ID: 1150498539

View in Genome Browser
Species Human (GRCh38)
Location 17:65628214-65628236
Sequence GAAGCTGCTGAAATAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 5, 3: 27, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150498539_1150498544 16 Left 1150498539 17:65628214-65628236 CCCATTTCTATTTCAGCAGCTTC 0: 1
1: 1
2: 5
3: 27
4: 336
Right 1150498544 17:65628253-65628275 AATGCAATAAATAAAAATACTGG 0: 1
1: 1
2: 11
3: 137
4: 1541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150498539 Original CRISPR GAAGCTGCTGAAATAGAAAT GGG (reversed) Intronic
900093202 1:929511-929533 GGCGCTGATGAAATAGAAAAGGG + Intronic
902088949 1:13887286-13887308 GCAGATGCTGAAATAGTAATTGG - Intergenic
902682254 1:18051617-18051639 GAAGGCTCTGAAATACAAATGGG - Intergenic
903019457 1:20383829-20383851 GAAGCTGCTAAATTAGGAGTGGG + Intergenic
905727904 1:40270215-40270237 GAAGCAGCTGAAATATAAATAGG + Intronic
905985453 1:42277065-42277087 GAAGCTGATGAAATATACATGGG + Intronic
907200188 1:52719999-52720021 GAAATTGCTGAAATAAAAAAAGG + Intergenic
907998158 1:59653839-59653861 GATGAAGCAGAAATAGAAATCGG - Intronic
909708726 1:78619051-78619073 GAAGATGCTCAAAAACAAATGGG - Intergenic
911253905 1:95612199-95612221 GAACCTCCTGAAAGAGCAATTGG + Intergenic
911331772 1:96532673-96532695 TATGCTTCTCAAATAGAAATAGG - Intergenic
911774269 1:101787729-101787751 GAACATACTGAAAGAGAAATAGG + Intergenic
912079034 1:105912474-105912496 GAAGCTGCAGAAATAGGCCTTGG + Intergenic
912504349 1:110145792-110145814 GAAGGGGCTGAGATGGAAATGGG - Intergenic
914323068 1:146584169-146584191 CCTGCTTCTGAAATAGAAATGGG + Intergenic
914946271 1:152069440-152069462 TAAGCTGGTGAAATTGAAAATGG - Intergenic
915224151 1:154399707-154399729 GAAGATGTTGAAGTAGAATTTGG - Intergenic
915794892 1:158719398-158719420 GAAGCTTATGAAAGAGAGATTGG - Intergenic
917625908 1:176846018-176846040 GAAGCTGTGGAAGTAGGAATGGG + Intergenic
918516864 1:185372987-185373009 GAAGGTGTTCAAATAGAAAGTGG - Intergenic
919356379 1:196528061-196528083 GAAGCTTGTGTAATAGACATGGG - Intronic
919776823 1:201199637-201199659 GAAGTTGCTGAAAAAGAGGTGGG + Exonic
919830397 1:201536828-201536850 AAAGCTACTGAAAGAGAAAGTGG - Intergenic
920079087 1:203359259-203359281 GAAGCTGCAGCAAAAGACATAGG - Intergenic
924605325 1:245529309-245529331 GAAGCTGCTGCAATGAATATTGG - Intronic
1063805373 10:9633276-9633298 AATACTGCTGAAAGAGAAATAGG + Intergenic
1063853832 10:10224155-10224177 GAAGTTGATGAGATAGAAAAAGG + Intergenic
1064450439 10:15437378-15437400 AAAGCTGTTGAAATGGAAAAAGG + Intergenic
1064548327 10:16473727-16473749 GAAGCTGCTGAAAGAGATATTGG + Intronic
1064796579 10:19018825-19018847 GAAGATGCAGACATAGGAATAGG - Intergenic
1066225339 10:33377228-33377250 GTAGCTGCTGCAATTGAAGTTGG - Intergenic
1066755601 10:38709149-38709171 AAAGCTGATAAAATATAAATTGG + Intergenic
1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG + Intergenic
1071109962 10:82144321-82144343 GAAGCAGCTCTAATAGGAATTGG + Intronic
1071466031 10:85940497-85940519 GTGGCTTCTGAAAAAGAAATTGG + Intronic
1072850371 10:98884194-98884216 GAAGCTGCTGAAGAAAAAGTTGG + Intronic
1073026198 10:100488971-100488993 GAAGCTGCTGATAAAGAAGCAGG + Exonic
1073975709 10:109098506-109098528 GAAGCAGCAGAAATAAAATTAGG - Intergenic
1074447532 10:113532922-113532944 GAAGCTGCTGCAAGAGGAGTGGG - Intergenic
1074631992 10:115268310-115268332 GAAGCAGCTATAATACAAATGGG - Exonic
1080834122 11:35924238-35924260 GCTGCTCCTGGAATAGAAATGGG - Intergenic
1081258391 11:40926583-40926605 GAATCTGCTAAAATAGAAAAGGG + Intronic
1083797586 11:65026419-65026441 GAAGCTGCTGAGATGGGAAAGGG - Intronic
1086009438 11:82081894-82081916 GCAGCTGCTGAGCAAGAAATAGG - Intergenic
1086540569 11:87905079-87905101 GAAGCTACTCAAACTGAAATAGG - Intergenic
1086571748 11:88292924-88292946 GAAGGTGCTCAAAGAGAACTCGG + Intergenic
1087447374 11:98271626-98271648 GATGCTACTCCAATAGAAATAGG - Intergenic
1089839769 11:121405717-121405739 GAAGCTGCTACAACACAAATTGG - Intergenic
1089993017 11:122879407-122879429 GACGCTGCTGAGCTAGACATAGG + Intergenic
1091426220 12:392014-392036 GAAGCTGATGAAACACAATTTGG - Intronic
1091877427 12:3947483-3947505 GAAGCTGCTTAAGTATAGATTGG - Intergenic
1091945810 12:4540249-4540271 GAACATGCTGAATTTGAAATGGG + Intronic
1093567247 12:20622213-20622235 GAGGCTGGTGACATAAAAATTGG - Intronic
1093831016 12:23758522-23758544 TAATCTGCTGAATTAGATATTGG + Intronic
1093996428 12:25647685-25647707 GAAGATGATGAATTAGTAATTGG - Intronic
1097874519 12:64631200-64631222 GAAGCTGGAGAAAAAGAAAAGGG + Intronic
1098076183 12:66734144-66734166 GATGCTGCTGTAATTAAAATAGG - Intronic
1098124640 12:67278004-67278026 GAAGCTACTGAAAAACAACTGGG - Intronic
1098796916 12:74900632-74900654 GTAGCTGTTGAAGTATAAATTGG + Intergenic
1099213401 12:79821912-79821934 GAAGGGGAGGAAATAGAAATGGG + Intronic
1100654779 12:96630178-96630200 AAAGCTGCAGTAATGGAAATTGG + Exonic
1100679441 12:96902541-96902563 GAAGCTGCTGAGATGGAAAAGGG - Intergenic
1105315914 13:19263010-19263032 GATGCTGCTGAATTTGAATTGGG - Intergenic
1106421337 13:29588840-29588862 AAAACTGCTGAAAAAGAAAAGGG + Intronic
1106456238 13:29929754-29929776 GCAGCAGCTGGAATAGAAAAAGG + Intergenic
1106491321 13:30225330-30225352 GAAGCTGATTAAATAGTTATGGG - Intronic
1108520821 13:51245424-51245446 GAAGCTGCGCCAATAGAAAAGGG - Intronic
1109205814 13:59481544-59481566 GGAAATTCTGAAATAGAAATGGG - Intergenic
1109499945 13:63221420-63221442 GAACGTGCTGAAATAGCATTTGG + Intergenic
1109623026 13:64934750-64934772 GTAGCTGATGAATTAGATATGGG - Intergenic
1109689934 13:65873085-65873107 GAAGTTGCAGAAATAGGCATAGG - Intergenic
1110214244 13:73008928-73008950 AAAGCTGCTGAACTAGCAGTGGG - Intronic
1111184936 13:84721076-84721098 GAAACTGGTGAAATTTAAATAGG - Intergenic
1112039979 13:95537488-95537510 AAAGGTGCTGAAGTAGAATTGGG + Intronic
1112734830 13:102404275-102404297 GAAATAGCTGAAATATAAATAGG + Intergenic
1113092656 13:106631808-106631830 GAAGCAGGTGAAATAGAAAGAGG - Intergenic
1113128908 13:107012880-107012902 TAAGATGCTGAAACAGAAAAAGG - Intergenic
1113305457 13:109073585-109073607 GTACCTGCTGATGTAGAAATAGG + Intronic
1114808403 14:25864816-25864838 GAAGCTCCTGAAATAGGAATAGG - Intergenic
1115300901 14:31883877-31883899 GAAGCTGGTGAACTAAAAAGAGG + Intergenic
1115721556 14:36167201-36167223 TAAGTTGGTGAAACAGAAATAGG - Intergenic
1116576155 14:46578315-46578337 GGAGCTGCAGTAAAAGAAATGGG - Intergenic
1117118336 14:52540191-52540213 GAAAATGCTAAAATATAAATGGG - Intronic
1117488155 14:56219672-56219694 TTGGCTACTGAAATAGAAATGGG - Intronic
1117694630 14:58347068-58347090 GAAGCAGCTGAATTCAAAATAGG - Exonic
1118870122 14:69734369-69734391 GGAGCTGCAGAAAGAGAAAGAGG + Intronic
1119000184 14:70874679-70874701 GAAGTTGCTGAAAAAGATTTTGG + Intergenic
1119395189 14:74321079-74321101 GAAGGTGAGAAAATAGAAATGGG + Intronic
1120039352 14:79735097-79735119 GAAGCTGCTGTATTAGAAATAGG - Intronic
1120310941 14:82827471-82827493 AAAGCTCCTGTAATAGCAATGGG - Intergenic
1120646070 14:87075799-87075821 GAAGTTGCTGAAATTAATATTGG - Intergenic
1120901325 14:89578257-89578279 GAAGTTGCTGAAAGAGAAGTGGG - Intronic
1122307510 14:100775270-100775292 GAATCTGCTGTAATAAACATGGG + Intergenic
1122434763 14:101687910-101687932 GGAGATGCTGAAATGGCAATGGG - Intergenic
1125127372 15:36239865-36239887 GAAGCTGCTGCAATAGTGACTGG - Intergenic
1125680111 15:41525137-41525159 AAAGCTGCTCAACTGGAAATGGG + Exonic
1126385587 15:48090084-48090106 AAACCTGCAGAAAAAGAAATTGG + Intergenic
1126925306 15:53578775-53578797 CAAGTTGCTGAAAGAGAAAAGGG - Intronic
1127328484 15:57917153-57917175 GAAGCTGCTAAAGTAGAATGGGG + Intergenic
1128179679 15:65590788-65590810 GATGTTCCTGAAATTGAAATGGG + Intronic
1128904615 15:71455762-71455784 GTAGATGCTGAAAGAGAAGTGGG + Intronic
1130094811 15:80848099-80848121 GACCCAGATGAAATAGAAATTGG + Intronic
1130233149 15:82112099-82112121 GAGGCTGCTGAAATGTAAATGGG - Intergenic
1130675004 15:85943837-85943859 GAAGCTGCTGCAATAGTGAGTGG + Intergenic
1131216437 15:90540035-90540057 GAAGCTTCTGAAATTGAACCTGG - Exonic
1131322548 15:91408737-91408759 GAAGCTGGTGACAAAGAAATCGG + Intergenic
1132146706 15:99433576-99433598 GAAGCTGCAGAAATAGCTCTGGG - Intergenic
1133842016 16:9418485-9418507 AAAGCTGCTGAAAAGGAAACAGG - Intergenic
1134409081 16:13988383-13988405 GAAACTGCTGAAGTAGGAAAAGG + Intergenic
1135596406 16:23747345-23747367 GATGCTACTAAAACAGAAATTGG + Intergenic
1135971238 16:27073534-27073556 GATGCTGCTGACACAGAAGTGGG - Intergenic
1136727081 16:32367693-32367715 AAAGCTGATAAAATATAAATTGG - Intergenic
1137747796 16:50835787-50835809 GGAGCTGCTCAAATACAAGTTGG + Intergenic
1137757273 16:50912655-50912677 GAAACAGTTGAAATAGACATTGG - Intergenic
1137863774 16:51872554-51872576 GTAGCTTCTGAAACACAAATAGG + Intergenic
1137944041 16:52716938-52716960 GCAGATGCTGAAATGGAATTTGG + Intergenic
1140010491 16:71126681-71126703 CCTGCTTCTGAAATAGAAATGGG - Intronic
1140287407 16:73617370-73617392 GAAGTTGCTGAAATATACACTGG + Intergenic
1142419267 16:89960586-89960608 GGAGCTGCTGAAACCGAGATGGG + Intronic
1202999353 16_KI270728v1_random:150055-150077 AAAGCTGATAAAATATAAATTGG + Intergenic
1203130951 16_KI270728v1_random:1686465-1686487 AAAGCTGATAAAATATAAATTGG + Intergenic
1144189281 17:12829242-12829264 AAACATGCTGAAATAGAAATAGG - Intronic
1148054357 17:44785138-44785160 GTAGCTGCTGAGTTTGAAATTGG - Intergenic
1148619723 17:49025514-49025536 GAAGGTGGGGAAATAGAAACTGG + Intronic
1149138713 17:53403024-53403046 AAAGATACTAAAATAGAAATAGG - Intergenic
1150498539 17:65628214-65628236 GAAGCTGCTGAAATAGAAATGGG - Intronic
1150793360 17:68218265-68218287 GGACCTACTAAAATAGAAATGGG + Intergenic
1152132358 17:78485001-78485023 GAAGCCGCTGGAGAAGAAATCGG - Exonic
1155300487 18:24424933-24424955 GAAGCTGCAGAAATATGAAAAGG + Intergenic
1157241084 18:46010073-46010095 GCAGCTGGTGAAACAGCAATAGG + Intronic
1157878189 18:51293461-51293483 GGACTTGCTGAAAGAGAAATGGG - Intergenic
1158304708 18:56092325-56092347 GCAGCTTCTAAAATAGAAACAGG - Intergenic
1159135029 18:64327398-64327420 GCAGATGCTGAAATTGCAATAGG - Intergenic
1159408184 18:68033781-68033803 GAAAAGGCTGGAATAGAAATAGG + Intergenic
1159634979 18:70794356-70794378 GAAGATGCTGACACAGAAAAAGG + Intergenic
1159914314 18:74175013-74175035 GAAGCTGGTAACACAGAAATGGG + Intergenic
1160477403 18:79204678-79204700 GTATCTGCAGAAATAGTAATTGG + Intronic
1163092727 19:15032284-15032306 GAAGCTGCTGAAACCCAGATAGG + Intergenic
1166511526 19:43412489-43412511 GGAGCTGTTGAAGCAGAAATGGG + Intronic
1167634208 19:50644576-50644598 GAAGCTGCAGAAATAGACGAAGG + Intronic
1167771043 19:51518766-51518788 GAAGCTGTGGAAATGGACATGGG + Intergenic
925621129 2:5793961-5793983 AAAGATGCTGAAAGAGAAAAGGG - Intergenic
926296576 2:11573263-11573285 GCAGCTGCTGAACTAGACACAGG + Intronic
926951683 2:18249945-18249967 GTAGATGCAGAAATAGAAGTAGG - Intronic
928204178 2:29272318-29272340 GAAGATGCTGAAAGAGAAAATGG - Intronic
929394317 2:41505056-41505078 GAAGGTGCTGAAATGGGAGTTGG - Intergenic
933547297 2:83730595-83730617 GAAGATGCAGTTATAGAAATTGG + Intergenic
933705648 2:85287869-85287891 GGAGCTGCATAAATAGAAAGAGG - Intronic
934102144 2:88663434-88663456 GAAGAGGCTGAAACAGAAGTCGG - Intergenic
934318898 2:91953387-91953409 AAAGCTGATAAAATATAAATTGG + Intergenic
937230517 2:120395840-120395862 GGAGCTGCTCAAATAGGAAGTGG - Intergenic
937642861 2:124233489-124233511 GAAGCTGGTGAAATAGGAAAGGG - Intronic
937886679 2:126904114-126904136 GATGCTGGGGAAATAAAAATTGG + Intergenic
938237869 2:129721308-129721330 GAAAATGCTGAAATAGAAAGGGG - Intergenic
938887384 2:135665456-135665478 GAAGCAGCTGAAAAAGAGACCGG - Intronic
939238057 2:139522948-139522970 GAAGCTGCAGAAGTATAAAGGGG - Intergenic
939670487 2:145005671-145005693 GAAGCTGCAGGAGCAGAAATTGG - Intergenic
940543408 2:155051342-155051364 GAATCTGCTGTAATTCAAATTGG - Intergenic
942333113 2:174850229-174850251 GTAGCTGTTTAAATAGAATTAGG + Intronic
942375064 2:175328295-175328317 GAAGAGACTGAAATAAAAATTGG - Intergenic
942441302 2:176039604-176039626 GCAGATGCTGAAATTGAAATTGG - Intergenic
947298537 2:228661648-228661670 GAATATTCTGAAATAGAAATAGG - Intergenic
947517536 2:230820306-230820328 AAACCTGCTGAAACAGCAATTGG - Exonic
947783326 2:232790856-232790878 GAGGATGCTGAAGAAGAAATGGG + Exonic
948680356 2:239629764-239629786 GCAGATGGTGAAATAGAATTGGG - Intergenic
1168908433 20:1425581-1425603 GAAGACAATGAAATAGAAATGGG - Intergenic
1169355371 20:4900851-4900873 GAAGCTGCTGGAAGAAAAGTAGG - Intronic
1170683060 20:18543986-18544008 GAAGCTGCTGAATGAGCACTCGG + Intronic
1172058346 20:32170342-32170364 GAAGCAGCTGGAAGAGAAAATGG - Intergenic
1174049209 20:47755942-47755964 AAAGATACTGAGATAGAAATGGG - Intronic
1174523540 20:51153768-51153790 GCAGTAGCTGAAAAAGAAATAGG + Intergenic
1174561417 20:51433090-51433112 GGAGCTGCTGGGATAGAAAGAGG - Intronic
1174585718 20:51606580-51606602 TAAGATGCTGAACTAGAAACAGG + Intronic
1174947467 20:55003840-55003862 TGAGCTGCTGATATAAAAATGGG - Intergenic
1175315395 20:58043566-58043588 GCAGCTGCTGAAGTGGAATTTGG - Intergenic
1175694166 20:61088823-61088845 GGAGCTGCAGAAGAAGAAATGGG + Intergenic
1175767260 20:61600107-61600129 GATGCTGCTGAGAATGAAATGGG + Intronic
1176944632 21:14964505-14964527 GAAACTACTGAACTAGCAATTGG - Exonic
1176990142 21:15485956-15485978 AAGGGTGCTGAAAAAGAAATGGG - Intergenic
1178334914 21:31733792-31733814 GAAGGAGCTGAAATAGATAGGGG + Intergenic
1179592111 21:42415679-42415701 GATGCTGCTGAAGCAGAAATTGG + Intronic
1180307078 22:11137048-11137070 AAAGCTGATAAAATATAAATTGG + Intergenic
1180545598 22:16499231-16499253 AAAGCTGATAAAATATAAATTGG + Intergenic
1181453020 22:23036639-23036661 GTAGCTGCTGAAAGAGGAAGGGG + Intergenic
1182011308 22:27002953-27002975 GTGGCTGCTGAAATGGAAGTAGG - Intergenic
1182155457 22:28067884-28067906 GAAGCTGCCTAAATCAAAATGGG - Intronic
1184306664 22:43607517-43607539 TAAGCTACTCAAACAGAAATGGG + Intronic
949278478 3:2317684-2317706 GCAGCTGCTGTGAAAGAAATTGG + Intronic
949553155 3:5129501-5129523 GCAGTTGCTGAAATATAAAAAGG - Intronic
950170068 3:10832916-10832938 CAAGCTGCTGAAGTAGGAAGGGG + Intronic
951297641 3:20958875-20958897 GAAGCTGGTGAATGATAAATGGG + Intergenic
951752634 3:26054519-26054541 GATTCTGCTGACAGAGAAATAGG + Intergenic
952261297 3:31742949-31742971 CAAGCTGCTGAAGTAGATTTAGG + Intronic
953013384 3:39050101-39050123 GAAGCTGTTGAAATACAGGTAGG - Intergenic
953861503 3:46547768-46547790 GAAAGTGCTGAAAGAGAAGTGGG + Intronic
956627784 3:71283446-71283468 TAAGGAGCTGAAAGAGAAATGGG + Intronic
956983955 3:74674994-74675016 TAAGATGTTGAGATAGAAATGGG + Intergenic
958492932 3:94801172-94801194 GAAGCTGCAGAAAAAAAAGTTGG - Intergenic
958815942 3:98915670-98915692 GTAGCTGCTAAAATGCAAATAGG - Intergenic
959372234 3:105541774-105541796 GAAGCTGCTGATGAAGAAGTAGG - Intronic
960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG + Intergenic
960031051 3:113055386-113055408 GGAGCTGCAGAAGTAGAAAGAGG - Intergenic
960249285 3:115434542-115434564 GAAGATGCTGTTATAGAACTGGG + Intergenic
960599740 3:119444721-119444743 AAACCTACTGAAATAGAAACTGG - Intronic
960606438 3:119510205-119510227 GTAACTGCTGAAATATAAAAAGG - Intronic
960814482 3:121658771-121658793 GTTGCTGTTGAAATACAAATTGG + Intronic
961127642 3:124434757-124434779 GGAGGTGTTGAAATAGAAATTGG + Intronic
961803342 3:129469838-129469860 GGAGCTGCTGACATAGAGCTGGG + Intronic
962154061 3:132925732-132925754 AAATCTGCTGAATTAGAAACTGG + Intergenic
962775168 3:138652275-138652297 GGAGCTACTGATTTAGAAATGGG - Intergenic
964224569 3:154383243-154383265 GAAGCTGGGGAAACAGGAATGGG + Intronic
965102588 3:164320058-164320080 TAAGCTGCAGAGATAGAAATTGG - Intergenic
965421558 3:168465647-168465669 AAATCTGCTAAAATGGAAATTGG - Intergenic
965821967 3:172693365-172693387 AAAGTTGCTGAAATACAGATTGG - Intronic
966178876 3:177169961-177169983 GGACCTGCTGAATCAGAAATTGG + Intronic
966357152 3:179093061-179093083 GAAAGTGCTTAAATAGTAATGGG - Intergenic
966651348 3:182304374-182304396 GAAACTTCTGAAAGAGAAAGAGG + Intergenic
966900016 3:184475146-184475168 GGAGCTGCGGAAATCGACATAGG - Intronic
968354739 3:198096753-198096775 TAAATTGCTGAAAGAGAAATGGG + Intergenic
968955682 4:3717657-3717679 GAAGCTGCTGATTTAGAAATTGG - Intergenic
970253582 4:14142962-14142984 GAAGTTGCTGAAATGGAATGAGG - Intergenic
970296141 4:14632779-14632801 GGAGCTACTGACAGAGAAATTGG - Intergenic
970806726 4:20045300-20045322 GAATTTGCTAAAATAGGAATGGG - Intergenic
970922017 4:21405561-21405583 CAAGTTGCTGAACTAGAAAGTGG - Intronic
972200930 4:36714061-36714083 GAACCTGGTGAAATAGCCATTGG + Intergenic
972827152 4:42772398-42772420 GATGGTGCTGATATAAAAATAGG + Intergenic
973025506 4:45264625-45264647 GAATCTGCTAATTTAGAAATTGG + Intergenic
973529309 4:51819121-51819143 GAAGGACCTGAAACAGAAATGGG + Intergenic
974285801 4:59865462-59865484 GATGCTGATGAGAAAGAAATAGG + Intergenic
974615557 4:64274831-64274853 GAAACTGCTGAAATAAAGACTGG - Intergenic
975998366 4:80341657-80341679 GAAGATGCTGAACTTTAAATGGG - Intronic
976385625 4:84454344-84454366 GAAGCTGCTGGATTTGAACTTGG + Intergenic
976612416 4:87043658-87043680 GAAGCTGCTGAACCAGAAACTGG - Intronic
976711932 4:88081883-88081905 AAAGATTCTGAAATAGAATTAGG - Intergenic
976874707 4:89838065-89838087 GAAGGGGCTGAAGAAGAAATTGG - Intronic
977140008 4:93358687-93358709 GTAGATGCTGAAGTAGAATTTGG - Intronic
977809789 4:101346392-101346414 GTAGCTGCTGTGACAGAAATAGG - Intronic
977951250 4:102972788-102972810 AAAGCTGATAAAATATAAATTGG + Intronic
978108043 4:104928674-104928696 GAACATGGTAAAATAGAAATAGG + Intergenic
978488620 4:109285982-109286004 GAGGCTGGTGGAATAGAAGTAGG + Intronic
978612683 4:110561113-110561135 AAAGCAGCAGAAACAGAAATGGG + Intronic
978904290 4:113987469-113987491 GAAACAGCTGAAAAACAAATGGG + Intergenic
979534884 4:121808401-121808423 CACGCTGCTGAAATCCAAATTGG - Intronic
979655353 4:123186458-123186480 GAAGTTGTTCAAATAGAAGTTGG + Intronic
979872962 4:125849746-125849768 AAAGTTGGTAAAATAGAAATAGG - Intergenic
980437939 4:132803014-132803036 GAAGCAGCAGAAATAGAAACAGG - Intergenic
982334033 4:154214165-154214187 GAAGATTCTGAGAAAGAAATGGG + Intergenic
982911782 4:161150957-161150979 GAAGCTGAAGAGATAGAAAATGG + Intergenic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
983720069 4:170839863-170839885 GAAGCTCCTGAAACAGAAAATGG + Intergenic
984526262 4:180862236-180862258 GAAGCAGCAGAAATGGAGATAGG + Intergenic
984923593 4:184787190-184787212 GAAGTGGCTAAAATAGAAAGAGG + Intronic
986957261 5:13168224-13168246 AATGCTGCTGCAATATAAATGGG + Intergenic
987303084 5:16614815-16614837 GAAGCAGCTGAAAAAGAACAAGG + Intronic
987769223 5:22278489-22278511 AAATCTGCTGAAAGAGGAATAGG + Intronic
988157013 5:27466982-27467004 GAAACTGCTGAAAAAAAATTTGG - Intergenic
988294918 5:29344340-29344362 GAAACTGCTGAAAATGAAACTGG - Intergenic
989223831 5:39002551-39002573 GAAGGTGCTAAAATTGAAAGTGG - Exonic
989317719 5:40102316-40102338 GAAGCAGATGACATAGAATTTGG + Intergenic
990294065 5:54382348-54382370 GAATATGCTCAATTAGAAATGGG + Intergenic
990405672 5:55488228-55488250 CAAGCAGCTTAAATAGCAATAGG - Intronic
990474800 5:56151990-56152012 CAAGCTACTGAACTAGAAACTGG + Intronic
992122321 5:73607836-73607858 GAAGCAGCTGTAAAAGGAATGGG - Intergenic
993058556 5:83011561-83011583 AATGCTAATGAAATAGAAATAGG + Intergenic
993937781 5:94024940-94024962 GAAGCTGGAGAAATATAAAAGGG + Intronic
995511533 5:112914903-112914925 GTAGCAGCTGAAATATAAGTGGG - Intronic
996015027 5:118523808-118523830 AAGGATGCTGAAATAGGAATTGG + Intergenic
998000482 5:138621232-138621254 AAAGCTGGTGAAACACAAATAGG + Intronic
999519451 5:152335727-152335749 GGGGGTGCTCAAATAGAAATTGG + Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000889632 5:166787094-166787116 GAATCTGCAGAAAAAGAAAGGGG + Intergenic
1000896549 5:166861977-166861999 CAAGCTGCTGAAATTTAAAATGG + Intergenic
1001473620 5:172033669-172033691 GAGGATGCTGAAACAGAAATTGG - Intergenic
1001569792 5:172723052-172723074 GAAGCTGCAGATATGGAAAAGGG + Intergenic
1001692487 5:173643437-173643459 GAAGCTGATGCAACAGAATTGGG + Intergenic
1001874684 5:175189347-175189369 GAATATGCTCAACTAGAAATGGG + Intergenic
1003462887 6:6348522-6348544 ACATCTGCTGAATTAGAAATAGG + Intergenic
1003481226 6:6535129-6535151 AAAGCTGCTGAAACTGTAATTGG + Intergenic
1004545992 6:16598845-16598867 AAGGCTGCTGACATAGAAACTGG + Intronic
1004925098 6:20408743-20408765 GCAGCTGATGGAATAGAAAGGGG + Intronic
1004987953 6:21104157-21104179 GAGCATGCTGAAATAGATATGGG - Intronic
1005639322 6:27780664-27780686 GAAGCAGCTGGAAGAGAAAATGG - Intergenic
1006892788 6:37443983-37444005 GTAGATGCTGAAAAAGAAAAAGG - Exonic
1008846342 6:55968687-55968709 GTAGCTGTTGTAATAGAAATAGG + Intergenic
1010062439 6:71638981-71639003 AAACATGCTTAAATAGAAATAGG - Intergenic
1010139485 6:72597868-72597890 GCAGCTGCACAAAAAGAAATGGG + Intergenic
1010797295 6:80132187-80132209 GAATCTTCTGAAGAAGAAATAGG - Intronic
1011099388 6:83705958-83705980 AAAGCAGCTGAAATAGGAACTGG - Intronic
1011302158 6:85887709-85887731 GAAGCTGCTGCATTAGAAGATGG + Intergenic
1011376107 6:86688776-86688798 GAAGCTGAGGAAATATCAATGGG + Intergenic
1012766074 6:103368466-103368488 GAAGATGAGGAAAAAGAAATTGG + Intergenic
1013189064 6:107786495-107786517 GTAGGTGCTGTGATAGAAATGGG - Intronic
1013200038 6:107885603-107885625 AAAGCTGCTGAAATTTACATTGG - Intronic
1014628239 6:123756480-123756502 AAAGCTCCTGAAAAAGAAATTGG - Intergenic
1015235625 6:130967627-130967649 GAAGCTGCTGAAAGAGATTGGGG - Intronic
1015426911 6:133081662-133081684 GAAGCTATGGAAATAGAAAGGGG - Intergenic
1016166902 6:140957232-140957254 GCAGCTGCTGTAATATCAATGGG - Intergenic
1016357642 6:143235515-143235537 GAAGCTTCTGGAATGGAAAATGG + Intronic
1017256999 6:152344671-152344693 GATGCTTCTGCAATAGAGATAGG + Intronic
1017573707 6:155777708-155777730 GAGGCAGCTGAAATATGAATTGG + Intergenic
1020451762 7:8327687-8327709 TTAGCAGCTGTAATAGAAATTGG + Intergenic
1020783237 7:12541476-12541498 GAAGTCACTGAAATATAAATGGG + Intergenic
1021838574 7:24704403-24704425 GAAAGTGCTGGAATAGAAAATGG - Intronic
1022001212 7:26228314-26228336 GGAGCTGGTCATATAGAAATAGG + Intergenic
1024722837 7:52157096-52157118 GAAGCAGTTACAATAGAAATTGG - Intergenic
1025861535 7:65335218-65335240 GAAGCAGCTGGAAGAGAAAATGG - Intergenic
1027552296 7:79614055-79614077 GAATTTGCTGAAATTGACATAGG + Intergenic
1027894329 7:84021759-84021781 GAATCTCCTGAACTAAAAATTGG + Intronic
1028328191 7:89553243-89553265 GATTCTACTGAAATAAAAATAGG + Intergenic
1028387234 7:90269873-90269895 GAAGCTGGTAAGAAAGAAATGGG + Intronic
1029226156 7:99030129-99030151 GCAGCTGCTCAAATTGAAAAGGG + Exonic
1030148020 7:106376098-106376120 GAAGCTCCTGAAAAAGAACAAGG + Intergenic
1030927297 7:115474776-115474798 AAAGTTGCTGCAATAGAATTGGG - Intergenic
1031042049 7:116848985-116849007 GAAGCTGCTGAAATAGAAGTAGG + Intronic
1031466615 7:122120117-122120139 AAATCAACTGAAATAGAAATGGG - Intronic
1032625936 7:133591132-133591154 GGAGATGCTGCAATTGAAATAGG - Intronic
1033200622 7:139365926-139365948 GCAGCTGCTAGAATAGATATTGG + Intronic
1036999412 8:13699938-13699960 TAAGGAACTGAAATAGAAATGGG - Intergenic
1037076174 8:14721672-14721694 AAAGTTGCTGAAATAGGAAAAGG - Intronic
1037770610 8:21797043-21797065 GAAGCTGCTGATCTAGGACTGGG + Intronic
1037830311 8:22184423-22184445 GGAGCTGCAGAAAGAGAAAAGGG + Intronic
1038936736 8:32260132-32260154 GAACTTGCTCAAATAGAAATGGG + Intronic
1039418478 8:37416427-37416449 GGACCTGCTGAAAAACAAATTGG - Intergenic
1039708363 8:40030751-40030773 GAAGCTTCTGAGAGAGAAGTGGG + Intergenic
1039829148 8:41199177-41199199 GGAGCTGCTGGAGTAGAAACAGG + Intergenic
1041453345 8:58031452-58031474 GGAGCAGCTGAATTAGAAACAGG + Intronic
1041684047 8:60626105-60626127 GAAACCGGTGAAATAGGAATAGG + Intergenic
1042944620 8:74142708-74142730 AAAGCTTCTGAAATAGTATTTGG + Intergenic
1043538411 8:81231862-81231884 GAAGCTGCTGAGACAGAGCTTGG - Intergenic
1044032436 8:87254838-87254860 GAGGCTACTGTAATAGAAAATGG + Intronic
1044481042 8:92688392-92688414 GAAGGAGCTGAAAGGGAAATTGG + Intergenic
1045309565 8:100989141-100989163 GAATCTGCTCAAGTAGCAATAGG + Intergenic
1045626021 8:104051574-104051596 GAAACTGCTCAAAAAGAAAAGGG + Intronic
1045949886 8:107839637-107839659 GCAGCTGATGAAATAGAACAGGG - Intergenic
1046302802 8:112319900-112319922 GAAGATGATGAATTTGAAATAGG - Exonic
1046908483 8:119600487-119600509 GAAGCTCCTGTAACAGAAACAGG + Intronic
1047171256 8:122495241-122495263 AGAGCTGCTGAACTGGAAATGGG - Intergenic
1049519198 8:143079689-143079711 GCAGATGCTGCAAAAGAAATTGG + Intergenic
1050906343 9:11011631-11011653 GAAACTGGTGATACAGAAATGGG - Intergenic
1051305926 9:15709174-15709196 GAATAGGCTGAAATAGAAAAAGG + Intronic
1052550490 9:29941441-29941463 GCAGCTGATGAACTAGAAAGAGG + Intergenic
1052593299 9:30526984-30527006 GGAGATGCTGAAAAAGAAACAGG + Intergenic
1052984651 9:34477867-34477889 TAAGCTGCAGAAATAGATCTGGG + Intronic
1055071324 9:72169174-72169196 GAAGCAGGTGAAATAGATATTGG + Intronic
1055969533 9:81898121-81898143 AAAGCTATTGAAATAAAAATGGG + Intergenic
1058910238 9:109514153-109514175 GAAGGTCCTGAAATAGAAAGTGG - Intergenic
1059105131 9:111504386-111504408 AAAGCTGCATAAAGAGAAATTGG + Intergenic
1059875327 9:118628364-118628386 CATGCTACTGAAATAGAGATGGG - Intergenic
1062605474 9:137346534-137346556 GAAGGTTCGGAAATAGAAGTGGG - Intronic
1185854936 X:3525023-3525045 GAAGATGCTGGAACAGAAAGAGG - Intergenic
1186379285 X:9040148-9040170 GAAGCTGCTGTATCAGAAGTAGG + Intronic
1187564094 X:20431377-20431399 TAATCTGCTAAAATAGAAAAAGG + Intergenic
1188577188 X:31665854-31665876 AAAGCAGCTGGAAGAGAAATGGG - Intronic
1189256531 X:39644392-39644414 GAAGCTGAGCAAATAGAAAGAGG + Intergenic
1190158364 X:48011930-48011952 CAAGTTGCTCTAATAGAAATTGG + Intronic
1190174135 X:48134812-48134834 CAAGTTGCTCTAATAGAAATTGG + Intergenic
1190462194 X:50688289-50688311 GATACTGCTGCAATAGATATGGG - Intronic
1190816453 X:53934123-53934145 GAAGCTACTGAAGGAGAGATGGG - Intergenic
1191757755 X:64612594-64612616 GAAGCTGAAGCAATAGAAGTAGG - Intergenic
1191834672 X:65451823-65451845 TAAGCTCCTGAAAAAGAAACTGG - Intronic
1191995031 X:67084930-67084952 GAACTAGCTGAAAAAGAAATCGG - Intergenic
1192341594 X:70267893-70267915 GGAGCCGCTGATATAGAGATTGG + Intergenic
1193419139 X:81262609-81262631 AAAGCTGATGAAATCCAAATAGG + Intronic
1196044299 X:111240750-111240772 GAAGGAGCAGAAAAAGAAATTGG + Intergenic
1198613351 X:138426007-138426029 GAAATTGATGAAAGAGAAATGGG - Intergenic
1198897271 X:141469506-141469528 GCAGCTCCAGAAATAGTAATTGG - Intergenic
1199421211 X:147646631-147646653 GTAGTAGCTGAAATAGCAATAGG + Intergenic
1199713145 X:150486483-150486505 GAAGCTGCCTAAATGAAAATGGG + Intronic
1201186450 Y:11408471-11408493 AAAGCTGATAAAATATAAATTGG + Intergenic
1201964521 Y:19717216-19717238 GTAGCTGCTTACATAGGAATTGG - Intronic