-90669541 TGGGGTGTCACTGTGTTGCCCGG + Intergenic
1132801007 16:1753308-1753330 TAGGCTGTTGCTGTGTTGCCAGG + Intronic
1135534983 16:23286898-23286920 CGGGCTCTTTCTGTGTTGCCAGG - Intronic
1135863188 16:26076256-26076278 CGTGCTCCTACTGAATTGCCAGG - Intronic
1137302256 16:47162995-47163017 CGGGGTCTTACTATGTTGCCCGG + Intronic
1139654430 16:68378704-68378726 AGGGCTGGTGCTGAGTGGCCTGG - Intronic
1140453495 16:75090406-75090428 CGGGGTCTCACTGTGTTGCCCGG + Intronic
1141284687 16:82660536-82660558 CGGGCTGTTTCTGTTTTGCCAGG - Intronic
1142980158 17:3666919-3666941 AGGGCTGTCACTGATTTGCTGGG + Intronic
1144436286 17:15245649-15245671 CAGGCTGTTATTGAGGGGCCAGG + Intronic
1144678928 17:17180060-17180082 CCTGATGTTTCTGAGTTGCCGGG - Exonic
1147056464 17:37838951-37838973 CGGGCTGTAACTGTGTTCACTGG + Intergenic
1148949737 17:51300396-51300418 CGGAGTGTCACTGTGTTGCCAGG - Intergenic
1149918577 17:60634968-60634990 CGGGGTCTCACTGTGTTGCCCGG + Intronic
1150488972 17:65561540-65561562 CGGGCTGTTACTGAGTTGCCAGG + Exonic
1151709718 17:75796516-75796538 CAGGTTCTTACTGTGTTGCCAGG + Intronic
1152534932 17:80945101-80945123 CAGGGTCTTACTGTGTTGCCCGG - Intronic
1158920704 18:62187850-62187872 CGAGCTGTTAGAGAGTGGCCGGG + Exonic
1162770598 19:12947008-12947030 CGGGGTCTCACTGTGTTGCCAGG - Intronic
1167549082 19:50147185-50147207 CGGGGTCTCACTGTGTTGCCCGG - Intergenic
925257476 2:2502587-2502609 CAGGCTGCCACTGACTTGCCTGG + Intergenic
929009057 2:37423322-37423344 AGGCCTGTTACTGAAATGCCAGG + Intergenic
929196338 2:39188534-39188556 CGGACTGTCACTCTGTTGCCAGG - Intronic
932136730 2:69237610-69237632 CGGGGTCTCACTGTGTTGCCAGG + Intronic
932535858 2:72594171-72594193 CAGGGTGTTACTATGTTGCCCGG + Intronic
933200325 2:79440599-79440621 ATGGCTGTTACTGAGTTGCCAGG - Intronic
933923851 2:87075515-87075537 CGGGCGGTGACTGAATCGCCTGG - Intergenic
934158895 2:89229639-89229661 AGGGCTCTTTCTCAGTTGCCTGG - Intergenic
934208379 2:89952789-89952811 AGGGCTCTTTCTCAGTTGCCTGG + Intergenic
935596386 2:104881354-104881376 GGGGGTATCACTGAGTTGCCTGG + Intergenic
938290893 2:130149860-130149882 CGGGGTCTCACTGTGTTGCCAGG - Intergenic
942162589 2:173207299-173207321 CGGGGTTTCACTGTGTTGCCTGG - Intronic
942913300 2:181272069-181272091 CGGGGTTTCACTGTGTTGCCAGG - Intergenic
943715956 2:191151956-191151978 TGGGATTTTACTGTGTTGCCTGG - Intergenic
946033664 2:216724864-216724886 CGGGGTTTCACTGTGTTGCCAGG - Intergenic
947868039 2:233414979-233415001 CGGGGTCTTGCTGTGTTGCCTGG + Intronic
1169126196 20:3128669-3128691 CGGGGTCTTGCTGTGTTGCCCGG - Intronic
1172417950 20:34787331-34787353 CGGGGTCTTACTGTGTTGGCAGG - Intronic
1176275688 20:64266577-64266599 TGGGCTCTCACTGTGTTGCCTGG + Intronic
1176545876 21:8198486-8198508 CGGGGTCTCACTGTGTTGCCAGG + Intergenic
1176564827 21:8381531-8381553 CGGGGTCTCACTGTGTTGCCAGG + Intergenic
1177864070 21:26491914-26491936 AGGGCTGTCAGTGATTTGCCTGG + Intronic
1178337003 21:31752258-31752280 CAGGCTGGTCCTGGGTTGCCTGG - Intergenic
1178787014 21:35663254-35663276 AGGGCTGTACCTGAGCTGCCTGG - Intronic
1178818022 21:35949447-35949469 CAGGGTCTTACTGTGTTGCCTGG - Intronic
1179490314 21:41736981-41737003 CAGGCTGTTTCTGACTTGGCTGG + Intergenic
1180169951 21:46052940-46052962 CGGGCAGTGACTGAGATGCAGGG - Intergenic
1182526067 22:30920627-30920649 CGGGCTGTTTCTGATATGCGTGG - Intergenic
1203250747 22_KI270733v1_random:114723-114745 CGGGGTCTCACTGTGTTGCCAGG + Intergenic
949552751 3:5124666-5124688 CGGGCTCTTGCTATGTTGCCAGG + Intronic
951619105 3:24581243-24581265 CTGGCTGTTATTGAGTCTCCAGG - Intergenic
952260650 3:31736870-31736892 CAGGGTCTTACTGTGTTGCCTGG - Intronic
953626690 3:44577997-44578019 CCTGATGTTTCTGAGTTGCCAGG + Intronic
955011420 3:55018971-55018993 TGGGGTCTTACTGTGTTGCCTGG + Intronic
955811218 3:62792393-62792415 CAGGGTCTTACTAAGTTGCCAGG + Intronic
962227277 3:133624447-133624469 CGGGGTCTTGCTGTGTTGCCTGG - Intronic
969375458 4:6760683-6760705 CGGGCTGTGTGTGAGGTGCCCGG - Intergenic
972137092 4:35905741-35905763 CGGGGTTTCACTGCGTTGCCCGG + Intergenic
973133928 4:46682633-46682655 CGGGGTTTTGCTGTGTTGCCAGG - Intergenic
975139858 4:70907834-70907856 CTGGGTGTTACTGTGTTGCCCGG + Intronic
975646639 4:76552314-76552336 TGGGCTTTTGCTGTGTTGCCTGG - Intronic
985737878 5:1594961-1594983 CGGGATCTTGCTGTGTTGCCCGG + Intergenic
987181880 5:15376326-15376348 AGGGCTATTACTGAGATGCCAGG + Intergenic
990650884 5:57898246-57898268 CAGGGTGTTACTCTGTTGCCCGG + Intergenic
994364430 5:98896010-98896032 CAGGGTTTTACTGTGTTGCCAGG - Intronic
997440381 5:133905014-133905036 TGGGCTGATACTGAGTTGTCAGG - Intergenic
1000699573 5:164431792-164431814 TGTGCTGTTACTGATGTGCCAGG - Intergenic
1002895423 6:1377414-1377436 CGGGGTTTCACTGTGTTGCCAGG + Intergenic
1006704280 6:36004265-36004287 CAGGGTGTCACTGTGTTGCCAGG + Intronic
1019538739 7:1541955-1541977 GGGGCTGTTACTGGGTGGGCAGG - Exonic
1019826574 7:3289512-3289534 TGGGGTCTTACTGTGTTGCCAGG + Intergenic
1020119825 7:5496689-5496711 CGGGGTCTTGCTGTGTTGCCCGG - Intronic
1029167580 7:98604364-98604386 CAGGGTCTTACTTAGTTGCCCGG + Intergenic
1029602616 7:101577671-101577693 TGGGGTGTCACTGTGTTGCCCGG + Intergenic
1030584622 7:111402518-111402540 CGGGGTTTCACTGTGTTGCCTGG - Intronic
1032125358 7:129189122-129189144 GGGGCTTTTGCTGAGTTGGCGGG + Exonic
1033185571 7:139225055-139225077 CGGGGTTTTACTGTGTTGACCGG + Intergenic
1035924244 8:3710445-3710467 CAGTCGGTTACTGAGTTGGCTGG - Intronic
1037558382 8:20049266-20049288 CGTTCTGTTACTGAAATGCCAGG - Intergenic
1042878239 8:73459748-73459770 CGGGCTGTTACTAAGGGCCCTGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047484418 8:125315995-125316017 CGAGCTCTCACTGTGTTGCCCGG + Intronic
1049591944 8:143466647-143466669 CGGGCTCTTCCTGGGCTGCCTGG + Intronic
1058378487 9:104352787-104352809 CAGGGTGTTACTAGGTTGCCCGG - Intergenic
1203467148 Un_GL000220v1:97991-98013 CGGGGTCTCACTGTGTTGCCAGG + Intergenic
1185796215 X:2967126-2967148 TGGGCTGCTTCTGACTTGCCTGG + Intronic
1187061617 X:15791994-15792016 CGGGATTTCACTGTGTTGCCTGG + Intronic
1187066999 X:15850550-15850572 CGGGGTCTCACTAAGTTGCCAGG + Intronic
1187156933 X:16728845-16728867 CGGGCTTTCACTGTGTTGCCTGG - Intronic
1190369393 X:49726830-49726852 CCTGCTGTTTCTGAGTTGGCAGG + Intergenic
1192504294 X:71671578-71671600 CGGGGTGTTGCTGTGTTCCCTGG + Intergenic
1196060112 X:111398920-111398942 CGGGTTTTCACTGTGTTGCCCGG - Intronic
1201279484 Y:12329043-12329065 TGGGCTGCTTCTGACTTGCCTGG - Intergenic
1201542764 Y:15126199-15126221 CAGGCTGTTCTTGAGCTGCCAGG - Intergenic