ID: 1150493300

View in Genome Browser
Species Human (GRCh38)
Location 17:65589071-65589093
Sequence CAGGGTTCCCACAGTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150493300_1150493314 8 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493314 17:65589102-65589124 GATGTGGGGATGAGAGTGAGGGG 0: 1
1: 0
2: 5
3: 59
4: 641
1150493300_1150493315 9 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493315 17:65589103-65589125 ATGTGGGGATGAGAGTGAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 743
1150493300_1150493318 15 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493318 17:65589109-65589131 GGATGAGAGTGAGGGGGACGGGG 0: 1
1: 0
2: 4
3: 79
4: 913
1150493300_1150493317 14 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493317 17:65589108-65589130 GGGATGAGAGTGAGGGGGACGGG 0: 1
1: 1
2: 8
3: 65
4: 881
1150493300_1150493304 -8 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493304 17:65589086-65589108 GAACCCTGGTGCCCCAGATGTGG 0: 1
1: 0
2: 1
3: 12
4: 185
1150493300_1150493313 7 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493313 17:65589101-65589123 AGATGTGGGGATGAGAGTGAGGG 0: 1
1: 1
2: 4
3: 75
4: 638
1150493300_1150493316 13 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493316 17:65589107-65589129 GGGGATGAGAGTGAGGGGGACGG 0: 1
1: 0
2: 12
3: 295
4: 2643
1150493300_1150493305 -7 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493305 17:65589087-65589109 AACCCTGGTGCCCCAGATGTGGG 0: 1
1: 0
2: 1
3: 4
4: 163
1150493300_1150493312 6 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493312 17:65589100-65589122 CAGATGTGGGGATGAGAGTGAGG 0: 1
1: 1
2: 3
3: 63
4: 562
1150493300_1150493306 -6 Left 1150493300 17:65589071-65589093 CCCACCTCACTGTGGGAACCCTG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1150493306 17:65589088-65589110 ACCCTGGTGCCCCAGATGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150493300 Original CRISPR CAGGGTTCCCACAGTGAGGT GGG (reversed) Intronic
900400782 1:2472070-2472092 CAGGGATCCCAGAGTCAGGCTGG - Intronic
900640433 1:3685717-3685739 CAGGGGTCCCAGAGTGGGGCTGG + Intronic
901724639 1:11231295-11231317 CAGGGTACACGCAGAGAGGTAGG - Exonic
902238542 1:15073477-15073499 CAGGGTCCCCCCAGTAAGGGAGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
903548732 1:24143044-24143066 CAGGGATCCCACAGTCAAGATGG + Exonic
904031701 1:27537140-27537162 CAGGGTTCTCTCATGGAGGTGGG + Intronic
904200989 1:28818903-28818925 CAGGGGTCCCATGGTAAGGTTGG + Intronic
906545987 1:46619833-46619855 CAGAGTTCCCACTGCGAGGGGGG - Intergenic
907946026 1:59137403-59137425 CATGCTTCCCACAGAGAAGTGGG - Intergenic
908113613 1:60920573-60920595 TAGGGCTTCCACAGTGAGGCAGG - Intronic
908266298 1:62382520-62382542 CAGTGATCCCAGAGTGGGGTAGG + Intergenic
909674841 1:78227450-78227472 CAAGGGTCCAACAGTGGGGTCGG - Intergenic
912366092 1:109135121-109135143 CAGGGTTCCCAAACTGCAGTAGG + Intronic
912910968 1:113759074-113759096 CCGGGGTCCCACCGTGAGGCCGG + Exonic
913010101 1:114674823-114674845 CAGCTTCTCCACAGTGAGGTCGG + Exonic
913025332 1:114832751-114832773 CAGGGTTCAATCTGTGAGGTGGG - Intergenic
913276136 1:117139962-117139984 CAGTGTCCTCACAGTGAGCTAGG + Intergenic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
913677440 1:121154612-121154634 CAGGTTTCCCCCTGTGAAGTGGG - Intergenic
914029275 1:143942241-143942263 CAGGTTTCCCCCTGTGAAGTGGG - Intergenic
914160175 1:145125709-145125731 CAGGTTTCCCCCTGTGAAGTGGG + Intergenic
914639491 1:149590513-149590535 CAGAGTTCTCACAGAGAGATGGG + Intergenic
917053143 1:170947902-170947924 AAGGGTTTCCACAGTGATGATGG - Intronic
917916998 1:179712043-179712065 CAGGGATCTCACAGTTTGGTGGG + Intergenic
918110826 1:181454003-181454025 CAGGGTTCTCACAGTGCAGAGGG + Intronic
918379084 1:183936852-183936874 AAGGGTACCCACAGTGAGTCGGG + Exonic
918402891 1:184181166-184181188 CAGGGAACCCAAACTGAGGTGGG + Intergenic
919552398 1:199007531-199007553 CAGGCTCCCAAGAGTGAGGTTGG - Intergenic
919662182 1:200258127-200258149 GAGGCTTCCCACAGTGATTTAGG - Intergenic
920464743 1:206173126-206173148 CAGGTTTCCCCCTGTGAAGTGGG - Intergenic
921801745 1:219410573-219410595 AGGGGTTCCCACAGTGCAGTAGG - Intergenic
923546595 1:234927858-234927880 CAAGGTTGCCACAGGGAGGGAGG - Intergenic
924864714 1:247966104-247966126 CAGGCTTGCCACAATCAGGTGGG - Exonic
1062918193 10:1258007-1258029 CAGGGTCCCCACTGTGTGGATGG - Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064790415 10:18951716-18951738 AAGGGCTCCCACAGTGCAGTGGG + Intergenic
1065366178 10:24939052-24939074 CAGAAGTCACACAGTGAGGTGGG + Intronic
1066272096 10:33834314-33834336 TATTGCTCCCACAGTGAGGTAGG + Intergenic
1066745315 10:38601423-38601445 CAGGGATCCCACAGACATGTAGG - Intergenic
1066748455 10:38627485-38627507 AAAAGTTCCCACAGTGAGTTTGG + Intergenic
1067873179 10:49980252-49980274 CAGAGTTCCAACAGAGAGGGAGG + Intergenic
1070869182 10:79733646-79733668 CAAGGTTCACACATTGAGATTGG + Intergenic
1071636096 10:87255823-87255845 CAAGGTTCACACATTGAGATTGG + Intergenic
1071659145 10:87482123-87482145 CAAGGTTCACACATTGAGATTGG - Intergenic
1073111017 10:101063065-101063087 CGGGTGTGCCACAGTGAGGTTGG - Exonic
1075832672 10:125424676-125424698 CATGGTTCCCAAACTGAGCTTGG - Intergenic
1076262769 10:129081204-129081226 CAAGTTTCCCAGACTGAGGTGGG + Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1078519410 11:12051228-12051250 CTGGGTTCCCACCATGATGTGGG - Intergenic
1082162684 11:48901463-48901485 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082175077 11:49049458-49049480 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082238738 11:49851271-49851293 CAGGGATCCCACGTTGAGGACGG + Intergenic
1082243406 11:49893056-49893078 CAGGGATCCCACGTTGAGGACGG - Intergenic
1082657901 11:55873882-55873904 CAGGGATCCCACGTTGAGGACGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084790957 11:71474923-71474945 CTGCGTTCCCACAGTGCGGGAGG + Intronic
1085198124 11:74684299-74684321 CAGCGTTCTCCCACTGAGGTTGG + Intergenic
1086433759 11:86761720-86761742 CGGGTTTTCCACAGGGAGGTAGG - Intergenic
1086690691 11:89786626-89786648 CAGGGATCCCACGTTGAGGACGG + Intergenic
1086697831 11:89864880-89864902 CAGGGATCCCACGTTGAGGAAGG - Intergenic
1086708331 11:89979608-89979630 CAGGGATCCCACGTTGAGGAAGG + Intergenic
1086715110 11:90053034-90053056 CAGGGATCCCACGTTGAGGACGG - Intergenic
1089497761 11:118916365-118916387 TGGGGTGCCCACAATGAGGTGGG - Intronic
1090643533 11:128749081-128749103 CTAGGTTCACACAGTGAGGGGGG - Intronic
1091047847 11:132340999-132341021 CAGGCTTCTCACAGAGGGGTTGG - Intergenic
1093261834 12:16948428-16948450 CAGTCATCCCACATTGAGGTGGG - Intergenic
1096807949 12:54151727-54151749 CAGGGCTCCAAGACTGAGGTGGG - Intergenic
1100584642 12:95969056-95969078 AAGGGCTCCCACAGTGCAGTAGG - Intergenic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1104390245 12:128385961-128385983 CAGTGCTCCCACAGAGAGCTGGG + Intronic
1104821062 12:131677906-131677928 CAGGGTCCCCACAGTGACCGCGG - Intergenic
1105968827 13:25408441-25408463 CTGGGTTCCCACAGACAGGATGG + Intronic
1107959735 13:45547337-45547359 CAGAGTTCTCACACTGAGATGGG + Intronic
1107965977 13:45598643-45598665 AAGGGCTCCAACAGTGATGTGGG - Intronic
1110070866 13:71175275-71175297 CAGGGTTCTCACAGACAGGCTGG + Intergenic
1111348546 13:86995711-86995733 AAGGGTTTCCACTGAGAGGTTGG - Intergenic
1111682389 13:91459513-91459535 CAGGGTTGCATCAGTGATGTAGG + Intronic
1112488352 13:99840064-99840086 CAGAGTTCCCAGCGTGGGGTGGG - Intronic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1117238160 14:53799966-53799988 TAGGGTTCCCGCAGAGAGATGGG - Intergenic
1119804757 14:77475471-77475493 AAGGGCTCCCCCAGTGAGGTTGG - Exonic
1120536079 14:85697519-85697541 CAGGTTTCTCACTGTGAAGTTGG + Intergenic
1122243099 14:100382176-100382198 CAGGGCTTGCACAGTGAGGCGGG + Intronic
1122325534 14:100879110-100879132 CAGGGGTCCCACAGGGAGTTGGG - Intergenic
1122406701 14:101505184-101505206 CTGAGTTCCCAAAGTAAGGTAGG - Intergenic
1122627751 14:103092813-103092835 CTGGGTTCCCTCTGTGAAGTGGG - Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1124961999 15:34405634-34405656 CTGTGTTCCCACAGTTAGGTGGG + Intronic
1124978622 15:34551855-34551877 CTGTGTTCCCACAGTTAGGTGGG + Intronic
1128260513 15:66229697-66229719 CAAGGCTCCCACAGGGAGGAAGG + Intronic
1129169625 15:73799641-73799663 CAGGGTTCCTCCCGTGTGGTTGG - Intergenic
1130062111 15:80577642-80577664 CAGGGCTTCTCCAGTGAGGTTGG + Intronic
1130597639 15:85258186-85258208 CAGTCTTCCCACAGTGAGACCGG - Intergenic
1131792262 15:95978005-95978027 CAGGTTTCCATCAGTGATGTGGG + Intergenic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1132702222 16:1226752-1226774 CAGGGTTCCCACCGAGGGGACGG - Intergenic
1135323886 16:21513798-21513820 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1135381054 16:21996419-21996441 CAGGCTACCCACAGTGAGTTTGG + Intronic
1135922931 16:26667517-26667539 CAGGGTTCCCACAGAGCAGAAGG + Intergenic
1136335371 16:29607066-29607088 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1138046700 16:53732505-53732527 CACAGTTCCCACACTGAAGTAGG - Intronic
1138529681 16:57628289-57628311 CAAAGTTCCCACAGAGAGGCCGG - Intronic
1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG + Intronic
1139545460 16:67647749-67647771 CAGGGTTGACACCGCGAGGTAGG + Exonic
1139841057 16:69881060-69881082 CAAGGTTCCCTCTGTGATGTTGG - Intronic
1141027974 16:80565708-80565730 CAGGGGTCCCTCTGTGAGGCAGG - Intergenic
1141763411 16:86043742-86043764 CAGGGACCCCACAATGACGTTGG - Intergenic
1142146729 16:88495910-88495932 CAGGGGTCCGCCTGTGAGGTGGG + Intronic
1142963029 17:3563206-3563228 CAAGGTTCCAACAGTGAGTAAGG - Intergenic
1142993986 17:3750372-3750394 CAGAGTGCCCACGGTGATGTCGG + Exonic
1143026737 17:3945468-3945490 CAGGGATCGCACAGTGAGATGGG - Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1144616712 17:16782678-16782700 TAGGGTTTCCACTGAGAGGTCGG + Intronic
1144783098 17:17817543-17817565 GTGGGGTCCCACAGTAAGGTGGG - Intronic
1144895980 17:18532983-18533005 TAGGGTTTCCACTGAGAGGTCGG - Intergenic
1144967732 17:19088812-19088834 CAGGGTCCCGAGTGTGAGGTGGG + Intergenic
1144980184 17:19163251-19163273 CAGGGTCCCGAGTGTGAGGTGGG - Intergenic
1144988038 17:19214981-19215003 CAGGGTCCCGAGTGTGAGGTGGG + Intergenic
1145136233 17:20411237-20411259 TAGGGTTTCCACTGAGAGGTCGG + Intergenic
1145998401 17:29117438-29117460 CAGGATGCCCACCGTGGGGTGGG - Intronic
1148317335 17:46713854-46713876 CAGTCTTCCCACTGTGAGGAGGG - Exonic
1149067686 17:52499664-52499686 CAGAGTTCCCACAGTAAGAGAGG + Intergenic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1151967177 17:77437490-77437512 CGGGGGTCTCTCAGTGAGGTGGG + Intronic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152350187 17:79779796-79779818 CAGGTTTGCCACAGTGACGCAGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1154080570 18:11252101-11252123 CAGGCTTCCCAGGGTGAGTTGGG + Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155216464 18:23647755-23647777 CAGTTTTCCCACTGTGATGTAGG + Intronic
1156540600 18:37906102-37906124 CAGGCATCCCACAGTGAGGAAGG - Intergenic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1159291988 18:66434935-66434957 CAGGGTTCCCACACACAGGTAGG - Intergenic
1160122089 18:76139907-76139929 CAGGGTTGCAACAGAGGGGTGGG + Intergenic
1160155763 18:76432729-76432751 CAGGCTTCCTAGAGAGAGGTTGG - Intronic
1161979807 19:7624515-7624537 CAGGGGTTCCACATTGAGGCTGG - Intronic
1162625098 19:11879026-11879048 CAGGGTTTCCCCAGGGAGTTTGG + Intronic
1164683236 19:30149877-30149899 CAGTTTTCCCACCGTGTGGTTGG + Intergenic
1165821975 19:38682567-38682589 GAGGGTTCCAGCAGTGAGGCTGG - Intronic
1167783109 19:51613376-51613398 AATGGTTCCCACAGGGAAGTTGG + Intronic
925905928 2:8539694-8539716 CTGGGATCCCCCAGTGTGGTTGG - Intergenic
926140850 2:10367014-10367036 CTGAGATCCCACAGTGAGGCTGG + Intronic
926164050 2:10507195-10507217 CAGGGTTCCCACAGGGTCGGGGG - Intergenic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
928291368 2:30040435-30040457 CAGGGATCCCACAGTGGGCCTGG + Intergenic
928688702 2:33776318-33776340 CAAGGTTTCCACAGTGAGGAAGG - Intergenic
928714156 2:34041030-34041052 CAGGGTTCTCACATTCAGGTTGG + Intergenic
932566694 2:72915611-72915633 CAAGGTTCCCACAGGGATGCGGG - Intergenic
935815921 2:106845629-106845651 CAAGGTGACCACATTGAGGTAGG - Intronic
938017626 2:127880610-127880632 CAGCGTCCCCACAGAGAGGGAGG - Intronic
938676534 2:133641451-133641473 CTGGCTTCCTACAGTGAGCTAGG - Intergenic
940786729 2:157989425-157989447 CAGGGAGCCCACAGAGAGGGGGG - Intronic
948722318 2:239908843-239908865 CAGGTTTCCAACAGGGAGGTAGG - Intronic
1168768324 20:397197-397219 CACAGTTCCCAGAGTGAGCTGGG - Exonic
1170658679 20:18315418-18315440 CAGGGTTCCCTGACTGAGCTGGG - Exonic
1171078603 20:22155044-22155066 CAGGGATCACGCAGTGAGGCTGG + Intergenic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1172969083 20:38860526-38860548 CAGAGTTCCCTCATTCAGGTTGG + Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1179979856 21:44890248-44890270 CAGGCTCCCCCCAGTGATGTGGG + Intronic
1180611663 22:17102154-17102176 CAGGGTCTCCACGGTGATGTTGG - Exonic
1181890486 22:26058720-26058742 CAGGGATCCCACAGTGAGAGAGG - Intergenic
1182422107 22:30253727-30253749 CAGGGTGGCCCCAGTGAGCTTGG - Intergenic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
1183870253 22:40736446-40736468 CAGAGGTCCTCCAGTGAGGTTGG - Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
1184583121 22:45430340-45430362 CAGAGTTTTCACAGTGAGGAGGG + Intronic
1184918090 22:47587042-47587064 CACCATTCCCACAGTGAGGCAGG + Intergenic
1185021520 22:48379496-48379518 CAGGGTGCCCACAGTAATGCTGG + Intergenic
949626076 3:5867888-5867910 CAGTGTTCTCACAGTGTGCTGGG + Intergenic
949706793 3:6827673-6827695 CAGGGTAGCCACAGTGCCGTAGG - Intronic
950424868 3:12919713-12919735 CAGGGTTCCCACAGGGACTGAGG + Intronic
950433109 3:12962632-12962654 CATGGGTCCCTCAGTGAGTTAGG + Intronic
950573453 3:13816417-13816439 CTGGGAACCCACAGTGAGGGAGG + Exonic
950856353 3:16109342-16109364 CAAAGATCCCAAAGTGAGGTTGG - Intergenic
953046013 3:39294696-39294718 CAGGGCTCCCACTGAGAGGAGGG - Intergenic
953327018 3:42020802-42020824 CAGGGCTCCCACAGTAAACTTGG + Intronic
953823278 3:46228200-46228222 CAGGGTGTCCCCAGTGAGATTGG - Intronic
954652819 3:52175718-52175740 CAGGTATTCCACAGTGACGTGGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
955681552 3:61506622-61506644 CAGAGATCACATAGTGAGGTAGG - Intergenic
956788302 3:72660969-72660991 CAGGGTACACACAGTGGGGTGGG + Intergenic
958985067 3:100770804-100770826 CACGGTGACCACAGTGAGGTTGG + Exonic
961365603 3:126397664-126397686 CAGGGGTCTCAGAGTCAGGTGGG + Intronic
962321326 3:134392932-134392954 CAAGGATCCCAGAGTGAGCTGGG + Intergenic
962529984 3:136270385-136270407 AAGGGTTGCCTCTGTGAGGTAGG + Intronic
962890297 3:139666182-139666204 CATGCCTCCCACAGAGAGGTGGG + Intronic
966914778 3:184578612-184578634 CAGGGTACCCGGAGTGAGATAGG - Intronic
967440751 3:189505619-189505641 AAGGGTTCCCAAAATCAGGTAGG - Intergenic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
971081014 4:23211239-23211261 CAGTGTTCACACAGTGATGAAGG - Intergenic
972649967 4:41007188-41007210 CAGGGCTCCCACAGTAAGACTGG + Intronic
973048727 4:45568007-45568029 CAAGGTTTCCACAGTGTGGAAGG - Intergenic
978728408 4:111997555-111997577 AAGGGTTCCCAGTGTTAGGTGGG - Intergenic
986329409 5:6706564-6706586 CAGGTTTCCACCAGGGAGGTCGG - Intergenic
986684192 5:10261263-10261285 CTGGGTTCCCAGAGTGAGGGAGG + Intronic
986729538 5:10624951-10624973 CAGGGACCCCACATTGAGGATGG + Intronic
986732995 5:10649112-10649134 CAGGGTTCGCAGAGTGAACTAGG + Intronic
988155118 5:27439888-27439910 AGGGGTTCCCACAGTGCAGTGGG + Intergenic
991996702 5:72394818-72394840 CTGGGTTCCTACAGTGCAGTGGG - Intergenic
994605665 5:101962883-101962905 AAGGGCTCCCACAGTGCAGTGGG + Intergenic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1001699339 5:173695533-173695555 CAGGTTTCCACCTGTGAGGTAGG + Intergenic
1004510280 6:16279047-16279069 CACGGATTCCACAGTGAGGGTGG + Intronic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1005804607 6:29462491-29462513 GAGGGTGACCACAGTGAGATGGG - Exonic
1005818202 6:29574619-29574641 GAGGGTGACCACAGTGAGATGGG - Intronic
1005819839 6:29588666-29588688 GAGGGTGACCACAGTGAGATGGG - Exonic
1007207140 6:40162007-40162029 CAGGGTTCCCAAAGTATGGCTGG - Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1013709953 6:112885753-112885775 GAGGGATCCCACAGAGACGTTGG - Intergenic
1014814914 6:125924865-125924887 CAGGGGACCCACAGTGAGAGAGG - Intronic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1019089278 6:169513207-169513229 CATGGTGGCCTCAGTGAGGTGGG + Intronic
1019209769 6:170395473-170395495 ATGTGTTCCCACAGGGAGGTGGG + Exonic
1019697639 7:2455347-2455369 CCGGCTTCACAGAGTGAGGTAGG + Intergenic
1019828042 7:3300559-3300581 CAGGTTTCCCACCGTGGAGTGGG - Intergenic
1020113615 7:5462362-5462384 GTGGGTACCCACAGTGGGGTAGG - Intronic
1024690018 7:51789912-51789934 CCAGGTTCTCACAGTGAGGGCGG + Intergenic
1024783599 7:52880441-52880463 GAAGGTTCCCACAGTGAGAAAGG + Intergenic
1025029963 7:55548956-55548978 CAGGGTGACCACAGTGAGACTGG + Intronic
1026187151 7:68090851-68090873 AAGGGCTCCCACAGTGCAGTGGG + Intergenic
1026306121 7:69143407-69143429 CAGGGCTCCCACATTGCTGTTGG + Intergenic
1029893384 7:103955653-103955675 CAGGTTTCTGACAGTGAGTTGGG + Intronic
1034941020 7:155230348-155230370 CAGGGTTCCCTCAGTGGAGGAGG - Intergenic
1037162791 8:15793233-15793255 CAGAGTTTCCATAGTTAGGTGGG - Intergenic
1037548960 8:19951223-19951245 CAGGGTTCCCATTGTGAAGTAGG + Intronic
1037685553 8:21136705-21136727 CAGGGCTGCCATAGTGAAGTGGG + Intergenic
1040409923 8:47143791-47143813 CATGCTTCCCAGGGTGAGGTGGG - Intergenic
1040952763 8:52953294-52953316 AAGGGCTCCCACAGTGCAGTGGG + Intergenic
1043709817 8:83402862-83402884 AAGGGCTCCCACAGTGCAGTGGG - Intergenic
1044585230 8:93863615-93863637 CAGGGGTTCCACAGTGTGGAGGG - Intronic
1044849715 8:96416790-96416812 CAGGTTTCCTACAGTGACTTTGG - Intergenic
1048116764 8:131532226-131532248 GTGGGTTCCCACAGTGATGGGGG - Intergenic
1048352846 8:133629908-133629930 CAGAGTTCCCTGGGTGAGGTGGG + Intergenic
1048514538 8:135093986-135094008 CAGGGAACCCACAGTCAAGTAGG + Intergenic
1055715238 9:79110382-79110404 CTGGGTACCCACAATCAGGTGGG - Intergenic
1056681509 9:88723063-88723085 CAGGGTTCCCCCTGTTAGGTTGG - Intergenic
1057016555 9:91657565-91657587 CTGGGTACCAACAGTGGGGTAGG - Intronic
1057901865 9:98955359-98955381 CAAGGAACCCACAGTGATGTGGG - Intronic
1061809533 9:133154307-133154329 CAGGGTCCCCACTGTGTGCTGGG + Intronic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1185782472 X:2861519-2861541 CAGCTTTGCCACAGTGATGTGGG + Exonic
1187736619 X:22311404-22311426 TAGTGTGCCCACAGTGAGGGGGG + Intergenic
1187790705 X:22947032-22947054 CTGGGTGCACACAGTGAGATTGG + Intergenic
1187887624 X:23904455-23904477 TTGGGTTTCCACAGTCAGGTTGG - Intronic
1189494937 X:41500139-41500161 CAGGCTTCCCACAGGGTGGGAGG - Intergenic
1192325428 X:70128090-70128112 CATGGATCCCACAGTGAGTGGGG - Intergenic
1192509314 X:71712589-71712611 CAGGATGCCCACAGAGAGGGTGG - Intergenic
1192517383 X:71768964-71768986 CAGGATGCCCACAGAGAGGGTGG + Intergenic
1193223585 X:78955697-78955719 CAGGGCTCACAGACTGAGGTGGG - Intronic
1193566028 X:83078201-83078223 CTGGGTTCCCTCAGTGTTGTAGG + Intergenic
1193575163 X:83186569-83186591 GGGGGTTGCCACAGTGGGGTTGG - Intergenic
1196929435 X:120666531-120666553 CATGGATCCCACTTTGAGGTAGG + Intergenic
1197011116 X:121564809-121564831 CAGGGTTCTCTGAGTCAGGTCGG + Intergenic
1199069170 X:143456556-143456578 CAGGCTGTCCACAGTGAGTTAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201496995 Y:14598635-14598657 AAGGGCTCCCACAGTGCAGTGGG + Intronic