ID: 1150491575

View in Genome Browser
Species Human (GRCh38)
Location 17:65577824-65577846
Sequence GACAGTGCTCAGAAAGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150491566_1150491575 21 Left 1150491566 17:65577780-65577802 CCCCGGGTGGGTCTTTAAGTTCT 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 228
1150491572_1150491575 -8 Left 1150491572 17:65577809-65577831 CCTTTCTACAAGATGGACAGTGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 228
1150491571_1150491575 -4 Left 1150491571 17:65577805-65577827 CCATCCTTTCTACAAGATGGACA 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 228
1150491570_1150491575 -3 Left 1150491570 17:65577804-65577826 CCCATCCTTTCTACAAGATGGAC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 228
1150491568_1150491575 19 Left 1150491568 17:65577782-65577804 CCGGGTGGGTCTTTAAGTTCTTC 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 228
1150491567_1150491575 20 Left 1150491567 17:65577781-65577803 CCCGGGTGGGTCTTTAAGTTCTT 0: 1
1: 0
2: 2
3: 6
4: 180
Right 1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150491575 Original CRISPR GACAGTGCTCAGAAAGGGTA AGG Intronic
901312731 1:8282086-8282108 TGCAGTCCTCAGAAAGGGAAAGG + Intergenic
901684385 1:10935468-10935490 GACAGAGCTGGGATAGGGTAGGG + Intergenic
903347377 1:22695295-22695317 GACAGGACTCAGAGAGGTTAAGG - Intergenic
904465769 1:30706800-30706822 AACAGAGCTCAGAGAGGGTCAGG + Intergenic
905636839 1:39559628-39559650 GAGAGGGTTCACAAAGGGTAGGG - Intergenic
905937106 1:41833478-41833500 AACAATGCTCAGAAAGGCTAAGG + Intronic
906147998 1:43571228-43571250 GACAGAGCCCTGAAAGGCTAGGG - Intronic
910656933 1:89629294-89629316 CACAAAGCTCAGAAATGGTATGG + Intergenic
910756035 1:90691908-90691930 GTGAGGGCTCAGAAAGGGTGAGG - Intergenic
912109304 1:106320485-106320507 GACAATGCTGAGTAAGAGTATGG - Intergenic
913211986 1:116589685-116589707 GAGGGTGCTGAGGAAGGGTATGG - Intronic
915339525 1:155168704-155168726 GACAGAGCACAGACAGGGCAGGG + Intergenic
915955640 1:160217910-160217932 GACAATACACAGAATGGGTATGG + Intronic
916659288 1:166906431-166906453 GAAAGTGCTCAGAGAGGGGAAGG + Intergenic
917018709 1:170562891-170562913 GCCAGGGCTCAGCAAGGGGAGGG + Intergenic
918189177 1:182155674-182155696 GACAGTGCTGCAATAGGGTAGGG + Intergenic
918823685 1:189293930-189293952 GACAGTCCAGAGAAAAGGTAGGG - Intergenic
919919189 1:202158190-202158212 AGCAGTGCGCAGAAAGTGTAGGG + Exonic
920704508 1:208241925-208241947 GGCAGTGAAGAGAAAGGGTAGGG - Intronic
922449362 1:225724409-225724431 GACTGTGATCAGCAAGGGAAGGG + Intergenic
923209816 1:231793531-231793553 GATAGAGGTCAGAAAGGGGAGGG - Intronic
924498960 1:244618303-244618325 GAAAGTGCTCTGAATGGGGAAGG + Intronic
1063333316 10:5184308-5184330 GACTGTGGACACAAAGGGTAAGG - Intergenic
1065209346 10:23388030-23388052 GAGGGTGCTCAGAAAGGCCATGG - Intergenic
1067229794 10:44398127-44398149 GACAGGGTTGAGAAAGGGAATGG - Intergenic
1067291491 10:44946656-44946678 GGCAGAGCTGAGAGAGGGTAGGG + Intergenic
1068129673 10:52881900-52881922 GACAGTCCTCAGAAAGACTGAGG + Intergenic
1069181262 10:65362072-65362094 GACAATGGTCAGTAAGGGGATGG - Intergenic
1069716140 10:70522742-70522764 GACAGGGGTCAGCAAAGGTAGGG - Intronic
1070543201 10:77432132-77432154 GAAGGTGCTCAGAAGGGGAAAGG - Intronic
1070789794 10:79182229-79182251 GACAAAACTCAGAAAGGGCAGGG + Intronic
1071921339 10:90354266-90354288 TACAGTGATCAGACAGGGCATGG + Intergenic
1073111325 10:101064632-101064654 GACAGTGCTCACACCTGGTAAGG + Exonic
1074601345 10:114916998-114917020 GACAATGCTAAAAAAGGGAAGGG + Intergenic
1074762336 10:116676344-116676366 GGCAGAGCTGAGAAAGGGGATGG - Intronic
1075259992 10:120955045-120955067 GACAGGGCTCATAGAGGGGAGGG + Intergenic
1076682493 10:132180405-132180427 GACAGTGCCCAGAAAGGGGAGGG + Intronic
1078358004 11:10647189-10647211 AACAGTGCTCAGTGCGGGTATGG + Intronic
1079053156 11:17181097-17181119 GATAGTGTCCAGAAAGGGTATGG - Intronic
1080026745 11:27623131-27623153 GAAATTGATCAGAAAGGGAAAGG - Intergenic
1083397254 11:62400394-62400416 GCCAGGGCTCAGAAAAGGAACGG - Intergenic
1085260334 11:75200863-75200885 GGCAGTGCTCAGCATGGGTTGGG - Intronic
1087711791 11:101562371-101562393 GACAGTCCTCAAAAAGCTTATGG + Intronic
1088088808 11:106013163-106013185 AACAGGGCTCAGAAAGAGTAAGG + Intronic
1089032350 11:115345375-115345397 GTCAGTGCTCAGCAAGGGACAGG + Intronic
1090257770 11:125297917-125297939 GACTGTCCTCAGAAGGGTTATGG - Intronic
1092121689 12:6048837-6048859 GCACGTGCTCAGAAAGGGAAGGG - Intronic
1092129791 12:6102063-6102085 GCATGTGCTCAGAAAGGGAAGGG + Intronic
1093937662 12:25018874-25018896 GACAGTCTTCAGAAAGGATTAGG - Intergenic
1095145169 12:38718542-38718564 GGCACTATTCAGAAAGGGTAAGG + Intronic
1095796242 12:46221935-46221957 GACAGAGATGAGACAGGGTACGG + Intronic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1097959777 12:65520968-65520990 CAAAGTGCTAAGAAGGGGTAAGG - Intergenic
1099061966 12:77922564-77922586 AACAGTGGTCTGAAAGGGCAAGG - Intronic
1099879637 12:88452359-88452381 GATAGTGCTCAGAATGGGTTAGG + Intergenic
1105215232 13:18280311-18280333 GAGGGTGCTGAGGAAGGGTATGG - Intergenic
1105242949 13:18623941-18623963 GCCAGTGTTCAGAAAGTGTGTGG - Intergenic
1106428956 13:29661067-29661089 GAAATTGCTCAGAAAGTGTTGGG + Intergenic
1106752752 13:32791841-32791863 CACAGTGCTCAGAAGGTGCAGGG - Intergenic
1108232976 13:48369931-48369953 GACAGTGAACAAAAAGGTTATGG - Intronic
1110393191 13:74999843-74999865 GACAATGCACAGAAAGTGTCTGG + Intergenic
1110622585 13:77614433-77614455 TACTGTGCTCAGCAAGGTTATGG + Intronic
1110889520 13:80680487-80680509 GACAATCCTAAGCAAGGGTAGGG - Intergenic
1114743317 14:25120315-25120337 GAACCTGCTCAGAAAGGGTGGGG - Intergenic
1115736492 14:36336998-36337020 GACAGTGTACTGAAAGGGTCAGG - Intergenic
1116790747 14:49337375-49337397 TACATGCCTCAGAAAGGGTATGG + Intergenic
1118988499 14:70777330-70777352 GACAGTGGTGAGAAAGGCTGAGG + Intronic
1121597024 14:95171618-95171640 CACAGTGCTCACAAATAGTAGGG - Intergenic
1121735216 14:96213687-96213709 CACAGTGGAGAGAAAGGGTAGGG + Intronic
1122612448 14:102994794-102994816 GACATCACTCAGAAATGGTACGG - Intronic
1123488346 15:20760690-20760712 GCCAGTGTTCAGAAAGTGTGCGG + Intergenic
1123544843 15:21329763-21329785 GCCAGTGTTCAGAAAGCGTGCGG + Intergenic
1123925834 15:25109783-25109805 GGCAGTGCGCAGAGAGGGAAAGG - Intergenic
1125172904 15:36786832-36786854 GAGAGTGGTCAAAAAGGATAAGG - Intronic
1127892708 15:63269391-63269413 GAAAGGGCTAAGAAAGGATAGGG - Intergenic
1130760805 15:86817683-86817705 GAGAGTGCTGGGAGAGGGTATGG + Intronic
1130896952 15:88178360-88178382 GTCAGTGTCCTGAAAGGGTAGGG + Intronic
1131279257 15:91007514-91007536 GAGAGTGCTGAGAAGGTGTAAGG + Exonic
1131442131 15:92467213-92467235 GACGTTTCTCAGAAAGGGGAAGG - Exonic
1131503883 15:92998567-92998589 GAAGCTGCTCAGAAAGGGTCTGG + Exonic
1131913542 15:97235531-97235553 GGCAGAGATCAGAAAGGGAACGG + Intergenic
1202953189 15_KI270727v1_random:57034-57056 GCCAGTGTTCAGAAAGCGTGCGG + Intergenic
1132616388 16:842940-842962 GACAGGGCTGTGAAAGGGCAGGG + Intergenic
1135150173 16:19998632-19998654 GACAGTGCTCTGTCAGGGTAAGG - Intergenic
1139265452 16:65634357-65634379 GACAGGGCACAGAAAGTGTGTGG + Intergenic
1139483143 16:67241701-67241723 CACAGTGCTAAGAAAGGGGAGGG + Intronic
1139516067 16:67453082-67453104 GACAGAGCTCTGAAAGGCCAAGG - Intronic
1141717506 16:85735248-85735270 GACAGCGCTGAGAGAGGGGAGGG + Intronic
1143688396 17:8538605-8538627 GAGATAGCTCAGAAAGGGGAGGG - Intronic
1144375554 17:14636312-14636334 GAGAGTGAGCAGGAAGGGTAAGG + Intergenic
1144848170 17:18230781-18230803 GTCAGTGCTGGGAAAGGGGAGGG + Intronic
1145783400 17:27578542-27578564 GACTGAGCTCAGAGAGGGAAAGG + Intronic
1146427977 17:32762075-32762097 TGCAGTGCTCAGGAAGGTTAGGG + Intronic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG + Intronic
1151057329 17:71048763-71048785 AACAGTGCTCATAAAAGATATGG - Intergenic
1153978972 18:10293380-10293402 GAAAGTGATAAGAAAGGGGAAGG + Intergenic
1154176379 18:12088917-12088939 GACAGAGCCAAGAAAGGGTCTGG - Intergenic
1154445988 18:14435956-14435978 GCCAGTGTTCAGAAAGTGTGTGG + Intergenic
1155377350 18:25174788-25174810 AACAGTGCTCAGAAAGGTTGGGG - Intronic
1156416066 18:36891906-36891928 TACAGTCCTCAGAAAGATTAAGG - Intronic
1157370306 18:47104802-47104824 GACAGTGCTCAGATAGCCTTTGG - Intergenic
1162873022 19:13600105-13600127 GACAGAGCTCACAGAGGGCAAGG + Intronic
1163263549 19:16205338-16205360 GACAGTGCTCAGCAAGGCCGTGG + Intronic
1164711182 19:30358231-30358253 GCCGGGGCTCAGAGAGGGTAAGG + Intronic
927090490 2:19707094-19707116 GTCAGTGCTCCGGAAGGTTAAGG + Intergenic
929564098 2:42974111-42974133 GACAGGGCTCAGAGAGGGAGAGG + Intergenic
931474692 2:62575489-62575511 GACAGAGGAGAGAAAGGGTAAGG + Intergenic
934299088 2:91766426-91766448 GAGGGTGCTGAGGAAGGGTATGG + Intergenic
934973818 2:98786370-98786392 GACAGTGCTCTGACAGGACAGGG + Intergenic
936745693 2:115573989-115574011 GACTGTGGTTAGAAAGGGCATGG - Intronic
937897141 2:126986252-126986274 GTAAGTGCTCAGAAGGTGTAAGG + Intergenic
938660804 2:133485106-133485128 GTCAGTGCTCAGTAAAAGTAGGG + Intronic
940698013 2:157004182-157004204 GACATTGCTGAGAAATGATATGG - Intergenic
941027281 2:160470987-160471009 GTCAGTGCAATGAAAGGGTAGGG - Intronic
942682060 2:178487208-178487230 GACATTGCTGGGAAATGGTAGGG + Intronic
944065381 2:195614512-195614534 GACACTGCTCAAAGTGGGTAAGG - Intronic
946811720 2:223532541-223532563 GACAGTGGTCACAAATTGTATGG + Intergenic
946896398 2:224328580-224328602 GACAGTATGAAGAAAGGGTAAGG - Intergenic
947943758 2:234082039-234082061 GGCAGTGCTCTGAAAAGGCATGG - Intergenic
948510146 2:238458595-238458617 GACAGTGCACAGAAATGCTGAGG + Intergenic
948605985 2:239135408-239135430 GGCAGAGCTCAGGAAGGGGAAGG + Intronic
1168884937 20:1242618-1242640 GACATTGCTGAGAAAAGGAAAGG + Exonic
1169087778 20:2838159-2838181 GACAGGGCTCAGAAACAGAATGG - Intronic
1170479617 20:16753118-16753140 GACAGTGCTGTGATAGGGTTGGG - Intronic
1170831903 20:19850198-19850220 GACAGCACTCAGAAAAAGTATGG - Intergenic
1171361941 20:24592439-24592461 GACATTGCTCAGAGAGTGTGGGG + Intronic
1176219880 20:63964815-63964837 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219892 20:63964858-63964880 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176219903 20:63964901-63964923 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219914 20:63964944-63964966 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219926 20:63964987-63965009 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219937 20:63965030-63965052 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219950 20:63965076-63965098 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219962 20:63965119-63965141 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219972 20:63965162-63965184 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219984 20:63965205-63965227 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176219996 20:63965248-63965270 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220008 20:63965291-63965313 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220020 20:63965334-63965356 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220032 20:63965377-63965399 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220043 20:63965420-63965442 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220055 20:63965463-63965485 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220067 20:63965506-63965528 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220080 20:63965552-63965574 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220093 20:63965598-63965620 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220106 20:63965644-63965666 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220117 20:63965687-63965709 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220130 20:63965733-63965755 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220143 20:63965779-63965801 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220156 20:63965825-63965847 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220168 20:63965868-63965890 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220179 20:63965911-63965933 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220190 20:63965954-63965976 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220203 20:63966000-63966022 AACAGTGGTGAGAAAAGGTATGG - Intronic
1176220215 20:63966043-63966065 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220227 20:63966089-63966111 AACAGTGGTAAGAAAAGGTATGG - Intronic
1176220240 20:63966135-63966157 AACAGTGGTAAGAAAAGGTATGG - Exonic
1176449991 21:6853901-6853923 GCCAGTGTTCAGAAAGTGTGTGG - Intergenic
1176828160 21:13718919-13718941 GCCAGTGTTCAGAAAGTGTGTGG - Intergenic
1176889725 21:14300043-14300065 GAAAGTCCTCAGAAAGGGAATGG + Intergenic
1177585271 21:23085063-23085085 GAAAGTGCATTGAAAGGGTAGGG + Intergenic
1178678748 21:34653790-34653812 GACAGAGGTCAGAGAGGGGAGGG + Intergenic
1178737882 21:35169039-35169061 GACACTCCTTTGAAAGGGTAGGG + Intronic
1180074021 21:45453657-45453679 GACAGTGGGCAGGAAGGGTGGGG + Intronic
1184089424 22:42284471-42284493 GGCAAGGCTCAGAAAGGGAAGGG + Intronic
1185080007 22:48704496-48704518 GACAGCGCTGAGAGAGGGGATGG - Intronic
951778369 3:26335700-26335722 AAGAGTTCTCAGAAAGGGGATGG - Intergenic
952726391 3:36590589-36590611 GACAGTAATTAGAAAGAGTATGG - Intergenic
954375281 3:50191340-50191362 GTCAGGGCTGAGAAAGGGGAAGG - Intergenic
956466596 3:69526019-69526041 CACTGTGCTCTGAAATGGTAAGG - Intronic
959605445 3:108236810-108236832 GACAGTGCTCCCAAATGGAAGGG - Intergenic
960286164 3:115831318-115831340 GGCAGTGATCAGAAAGGGATAGG + Intronic
960953842 3:123017356-123017378 AAGAATGCTCAGAAAGGGAAAGG + Intronic
964188222 3:153972770-153972792 CACAGTGCTGAGAAGGGGAAAGG + Intergenic
964335109 3:155646440-155646462 GGCAGTGCTGAGAAAGGGTGGGG - Intronic
965024167 3:163277417-163277439 AACAGTGGTCAGAAAGGTAACGG - Intergenic
965197485 3:165620585-165620607 AACAGTGATTAGAAAGGGAAGGG + Intergenic
966413417 3:179666006-179666028 GACAGTGCTTTGGAGGGGTAGGG + Intronic
966856232 3:184195742-184195764 GAAGGTGCTCAGAAAGGTTGAGG - Intronic
969068154 4:4507055-4507077 GCCAGTGCTCAGCAAGGAGAAGG + Intronic
969270861 4:6099928-6099950 AACAGTGCTGAGAAATGGCAAGG - Intronic
970195359 4:13546404-13546426 GTCAGTGCTCAGCAAGTGTAAGG + Intergenic
971028092 4:22608048-22608070 GACTGTCCACAGAAGGGGTAAGG + Intergenic
973570247 4:52231432-52231454 GACATTGCTCAAGAAGGGTAAGG + Intergenic
981180074 4:141731223-141731245 GGGAGTGCTCAGATAGGGAAGGG - Intronic
986727179 5:10607479-10607501 GTCAGAACTCAGAAAGGGTGGGG + Intronic
988834138 5:35014921-35014943 TACAGTTCTCAGGAAGGGGAAGG - Intronic
992385321 5:76279114-76279136 GACAGTGCTGAAATAGGGAAGGG + Intronic
992913324 5:81421036-81421058 GAAAGTGCTCAGCAAGTGTTAGG + Intronic
994242850 5:97444688-97444710 GACAGAGCTCTGAGAGGGAAGGG - Intergenic
999733944 5:154498674-154498696 GAAAGTCCTCAGAAGGGGCAGGG - Intergenic
1000026778 5:157365770-157365792 GACAGAGGTCAGAAAGGAAAGGG - Intronic
1000368316 5:160511283-160511305 GACAGAACTGGGAAAGGGTATGG - Intergenic
1000549666 5:162644747-162644769 TACACTGTTCAGAATGGGTAAGG - Intergenic
1002463238 5:179387342-179387364 GCCAGTGCTCAGTGAGGGCAGGG - Intergenic
1004062149 6:12208229-12208251 GAAATTGCTCAAAAAGGGTGAGG - Intergenic
1004218933 6:13728762-13728784 GGAAGTGCTCAGAAAGTGTTGGG - Intergenic
1007335190 6:41150594-41150616 GACAGGAATTAGAAAGGGTAGGG - Intronic
1008385061 6:50879872-50879894 GAAAGTGCTTAAAAAGGGCATGG + Intergenic
1008626917 6:53326102-53326124 CACAGTAGACAGAAAGGGTAGGG + Intronic
1008876806 6:56338437-56338459 GGCAGGGCTCAGAAAGGGTCAGG - Intronic
1015076497 6:129164939-129164961 GACTGTGCACAGAATAGGTAAGG - Intronic
1015765423 6:136711013-136711035 AGCAGTGTGCAGAAAGGGTACGG - Intronic
1015794287 6:136995291-136995313 GACAGTTCTCAGTAAAGCTAAGG + Intergenic
1016261833 6:142181019-142181041 GAAAGTGCAATGAAAGGGTAAGG + Intronic
1016505658 6:144776165-144776187 GCCAGTGCAGAGAAAGGGTCAGG - Intronic
1019331657 7:463459-463481 GACAGAGCCCAGAAAGGCGACGG + Intergenic
1020956522 7:14745738-14745760 GAAAGTGCTCAGAAAAGAGAGGG - Intronic
1023984882 7:45088690-45088712 GACAGGGCGCGGAAAGGGGAGGG + Intronic
1024292340 7:47813742-47813764 GAAAGTGTTCATAAAGGGGAAGG + Intronic
1024578854 7:50785540-50785562 GACAGTGCTGGGAAGGGGTTGGG - Intronic
1026078662 7:67197614-67197636 GACAGAGCTCAGACTGGGCATGG - Intronic
1026858728 7:73770987-73771009 GACAGGGCTCGGAGAGGGGAGGG - Intergenic
1027422318 7:78029149-78029171 CAGAGTGTTCAGAAAGGGTTTGG - Intronic
1031750659 7:125569033-125569055 AACAGGTCTCAGAGAGGGTAAGG + Intergenic
1031840857 7:126737638-126737660 GACATTGCTCAGGAAGGGAATGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032118422 7:129137478-129137500 GGCAGTGCTCAAAAAAGGAAGGG - Intergenic
1033633171 7:143181525-143181547 GAAAGAGCTCAGACAGGGTCTGG - Intergenic
1033872157 7:145767685-145767707 GAAAGTGCTCAGGAAAGGGATGG - Intergenic
1034966723 7:155396013-155396035 GGAAGAGCTCAGAAAGGGCAGGG - Exonic
1038421459 8:27436640-27436662 GACAGTTCTGAGAAAAGGTGAGG + Intronic
1040979839 8:53235015-53235037 GACCGTACTCTGAAAGGGCATGG + Exonic
1041125681 8:54636041-54636063 CACAGTTCCCAGAAAGGTTAGGG - Intergenic
1041359633 8:57039647-57039669 AACAGAGCTCTGAAAGGGTTAGG - Intergenic
1045683604 8:104688693-104688715 CACACTGCTCAGAAAGCATAGGG - Intronic
1047718789 8:127619811-127619833 GGCAGGGCTGAGAGAGGGTAAGG - Intergenic
1053102359 9:35381525-35381547 GACAGAGCAGAGAAAGGGAATGG - Intronic
1054288943 9:63262361-63262383 GATATTTCTCAGAAAAGGTAGGG - Intergenic
1057521961 9:95767203-95767225 TACAGTGGCAAGAAAGGGTAAGG - Intergenic
1057902937 9:98963670-98963692 CACATTGCTCAGAAAGAGTGTGG + Intronic
1059781484 9:117532885-117532907 CACAGTGCCCAGAAAAGGTTAGG - Intergenic
1061519833 9:131111559-131111581 GACAGTGCTGAGCAAGGGACTGG - Intronic
1062488913 9:136794937-136794959 AACAGTGACCAGAAAGGGAAGGG + Intronic
1203519191 Un_GL000213v1:30616-30638 GCCAGTGTTCAGAAAGTGTGTGG + Intergenic
1185682904 X:1903176-1903198 CAGAGTGCTGAGAAAGGGTAGGG - Intergenic
1187443718 X:19343118-19343140 GACAGTGGTCAGAACGGTGAGGG - Intergenic
1192262277 X:69512533-69512555 GAAAGGGCTAAGAAAGGGGAAGG + Intronic
1193724642 X:85024905-85024927 AACAGAGCTCTGAATGGGTATGG + Intronic
1195582088 X:106516909-106516931 TAAATTGCTCAGAAAGGGAAAGG - Intergenic
1198443596 X:136689084-136689106 GACATTGCTCATAAAAAGTAAGG + Intronic
1199401638 X:147405626-147405648 GACAGTGCTAAGACTGGGTTTGG + Intergenic
1200855325 Y:7931894-7931916 GACACTGCCCACAAGGGGTATGG - Intergenic