ID: 1150490970

View in Genome Browser
Species Human (GRCh38)
Location 17:65574073-65574095
Sequence CCTGATGCCCAGGGAATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150490970 Original CRISPR CCTGATGCCCAGGGAATACC TGG Intronic
900713875 1:4131804-4131826 CCTGATGCCCAGGGCCTAGATGG + Intergenic
900820014 1:4879397-4879419 CCTGTTGCCCCGAGAGTACCGGG - Intergenic
901560800 1:10068757-10068779 CCTGAGGCCCTGGGAATATCTGG - Intronic
901733255 1:11295657-11295679 ATTGAGGCCAAGGGAATACCAGG + Intronic
902781955 1:18710808-18710830 CCTGACGCCCTGGTAATGCCAGG - Intronic
904602160 1:31679657-31679679 CCTGGTGGTCCGGGAATACCTGG + Exonic
905018137 1:34791478-34791500 CCTGGGGCCCAGGGAATCCAAGG + Intronic
905174749 1:36128244-36128266 CCTGATGGCCAATGAACACCAGG - Intergenic
905199294 1:36305764-36305786 CCTAACTCCCAGGGAAAACCTGG + Intergenic
905884082 1:41482399-41482421 CCTGCTCCCCAGGGCATGCCCGG + Intronic
905928093 1:41766225-41766247 TCTGATTCCCAGGGGATATCTGG + Intronic
907888849 1:58619267-58619289 ACTGATGCCCAGGGAACAACAGG + Intergenic
908331939 1:63079707-63079729 ACTGATGCCCACGGCATGCCAGG + Intergenic
909512525 1:76470748-76470770 ACTGAGGCCAAGAGAATACCTGG + Intronic
909896325 1:81074695-81074717 CCAGATTCCCAGGGCACACCTGG + Intergenic
914948309 1:152086471-152086493 CCTGAGGCCCATGGAACAGCAGG - Exonic
915066063 1:153225076-153225098 CAGGCTGCCCAGGGAATACAGGG + Intergenic
915605423 1:156947346-156947368 CCTGATGCCCCGGGAGGAGCTGG - Exonic
916581145 1:166110314-166110336 CATGATACCCAGGGAATAGCAGG - Intronic
916625995 1:166555358-166555380 TTTGATGCCCATGGAATATCTGG + Intergenic
920067950 1:203282424-203282446 CCCCAGGCCCAGGGAATGCCTGG - Intergenic
921887065 1:220317581-220317603 TGTGATGCCCAGGGAAGACAGGG - Intergenic
924363293 1:243263555-243263577 ACTGATGCCAAAGAAATACCAGG + Intronic
924784677 1:247184052-247184074 GCTGATGCCCAGGTTATAGCGGG + Intergenic
1065798378 10:29328359-29328381 CCTGAGGTCCAGGGAAAAACAGG - Intergenic
1066537533 10:36408071-36408093 TCTGTTGCCCAGGGAGTAGCTGG + Intergenic
1067054717 10:43043941-43043963 CCTGCTGTCCAGGGAATTCCCGG - Intergenic
1074699983 10:116084152-116084174 TCTGATGGCCAGAGAAGACCAGG + Intronic
1075746272 10:124730135-124730157 TCTGATGCCCATGGAAAACATGG + Intronic
1076744903 10:132507974-132507996 CCTGATGTCCAGGCCATGCCCGG + Intergenic
1078661497 11:13290477-13290499 CATGCTGTCCAGGTAATACCTGG + Intronic
1079244347 11:18742155-18742177 CCTGGTGCCCAGGGCAGAGCTGG - Intronic
1079396083 11:20064885-20064907 CCTGATGCCAAGGGCAAAACTGG - Intronic
1081544084 11:44057529-44057551 CCTGATGCTCAGGCTATATCAGG - Intronic
1081758758 11:45562445-45562467 CCTGATGGGGAGGGAATCCCAGG - Intergenic
1083108120 11:60378000-60378022 CCTCATGCTCAGGGAAGTCCAGG - Intronic
1083186928 11:61022994-61023016 AGTGATGCACAGGGAATTCCTGG + Intergenic
1083282638 11:61636676-61636698 CGTGATGCCCAGGGAAGACAGGG + Intergenic
1083475570 11:62912880-62912902 CCAGGTGCCCAAGGAACACCAGG - Intronic
1083840698 11:65302499-65302521 CCTGATTCCCAGCGAATAGGGGG + Intronic
1088182348 11:107126983-107127005 TCTGATACCCAGGCAATTCCAGG + Intergenic
1088582337 11:111328215-111328237 CCTGATGCCCACGGCCTGCCAGG + Intergenic
1088908986 11:114176402-114176424 CCCGAGTTCCAGGGAATACCTGG - Intronic
1091640730 12:2235153-2235175 CCTGCTCCCGGGGGAATACCTGG + Intronic
1092297164 12:7209795-7209817 GCTGATGCCCAGGTTATAGCGGG - Exonic
1092956779 12:13558567-13558589 CCTGATGGCCACGGAAGACCGGG + Exonic
1097377230 12:58855617-58855639 CCTTATGCCAAGGGAATCACTGG - Intergenic
1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG + Intergenic
1102108689 12:110347908-110347930 CCTGATGCCCTGTGAGCACCGGG + Intronic
1102351346 12:112194425-112194447 TCTGATCCCCAGTGAATGCCAGG - Intronic
1103337475 12:120200765-120200787 CGTGATGCCCAGGGAAGACAGGG - Exonic
1103898176 12:124288137-124288159 CCTGCTGGCCAGGGAAGACATGG + Intronic
1104651616 12:130538842-130538864 CCCGATCCCCAGGCAATACGGGG - Intronic
1105242275 13:18619344-18619366 CCTGATGCCCTGGGAAGGACAGG + Intergenic
1105779932 13:23696728-23696750 CTTGAGGCCCAGGGAATCACAGG + Intergenic
1107101446 13:36597792-36597814 CCAGGGGCCCAGGGAAAACCTGG + Intergenic
1109436657 13:62312292-62312314 CTTGATGCCCTCAGAATACCAGG + Intergenic
1112318081 13:98382423-98382445 CCTGATGCCAAAGGAAAAACTGG + Intronic
1113230922 13:108214519-108214541 ACGGATTCCCAGTGAATACCTGG + Exonic
1113794383 13:113048802-113048824 CGTGATGCCCAGGCAGTGCCTGG - Intronic
1114914231 14:27241970-27241992 CCAGTTGCCCAGTGAAAACCTGG - Intergenic
1115648889 14:35389051-35389073 CGTGATGCCCAGGGAAGACAGGG - Intergenic
1115961394 14:38838295-38838317 GCTGAGGCCCAGGGAACACAGGG + Intergenic
1117336021 14:54757996-54758018 CCTGCTGCCCACGGTAGACCCGG - Intronic
1117882295 14:60323826-60323848 CCTCAGCCCCAGGGAACACCAGG - Intergenic
1120324357 14:83006470-83006492 CCAGAGGCTCAGGGAATAGCTGG - Intergenic
1122081193 14:99269011-99269033 CCTGATGTCCCAGGAATGCCAGG + Intronic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122883590 14:104700782-104700804 ACTGAGGCCCAGGGGAGACCTGG + Intronic
1123489038 15:20765251-20765273 CCTGATGCCCTGGGAAGGACAGG - Intergenic
1123545537 15:21334338-21334360 CCTGATGCCCTGGGAAGGACAGG - Intergenic
1124218293 15:27827377-27827399 CCTGGTGCTCAGGTAATTCCGGG + Intronic
1124593612 15:31075964-31075986 CCAGATGCCCAGGCAATAGAGGG - Intronic
1126533513 15:49735180-49735202 CTTGTTGCCCAGGAAACACCTGG + Intergenic
1129642084 15:77390895-77390917 ACAGATGCCCTGGGAATTCCAGG + Intronic
1129954520 15:79623136-79623158 CCTAATGCCAAGAGAATATCAGG + Intergenic
1130250661 15:82298502-82298524 CCTTAGGCCCAGGGCAGACCGGG - Intergenic
1132083632 15:98888123-98888145 CCAGAAGCCCAGGAAACACCAGG + Intronic
1132374809 15:101322058-101322080 CCTGATGAACAGGGAGAACCAGG + Intronic
1202953882 15_KI270727v1_random:61608-61630 CCTGATGCCCTGGGAAGGACAGG - Intergenic
1133080222 16:3312858-3312880 CCAGTTGCCCAGAGAACACCCGG - Intronic
1134426420 16:14151760-14151782 ACTGATGCCCAGAGAATGCTAGG - Intronic
1134489790 16:14688111-14688133 CAGGATGCCCAGGGGATACTCGG + Intronic
1134495170 16:14727228-14727250 CAGGATGCCCAGGGGATACTCGG + Intronic
1135142759 16:19935835-19935857 GCTGCTGCCCAGGGAGTCCCTGG + Intergenic
1135448368 16:22537424-22537446 CAGGATGCCCAGGGGATACTCGG + Intergenic
1137725410 16:50653487-50653509 CCTGATCCCCAAGGCATCCCTGG - Intergenic
1138435507 16:56997303-56997325 CCTGATGCCCAGCCTATGCCGGG + Intronic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1138777549 16:59742177-59742199 CCTGATACCCAAAGAAGACCAGG + Intronic
1139855352 16:69975376-69975398 CAGGATGCCCAGGGGATACTCGG - Intergenic
1139885068 16:70202491-70202513 CAGGATGCCCAGGGGATACTCGG - Intergenic
1140367448 16:74393022-74393044 CAGGATGCCCAGGGGATACTCGG + Intergenic
1141733158 16:85835593-85835615 CCTGCTGCCCAGGCACGACCTGG - Intergenic
1144682532 17:17205342-17205364 CCTGCTGCCCAGTGAATCTCAGG - Intronic
1147600187 17:41740373-41740395 CCTGCTGGACAGGCAATACCAGG + Intergenic
1147795834 17:43042148-43042170 CCTGCTGCCCAGGGAATGTGGGG - Intergenic
1149560452 17:57604665-57604687 CCTTCAGCCCAGGGCATACCTGG + Intronic
1150490970 17:65574073-65574095 CCTGATGCCCAGGGAATACCTGG + Intronic
1150669287 17:67176633-67176655 CATGTTGCCCAGGGAAGATCTGG - Intronic
1151682979 17:75631386-75631408 CCTGGCGCCAAGGGAATGCCAGG + Intronic
1151718224 17:75842379-75842401 CCTGCTACCCAGGAAAGACCTGG + Intronic
1152128719 17:78462999-78463021 CGAGATGTCCAGGGTATACCTGG - Exonic
1152277223 17:79364900-79364922 CCTGGTGCCCAGGGAGTGGCTGG + Intronic
1152802778 17:82339662-82339684 CCTGATTCTCTGGGAATTCCAGG - Intergenic
1154446674 18:14440534-14440556 CCTGATGCCCTGGGAAGGACAGG - Intergenic
1155672505 18:28388628-28388650 CCTGTTGCCCTGGAAATGCCTGG + Intergenic
1157783142 18:50457883-50457905 TGTGATGCCCAGGGAAGACAGGG + Intergenic
1158337242 18:56426303-56426325 CCTGTTGCCCTGGAAACACCTGG + Intergenic
1158709385 18:59824021-59824043 CGTGATGCCCACGGAAGACAGGG + Intergenic
1160134333 18:76259805-76259827 CCTCTTGCCAAGGGAATTCCTGG + Exonic
1161181853 19:2889007-2889029 CCTGGTGTCCACGGACTACCAGG + Intergenic
1164712252 19:30365496-30365518 GATGCTGCCCAGGGAATCCCTGG + Intronic
1165151916 19:33766035-33766057 CCGGAGACCCAGGGAAGACCTGG - Intronic
1167474965 19:49694797-49694819 CCTGAGGCCCAAGGAGTCCCAGG - Intronic
1167711666 19:51115487-51115509 CCTGCTGCCCGGGGCTTACCAGG + Intergenic
926944185 2:18169354-18169376 CCTAATGCCCTGGGAGTTCCAGG - Intronic
927083636 2:19653973-19653995 CCTGAGTCCCAGGACATACCTGG + Intergenic
927213675 2:20653781-20653803 CCTGAGGCCCAGTGACTTCCTGG - Intergenic
929120717 2:38481847-38481869 CGTGATGCCCAGGGAAGACAGGG + Intergenic
929565003 2:42978671-42978693 CCTGATGCCCTGGGAGGCCCAGG - Intergenic
929589149 2:43133991-43134013 GCTGCTGCCCAGGGCCTACCAGG - Intergenic
931752793 2:65346063-65346085 CCTGAGGCCCAGGGAATAATGGG - Intronic
933728046 2:85437597-85437619 CCCGAGGCCCAGGGAGCACCGGG + Intergenic
933852952 2:86385571-86385593 CCTGAGGCCCTGGGAATGCATGG + Intergenic
934950938 2:98575003-98575025 CCTTATCCCCAGGGGATGCCTGG - Intronic
936936696 2:117846097-117846119 CCTGATGCCCAAGGCAAAGCGGG + Intergenic
937643370 2:124238188-124238210 CTTGTAGCCCAGGGAAGACCTGG + Intronic
938483282 2:131679698-131679720 CCTGATGCCCTGGGAAGAACAGG + Intergenic
942210035 2:173660844-173660866 CCTGCTGCCCAGGGCTTGCCAGG - Intergenic
945761716 2:213923075-213923097 CCTGTTGCCCTGGAAACACCAGG - Intronic
947536800 2:230944867-230944889 CTTGATGCCCTGCAAATACCAGG + Intronic
947899677 2:233711149-233711171 CCTGGTGCCCAGGAAATAGGAGG - Intronic
948903165 2:240966238-240966260 CCTGTTGCCCAGGGAGAGCCTGG - Intronic
948910332 2:240999337-240999359 CCTGATTCCCAGGGGAGAGCAGG + Intronic
1170179669 20:13515733-13515755 ATTGATGCCCAGGGAATTCCGGG - Intronic
1172012176 20:31851877-31851899 CCTGGGGCCCAGGGAATAGCAGG - Intronic
1173159338 20:40640614-40640636 CCTGATGTACAGAGAAGACCAGG - Intergenic
1173923448 20:46762890-46762912 ACAGATCCCCAGGAAATACCAGG + Intergenic
1174418292 20:50382449-50382471 CATGTGTCCCAGGGAATACCTGG - Intergenic
1175694009 20:61087644-61087666 CCCGATCTCCAGGGAAGACCAGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176449301 21:6849307-6849329 CCTGATGCCCTGGGAAGGACAGG + Intergenic
1176827469 21:13714331-13714353 CCTGATGCCCTGGGAAGGACAGG + Intergenic
1178675088 21:34623921-34623943 ACTGATGCCCAGGGTATCCGTGG - Intergenic
1178934619 21:36850722-36850744 CCTGAGTCCAAGGGAATAGCAGG + Intronic
1179443229 21:41410822-41410844 CCTGGTCCCCAGGGAAACCCAGG + Intergenic
1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG + Intronic
1183733690 22:39631949-39631971 CCTGGGGCCCAGGGAGTCCCAGG - Intronic
1183951746 22:41356446-41356468 CCAGATGCCCACGGACTACGCGG + Exonic
1184756584 22:46519552-46519574 CCTGATGCCCAGGCTCTGCCTGG - Intronic
950603065 3:14052518-14052540 AGTGGTGCCCATGGAATACCAGG - Intronic
950677802 3:14565136-14565158 GCTGGTGCCCAGGGAAGAGCGGG - Intergenic
950967872 3:17158843-17158865 CCTGCTGCCCAGGGATGGCCAGG + Intronic
954990874 3:54839725-54839747 CCTGAGGCCCAGGAAAGCCCAGG - Intronic
956126892 3:66019051-66019073 CCTTATGGCCAGGCAGTACCTGG - Intronic
956256883 3:67292566-67292588 CATGTTGCTCAGGGAATCCCTGG + Intergenic
957645520 3:82919282-82919304 ATTGATGCCCAGGGCATACATGG - Intergenic
958949486 3:100401102-100401124 CCGGAAGCCCAGGGCATGCCGGG + Exonic
960970165 3:123133923-123133945 ACTGATTCCCAGAGAAAACCTGG + Intronic
962093041 3:132265312-132265334 CCTGATACCAAAGTAATACCAGG + Intronic
962743106 3:138377609-138377631 CCAGATGCCCAGGGAAGTCCTGG - Intronic
962933724 3:140060497-140060519 CCTGAGGACCAGGGATTTCCTGG - Intronic
968286571 3:197512533-197512555 CCAGGTTCCCAGGGAAGACCAGG - Intronic
968962258 4:3751614-3751636 CCTGATGCTCAGGGACTGTCTGG + Intergenic
969369621 4:6723444-6723466 CCTCATGGCCTGGGAATAACGGG - Intergenic
969591357 4:8123563-8123585 CCTGGAGCCCAGGGAAAGCCAGG + Intronic
974472063 4:62331433-62331455 CCTGGTCCCCAGGGAAGCCCAGG + Intergenic
977234909 4:94496429-94496451 ACTAATGCCCAGGAAATATCTGG + Intronic
981370084 4:143950019-143950041 CCTGTTGACCAGGGAAGACCGGG - Intergenic
982601783 4:157460382-157460404 TCTGAGGCCCAGGGAATTACTGG + Intergenic
984999399 4:185469727-185469749 CCGGGTGCCCAGGCACTACCAGG - Intronic
985539125 5:479667-479689 TCTGATGCCCTGGGAATCCCAGG - Intronic
986268599 5:6211819-6211841 GCTGATGCCCAGGGAAGCCATGG + Intergenic
986306604 5:6521099-6521121 CCTGATGCCAGGGGGATACCTGG + Intergenic
986620425 5:9667372-9667394 CCTGTTGCCCTGGAAATACCTGG + Intronic
986654723 5:9999784-9999806 CCTGTTGCCCTGGGAACACCAGG + Intergenic
988957144 5:36331183-36331205 CCTTATGCCAAGGGAATCACTGG - Intergenic
990149346 5:52799461-52799483 CCTGATGTCCTGGGAATCCTAGG - Intronic
992500276 5:77335456-77335478 CCAGAGGCCCAGGGAAAGCCAGG + Intronic
1001425568 5:171619873-171619895 CCTGATGCCCAGGCCATCCCAGG + Intergenic
1001542857 5:172551340-172551362 CCTGGAGCCCAGGAAATGCCAGG + Intergenic
1002705144 5:181155722-181155744 CCTGAGGCCTAGGCACTACCGGG + Exonic
1007081358 6:39107301-39107323 CCTGATGCCCAGGGAGGTCAGGG - Intronic
1007685612 6:43665693-43665715 CCACATGCCCAGGAAATGCCAGG - Intronic
1007839112 6:44701256-44701278 CCTGAGGCCCCGGGAAAGCCAGG - Intergenic
1011749460 6:90440329-90440351 CCTGAATCCCAGGGAATTACAGG + Intergenic
1013587371 6:111591457-111591479 CCTGATGCCCAGGACATCCTGGG + Exonic
1015856810 6:137633508-137633530 TCAGATGCCCAGGGACTCCCTGG + Intergenic
1018082052 6:160267574-160267596 CATGCTGCCTAGGGAATACAAGG + Intronic
1018489036 6:164272795-164272817 CCTGGGGTCAAGGGAATACCTGG - Intergenic
1018977167 6:168574433-168574455 CCTGAAGCCCTGGAAATCCCTGG + Intronic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1022978179 7:35577424-35577446 CCTGTAGCCCAGGGAATGACAGG + Intergenic
1023315083 7:38928177-38928199 GCTGATGCCTAGGGACTTCCTGG + Intronic
1024280885 7:47718681-47718703 CCTGAAACCCAGGGAGCACCTGG + Intronic
1024333249 7:48177860-48177882 CCTGAAGGCCAGGGAAGCCCAGG - Intronic
1026827685 7:73594463-73594485 CCTGATGCCCAGTTCAAACCAGG + Intronic
1026945355 7:74312686-74312708 CCTGGTGCCCCGGGAATTCTGGG - Intronic
1027160811 7:75800771-75800793 CCAGATGCCCCGGGTATAGCAGG + Intergenic
1031505114 7:122572847-122572869 CCAGGTGCTAAGGGAATACCTGG - Intronic
1032710799 7:134458784-134458806 CCTGACGCCCAGGGCCAACCCGG + Intronic
1033409726 7:141106265-141106287 CATGATGCCCAGGGCAGACATGG + Intronic
1034468637 7:151244248-151244270 ACTCATGCCCTGGGACTACCTGG + Intronic
1035400853 7:158564621-158564643 CTTCATGCCCCAGGAATACCTGG + Intronic
1038849977 8:31266242-31266264 TGTGATGCCCTGGGAAAACCAGG - Intergenic
1041107939 8:54459467-54459489 CCCGATGCCCGGGGACTGCCCGG + Exonic
1044998658 8:97861073-97861095 CTTGATGCCCAGCTCATACCTGG - Intergenic
1047723979 8:127668796-127668818 CCTGATTCCCAGGGAAGGACAGG + Intergenic
1047965007 8:130040029-130040051 TCTGATGCCCTGGGAATGCTGGG - Intergenic
1048182069 8:132204512-132204534 CCTGATGCCCAGCCAAGGCCAGG - Intronic
1049625015 8:143615985-143616007 CCTGATCCTCAGGGACTTCCTGG + Intronic
1052253747 9:26428951-26428973 CAAGATGCTCAGAGAATACCTGG + Intergenic
1055771367 9:79720191-79720213 GCTGATGGCCAGGGCATAGCAGG - Exonic
1056464370 9:86839320-86839342 GCTGATGCCCAGGGGAGCCCTGG + Intergenic
1059774940 9:117465251-117465273 CCTCTTGCCCAGGGAAAGCCAGG - Intergenic
1061363054 9:130155902-130155924 GCTGATGCACAGGGAGTACGTGG + Intergenic
1061799270 9:133105239-133105261 CCTGGTGCCCCTGGCATACCCGG - Intronic
1062126391 9:134865216-134865238 CCAGAAGCCCAGGGAAGATCTGG - Intergenic
1062179960 9:135186031-135186053 CCAGATGCCCATGAAATATCGGG + Intergenic
1062348393 9:136126243-136126265 CCTGCTGCCCGGAGAAGACCAGG - Intergenic
1062486217 9:136777619-136777641 CCTGAGGCCCAGGGAGGAGCCGG - Intergenic
1203519887 Un_GL000213v1:35209-35231 CCTGATGCCCTGGGAAGGACAGG - Intergenic
1186423430 X:9444525-9444547 CGTGATGCCCAAGGTATACCTGG - Intergenic
1190232830 X:48595547-48595569 TCTGAAGCCCAGGGAATTCAAGG - Intronic
1194059552 X:89180539-89180561 TCTGATGGCCTGGGAATCCCTGG - Intergenic
1195217515 X:102715203-102715225 ACTGATGCCAAGGCAATCCCTGG + Exonic
1195746547 X:108124175-108124197 GCCCATGCCCAGGAAATACCAGG - Intronic