ID: 1150500465

View in Genome Browser
Species Human (GRCh38)
Location 17:65646070-65646092
Sequence TAGTGGGCAGGGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 1, 2: 4, 3: 109, 4: 975}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150500465_1150500473 6 Left 1150500465 17:65646070-65646092 CCTTCCTCCTGCCCTGCCCACTA 0: 1
1: 1
2: 4
3: 109
4: 975
Right 1150500473 17:65646099-65646121 TGTGATGGTTTCTCTCTAGTAGG 0: 1
1: 0
2: 0
3: 11
4: 171
1150500465_1150500470 -9 Left 1150500465 17:65646070-65646092 CCTTCCTCCTGCCCTGCCCACTA 0: 1
1: 1
2: 4
3: 109
4: 975
Right 1150500470 17:65646084-65646106 TGCCCACTATTCACATGTGATGG 0: 1
1: 0
2: 0
3: 6
4: 87
1150500465_1150500475 14 Left 1150500465 17:65646070-65646092 CCTTCCTCCTGCCCTGCCCACTA 0: 1
1: 1
2: 4
3: 109
4: 975
Right 1150500475 17:65646107-65646129 TTTCTCTCTAGTAGGAGGCTAGG 0: 1
1: 0
2: 1
3: 13
4: 136
1150500465_1150500474 9 Left 1150500465 17:65646070-65646092 CCTTCCTCCTGCCCTGCCCACTA 0: 1
1: 1
2: 4
3: 109
4: 975
Right 1150500474 17:65646102-65646124 GATGGTTTCTCTCTAGTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150500465 Original CRISPR TAGTGGGCAGGGCAGGAGGA AGG (reversed) Intronic
900009894 1:96428-96450 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900026006 1:273012-273034 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900035790 1:406869-406891 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900057412 1:642619-642641 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900154589 1:1198862-1198884 TGCGGAGCAGGGCAGGAGGAGGG - Intergenic
900345804 1:2209779-2209801 GTGTGAGCAGGGCAGGAGGGAGG - Intronic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900433009 1:2611766-2611788 GAGTGGGCTGGGCAGAAGGCAGG - Intronic
900518392 1:3094121-3094143 GAGTGTGCAGGGCAAGAGGCGGG + Intronic
900874380 1:5331145-5331167 TGGTGGGCATGGCAGGGTGAGGG + Intergenic
900891965 1:5456069-5456091 GAAGGGGCAGAGCAGGAGGATGG - Intergenic
900955235 1:5882727-5882749 TGGCGGGCAGGACAGGAGGGAGG - Intronic
901076350 1:6557241-6557263 GATTGGGTAGAGCAGGAGGAGGG + Intronic
901167281 1:7229584-7229606 AGGAGGGGAGGGCAGGAGGAGGG + Intronic
901194578 1:7433224-7433246 AAGGAGGCAGGGCAGAAGGAAGG + Intronic
901483195 1:9539899-9539921 TGGTGGGCAGGGCCGAGGGAGGG + Intronic
901646741 1:10720914-10720936 TGGTAGGCAGGGCATGAGGTCGG - Intronic
902359598 1:15935195-15935217 TGCTGGGCAGAGCAGGAGGGTGG - Exonic
902418128 1:16254826-16254848 AAGTGGACAGGACAGGAGGTAGG + Intronic
902490289 1:16776351-16776373 TAGTGGGCAGGGGCGGGGGCAGG - Intronic
902589051 1:17460470-17460492 CACTGAGCTGGGCAGGAGGAAGG - Intergenic
902986984 1:20160900-20160922 TAAAGGGGAGGGCAAGAGGATGG + Intergenic
903213411 1:21830764-21830786 TGGTCAGCAGGGCTGGAGGAGGG + Intronic
903372051 1:22842664-22842686 AACAGGGCAGAGCAGGAGGAAGG - Intronic
903664630 1:24998788-24998810 TAGAGGGCTGGGCAGGGGGAAGG - Intergenic
904322611 1:29707311-29707333 GAGTGGGGAGGGAAGGAGGGAGG + Intergenic
904491126 1:30859789-30859811 TGGTGGTGAGGGCAGGAGGGTGG - Intergenic
904594848 1:31637140-31637162 TTGTGGGGAGGGCAGGAAGCAGG + Intronic
904600773 1:31671504-31671526 GGCTGGGCAAGGCAGGAGGAGGG - Intronic
904622145 1:31782097-31782119 TGGGGGGCAGGGCAGGAGGGAGG - Intergenic
904645934 1:31966321-31966343 AAGAGGGCATGGCAGTAGGAAGG + Intergenic
904899282 1:33843798-33843820 TAGTAGCCAGGGCGTGAGGAGGG - Intronic
905055032 1:35085949-35085971 TATTTGTCACGGCAGGAGGATGG - Intronic
905294775 1:36947290-36947312 ATGGGGGCAGGGCAAGAGGAGGG - Intronic
905403966 1:37720971-37720993 CCCTGGGCTGGGCAGGAGGATGG - Intronic
905404083 1:37721621-37721643 CCGTGGGCTGGGCAGCAGGAAGG + Intronic
905508294 1:38498142-38498164 TGGGGGGCAGGGCACGTGGAGGG - Intergenic
905835178 1:41113164-41113186 TAGTATGCAGGGGAGGAGCAAGG - Intronic
905876011 1:41432516-41432538 TACAGGGCAGGCCAGGAGGAGGG + Intergenic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
906523105 1:46478861-46478883 AGGTGGGCAGGGCAAGAGGGTGG - Intergenic
907235990 1:53048212-53048234 TTGTGGTCAGGGGAGGATGAAGG + Intronic
907755978 1:57311210-57311232 TAGTGGGCTAGGCAGGATGATGG + Intronic
907793220 1:57688914-57688936 GAGTGGGGAGGAAAGGAGGAAGG + Intronic
908021666 1:59904678-59904700 TTGTGGGGAGGGGAGCAGGAAGG - Intronic
908224682 1:62044276-62044298 TAGTGGGAGGGGCTGGTGGATGG - Intronic
908255251 1:62297993-62298015 CTCTAGGCAGGGCAGGAGGAGGG + Intronic
908262473 1:62349567-62349589 AAGTGGGGAGGGGAGGGGGAAGG + Intergenic
908429476 1:64041921-64041943 TACTGGGGAGTGCAAGAGGAAGG + Intronic
908525641 1:64985100-64985122 TAGTGGAAAGGGCAGTAAGAAGG - Intergenic
909099879 1:71336972-71336994 TAGATGTCAGGGCAGGAGGGTGG + Intergenic
909173136 1:72319831-72319853 TATTGGACAGGGCAGGAGAGAGG + Intergenic
909174519 1:72339171-72339193 CACTGGGGAGGGCAGGAGGATGG + Intergenic
909193695 1:72588400-72588422 AAGTGAGGAAGGCAGGAGGAAGG + Intergenic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
909950544 1:81714464-81714486 TATGGGGCAGGGCAGGGAGAAGG + Intronic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911202005 1:95054360-95054382 ACATGGGCAGAGCAGGAGGAAGG - Intronic
911340866 1:96634675-96634697 CAGTTGGCAGGGGAGGAGGGAGG - Intergenic
911398097 1:97337449-97337471 TGGTGGTCAGGGCAGAAGGATGG - Intronic
912935874 1:114003241-114003263 TCTGGGGCAGGGAAGGAGGAGGG + Intergenic
913169838 1:116222019-116222041 AAGTGAGGAGGGAAGGAGGAGGG + Intergenic
913533196 1:119747720-119747742 GTGGGGGCAGGGGAGGAGGAGGG - Intergenic
914320799 1:146557598-146557620 TGGGGGAGAGGGCAGGAGGAGGG + Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915638324 1:157201988-157202010 TAGGGGGCAGGGCAGGGAGCTGG + Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916591587 1:166196036-166196058 TCTTGGGCAGGGCAGGAATAAGG - Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917333174 1:173903250-173903272 AAGGGGGGAGGGCAGGAGGGTGG + Exonic
917679569 1:177352212-177352234 TACTGGGGAGGGCAGGAGGCAGG + Intergenic
918150751 1:181796465-181796487 TAGGAGGCAGGGCATGAGGGTGG - Intronic
918346297 1:183610188-183610210 TGGAGGGGAGGGCAGGAGCAGGG + Intergenic
918720147 1:187842101-187842123 TAGAGGGGAGGGAAGGAGGAGGG - Intergenic
918786066 1:188765535-188765557 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
918816285 1:189189805-189189827 TACTGGACATGGAAGGAGGAAGG - Intergenic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
919995525 1:202745174-202745196 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
920265115 1:204715803-204715825 TAGCAGGCAGAGCAGGAGGCAGG + Intergenic
920415516 1:205796879-205796901 CAGAGGGCAGGGCTGGGGGAAGG - Intronic
921132029 1:212228018-212228040 TAGTGCTCAGGTAAGGAGGATGG - Intergenic
921281186 1:213569728-213569750 TTGTGGTCAGGGCAGAAGCATGG + Intergenic
921298821 1:213729915-213729937 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
921326481 1:213989581-213989603 TAGTGAGGAGGGCGGGAAGAGGG + Intronic
922258324 1:223912435-223912457 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
922473240 1:225889201-225889223 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
922720762 1:227899200-227899222 GAGTGGCCAGAGCAGGGGGAGGG + Intergenic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
922856378 1:228778533-228778555 TAGAGACCAGGGCAGGGGGAGGG - Intergenic
922920816 1:229301312-229301334 GAGAGGGCAGGGAAGAAGGAGGG + Intronic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923036550 1:230288563-230288585 AGGTGGGCAGGTCATGAGGATGG + Intergenic
923041884 1:230325517-230325539 TAATGAGCAGAGGAGGAGGAGGG + Intronic
923530151 1:234806179-234806201 TAGTGGGCAGGGGCGGGGGCAGG + Intergenic
923712765 1:236400262-236400284 AAGAGGGCAGGGGAGGATGAGGG - Intronic
924136104 1:240968471-240968493 TAGTGAGCACGGCAGGAAGCAGG + Intronic
924339520 1:243015199-243015221 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
924383973 1:243486462-243486484 TACTGGGGTGGGAAGGAGGAAGG - Intronic
924388844 1:243528465-243528487 GAGGGTGGAGGGCAGGAGGAAGG - Intronic
1063111010 10:3037441-3037463 TGGGGTGCAGGGCAGGTGGATGG + Intergenic
1063311221 10:4954131-4954153 TTATTGGCAGGGCAGGGGGAGGG + Intronic
1063316570 10:5012288-5012310 TTATTGGCAGGGCAGGGGGAGGG - Intronic
1063572633 10:7230234-7230256 TAGAGAGAAGGGCAGGAGAAAGG - Intronic
1063920657 10:10928996-10929018 AATTGGGAAGGGAAGGAGGAAGG + Intergenic
1064000018 10:11655714-11655736 TAGTGGACAGGGAAGGAAGCTGG - Intergenic
1064152425 10:12876019-12876041 GGGAGGGCAAGGCAGGAGGATGG - Intergenic
1064167848 10:13001771-13001793 CAGGGGGCAGGGCGGGAGGCGGG - Intronic
1065007267 10:21391473-21391495 TAATGGGCATGGTGGGAGGAGGG + Intergenic
1065862681 10:29885097-29885119 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1066426589 10:35312854-35312876 TAGGAGGCAAGGCAGGAGGACGG - Intronic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1067786623 10:49254989-49255011 TAGGGGGCGGTGCAGGTGGAGGG - Intergenic
1068322346 10:55435583-55435605 TACTTTGCAGAGCAGGAGGATGG - Intronic
1069077044 10:64049149-64049171 TAGTGGGGAGAGGAAGAGGAAGG + Intergenic
1069783319 10:70970455-70970477 GAGTGGGCAGGGGTTGAGGAAGG + Intergenic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070337667 10:75469638-75469660 TGGTGGGCAGTGGAAGAGGATGG + Intronic
1070565408 10:77600337-77600359 TAGTGGGGAGAGCAGGAGGTGGG + Intronic
1070719022 10:78743650-78743672 TACTGGGGAGTGCAGGAGGTGGG - Intergenic
1070815087 10:79317921-79317943 AAGTGGGCAGGGGAGCAGGGAGG + Intergenic
1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG + Intergenic
1071383290 10:85093383-85093405 TGGTGGGGAGGGGAGGAGTAAGG - Intergenic
1071482891 10:86078476-86078498 GAGGAGGCAGGGCAGGGGGATGG - Intronic
1071503519 10:86219550-86219572 TAGTGTGCAGAGCAGGGAGAAGG - Intronic
1071524573 10:86350942-86350964 GACTGGGGAGGGCAGGGGGAGGG - Intronic
1072327176 10:94310268-94310290 TAGTGGTGAGGGCAGGAGAAGGG - Intronic
1072862958 10:99025699-99025721 GAGTGGGGAGGGTAGGAAGAGGG + Intronic
1073426657 10:103459216-103459238 CAGTGGGAAGGGCAAAAGGAGGG - Intergenic
1073473823 10:103740057-103740079 TAGTGGGCAGAGGAGGAAGGAGG + Intronic
1073474483 10:103743978-103744000 TAATGGGCAGGGGAGAAGAACGG + Intronic
1073990722 10:109259561-109259583 GATTGAGCAGGGGAGGAGGAAGG - Intergenic
1074384592 10:113006891-113006913 AAGTGGGAAGGGCAGGAGGCTGG - Intronic
1074997710 10:118772154-118772176 AAGTTGGCAGAGCAGGAAGATGG + Intergenic
1075070850 10:119319123-119319145 GGGAAGGCAGGGCAGGAGGAAGG - Intronic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1076057708 10:127389177-127389199 AGGTGGCCAGTGCAGGAGGAAGG + Intronic
1076157680 10:128216080-128216102 GGGTGGCCAGGGCAGGTGGAGGG + Intergenic
1076698329 10:132257628-132257650 GAGAGGGCAGGGCAGGGGGCCGG - Intronic
1076721399 10:132394982-132395004 AGGTGGGCAGGGCAGAGGGAAGG + Intergenic
1076812923 10:132898565-132898587 CAGAGGGCAGGGCAGGGGGCGGG - Intronic
1076985521 11:233280-233302 CAGTGGGGAGGGCAGGAGTCAGG + Intronic
1077031592 11:470486-470508 TTGGGGGCGGGGCAGGGGGAAGG + Intronic
1077065608 11:639848-639870 GAGCGGGCAGGGTAGGAAGAAGG - Exonic
1077159855 11:1107766-1107788 TGGTGGGCAGGGCAGGGAGGAGG + Intergenic
1077166322 11:1141046-1141068 AAGTGGGCACAGCAGGAGGCTGG + Intergenic
1077225142 11:1436315-1436337 AGGTGGGCAGGGCTGGAGGGAGG - Intronic
1077288696 11:1778985-1779007 TCATGGGCAGGGCGGGAGCATGG + Intergenic
1077299283 11:1839742-1839764 GGGTGGACAGGGCAGGAGGTGGG - Intronic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077367637 11:2167523-2167545 GAGTGAGAAGGGCAGGAGGGAGG + Intronic
1077796977 11:5502517-5502539 TAGTGCATATGGCAGGAGGAGGG - Intronic
1077798647 11:5516729-5516751 TGGTGGGTGGGGTAGGAGGAGGG - Intronic
1077838219 11:5944050-5944072 TAGTGCCCAGGGCATGAAGAAGG + Intergenic
1077921272 11:6643536-6643558 GAGTGGGCAGGGAAGCATGATGG - Intronic
1077988161 11:7376364-7376386 GAGAGGGGAGGGGAGGAGGAAGG - Intronic
1078147269 11:8730461-8730483 CAGGGGGCATGGCAGCAGGAAGG - Exonic
1078171569 11:8932696-8932718 TAGGTGGCCGGGGAGGAGGAAGG - Intronic
1078406841 11:11077574-11077596 TATGGGGCAGGGCAAGAGGTGGG - Intergenic
1078470379 11:11581525-11581547 GAGGGGGCAGGGGAGGAGGAGGG - Intronic
1079238048 11:18703436-18703458 AAGTGGGGAGGGGAGGAGGTGGG - Exonic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080425893 11:32154018-32154040 TAGTGTACAGGGCAGGAAGAAGG + Intergenic
1080438960 11:32272795-32272817 TAGTGGGAGGGTCAGGAGGGAGG + Intergenic
1080744976 11:35100732-35100754 TAGCGGGCTGGGCAGCAAGAGGG - Intergenic
1081054659 11:38394511-38394533 TAGTGGGGAGTGAAGGAGTAGGG - Intergenic
1081089667 11:38847633-38847655 AAGGTGGGAGGGCAGGAGGAGGG - Intergenic
1081632020 11:44695699-44695721 TAGAGGGCAGGGCAGCAGGCTGG + Intergenic
1081683002 11:45021963-45021985 CAGGGGGCAGGGCAGGAGGGAGG + Intergenic
1081704684 11:45174794-45174816 TAGTGGTTAGTTCAGGAGGAGGG - Intronic
1081775031 11:45670888-45670910 TTGTGGGCAGGGGCAGAGGAGGG - Intergenic
1081991781 11:47341966-47341988 GAGTGTGCAGGGCAGGTGGATGG - Intronic
1083282316 11:61634722-61634744 TGGTGGCTAGGGCAGGATGAGGG + Intergenic
1083429900 11:62608923-62608945 TGGTGGGCTTGGCAGGAAGAGGG - Intronic
1083561557 11:63677162-63677184 GAGAGGCCAAGGCAGGAGGATGG - Intergenic
1083591774 11:63899698-63899720 GAATAGGCTGGGCAGGAGGAAGG - Intronic
1083678991 11:64342718-64342740 GAGGGGGCGGGCCAGGAGGAGGG + Intronic
1084001197 11:66296184-66296206 GAGAGGGCAGGCAAGGAGGAGGG - Exonic
1084125561 11:67096755-67096777 GAGTTGGGAGGGCAGGAGGCAGG - Intergenic
1084266378 11:68007514-68007536 GTGTGGGCAGGGCATGAGCATGG - Intergenic
1084392990 11:68890798-68890820 GGCTGGGCAGGACAGGAGGAGGG - Intergenic
1084716479 11:70877493-70877515 TGGTGGGGAGGGCAGGAGCCGGG - Intronic
1084945583 11:72636699-72636721 GAGTGGCCAGGGCTGGTGGAGGG - Intronic
1085188560 11:74597698-74597720 TGGAGGACAAGGCAGGAGGATGG - Intronic
1085244523 11:75089222-75089244 TGCTGGGATGGGCAGGAGGAGGG + Exonic
1085542800 11:77288278-77288300 CAGTGTGCAGGGCAGGTGGGTGG - Intronic
1085571099 11:77558683-77558705 CAGTGGGCAGAGCAGGGTGAAGG - Intronic
1085864567 11:80274404-80274426 TAGAGTGGAGGGCAGGAGGAGGG - Intergenic
1086530331 11:87777489-87777511 ACGTGGCCAGAGCAGGAGGAAGG - Intergenic
1086890496 11:92252918-92252940 TAGAGGGCAGGAGGGGAGGATGG - Intergenic
1086991606 11:93309824-93309846 AAGGGGGGAGGGTAGGAGGAGGG + Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087914755 11:103797211-103797233 TATTGGGCAGGGGAGGAGTTGGG + Intergenic
1089315307 11:117587390-117587412 TGATGGGGAGGGTAGGAGGAGGG - Intronic
1089349713 11:117815494-117815516 TGGTGAGCAGGGCAGCAGGGAGG - Intronic
1089362268 11:117898894-117898916 GAGTGTGCTGGGCAGGAGAAGGG - Intergenic
1089611672 11:119672776-119672798 GAGTAGGCAGGGCTGGAGGGCGG - Intronic
1089661972 11:119991769-119991791 ACCTGGGCAGGGCAGCAGGAAGG - Intergenic
1089794328 11:120967886-120967908 TCGAGGGAAGGCCAGGAGGAGGG - Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090261944 11:125327604-125327626 GAGTGTGGAGGGCAAGAGGAGGG + Intronic
1090306208 11:125693382-125693404 AAGTGGGTAGGGGAGAAGGAGGG - Intergenic
1090654423 11:128832128-128832150 AAGTAGGCAAGGAAGGAGGAGGG - Intergenic
1090683896 11:129094089-129094111 TAGTGGGGTGGGGAGGAGGTGGG + Intronic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091449457 12:563316-563338 GTGTGGGCAGGGCAGGAGGCTGG - Exonic
1091579103 12:1770159-1770181 TAGCGGCCAAGACAGGAGGATGG - Intronic
1092077114 12:5683145-5683167 TAGGGGGCAGAGCTGGAGGTAGG - Intronic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1092253490 12:6914409-6914431 GAGTGGGGAAGGGAGGAGGATGG - Intronic
1092358890 12:7819554-7819576 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092372010 12:7924482-7924504 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092986612 12:13851922-13851944 GAGTAGGCAGAGGAGGAGGAGGG + Intronic
1093658660 12:21727285-21727307 GAGTGGGCAGGACAGGACCAAGG + Intronic
1094502395 12:31033058-31033080 TGGAAGGCAGGGGAGGAGGAAGG + Intergenic
1095956493 12:47809286-47809308 CAGTGGGCAAAGCAGGAGTAGGG - Intronic
1095991482 12:48037525-48037547 TAGGAGAGAGGGCAGGAGGAGGG + Intergenic
1096261616 12:50096025-50096047 AAGAGGGCAGGGCTGGAGGCAGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096620758 12:52863478-52863500 GGGAGGGCAAGGCAGGAGGATGG + Intergenic
1096803520 12:54126820-54126842 TAGCTGGCAGGGGAGGGGGAGGG + Intergenic
1096834756 12:54342672-54342694 TAGTGGGCAGGAACAGAGGATGG + Intronic
1097185133 12:57192685-57192707 CAGTGGGGAGGGCATGGGGATGG - Intronic
1097195699 12:57241495-57241517 GAGTGGGCAGTGGAGGAGGTTGG + Intergenic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097494679 12:60315806-60315828 TAGTGGACATGTTAGGAGGAAGG + Intergenic
1097520352 12:60661304-60661326 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1097691986 12:62742068-62742090 TAGTGGGCAAGGCAGGGAGGGGG + Intronic
1097844205 12:64350138-64350160 TAGGGGGAAGGGTAGGAGGGAGG + Intronic
1097950390 12:65420619-65420641 GAGGGAGCAGGGCAGGAGGAGGG - Intronic
1097986561 12:65788483-65788505 TAGTTGGCTGGTCAGGAGCAAGG + Intergenic
1098096363 12:66960890-66960912 GAGTAGCCAGGGAAGGAGGAGGG - Intergenic
1098549097 12:71743126-71743148 TTGTGGCCAGGGCAGGGGGAGGG + Intergenic
1098569327 12:71971035-71971057 TAGAGGGTTGGGGAGGAGGAAGG + Intronic
1098850782 12:75593730-75593752 TAGTGGGTGGGGGATGAGGATGG - Intergenic
1099196604 12:79624276-79624298 TAGTTGAGGGGGCAGGAGGAGGG - Intronic
1100487042 12:95039877-95039899 GGGAGGTCAGGGCAGGAGGATGG - Intronic
1100776492 12:97979950-97979972 TGGTAGACAGGGCAGGTGGATGG - Intergenic
1100846999 12:98669890-98669912 AAGAGGGGAGGGCAGGAAGAGGG - Intronic
1100847005 12:98669906-98669928 AAGAGGGGAGGGCAGGAAGAGGG - Intronic
1101363701 12:104051726-104051748 CACTGGGAAGGGCAGGAGGAAGG - Intronic
1101640233 12:106581954-106581976 GGGTGGGGAGGGCAGGGGGAGGG + Intronic
1101720442 12:107346117-107346139 CAGTGTGCAGGGCAGCTGGATGG - Intronic
1101723921 12:107374093-107374115 GAGTGGGCAGGGAAGGGGGCTGG + Intronic
1101801886 12:108029502-108029524 AAGTGGACAGGGAAGGCGGAGGG + Intergenic
1102301056 12:111771740-111771762 GAGTGGGCAGGACAGGATAAGGG + Intronic
1102434564 12:112910882-112910904 CAGTGGAGAGGGCAGGAGGGAGG + Intronic
1102442555 12:112974863-112974885 TTGTGGGCAGGAGAGGAGGTGGG - Intergenic
1103621453 12:122189708-122189730 GAGTGGACAGGGCAGGAGTGGGG - Intronic
1103760841 12:123249399-123249421 GAGGGAGCAGGGCAGGGGGAGGG + Intronic
1104068688 12:125326811-125326833 GAGTGAGCAGGACAAGAGGAAGG - Intronic
1104200207 12:126581481-126581503 TACTGGGCATGGCAGGCGGAAGG + Intergenic
1104270865 12:127281008-127281030 CACTGGGCAGGGCTGGAGGGAGG + Intergenic
1104298038 12:127536392-127536414 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1104619584 12:130301328-130301350 TCGTGGGCGGTGCCGGAGGACGG - Intergenic
1104876656 12:132039555-132039577 TTGGGGGCAGGGCAGGAGACTGG - Intronic
1104921834 12:132294629-132294651 AAGAGGGCAGGGCAGGAGCAAGG + Intronic
1104982213 12:132578447-132578469 GAGTGGGCTGAGGAGGAGGAGGG + Intronic
1105402636 13:20109475-20109497 GAGAGGGCAGGGAAGGAGCATGG - Intergenic
1105575803 13:21650556-21650578 GAGGGGGCTGGGGAGGAGGAGGG - Intergenic
1107172992 13:37365380-37365402 GTGTGGGCAGGGCAGGGGGCGGG + Intergenic
1107806823 13:44161106-44161128 GAGAGGCCAGGGCATGAGGAGGG - Intronic
1108518056 13:51221552-51221574 AAGTTGGCAGGGCGGGCGGAAGG - Intergenic
1109290020 13:60462642-60462664 CAAGGGGCAGGGCAGGAGGTAGG - Intronic
1110334627 13:74313244-74313266 GAGTGTGGAGGGTAGGAGGAGGG - Intergenic
1111861713 13:93715458-93715480 AAGAGGGGAGGGAAGGAGGAAGG + Intronic
1112116211 13:96357759-96357781 AAGAGGCCAAGGCAGGAGGATGG - Intronic
1112809251 13:103198563-103198585 AAGGGAGCAGGGCAGGATGAAGG - Intergenic
1113069525 13:106406931-106406953 TGGTGAGCAGGACAGGAGGGAGG - Intergenic
1113541992 13:111115865-111115887 TTGTGTGCGGGGCAGGGGGAGGG + Intronic
1113796579 13:113061842-113061864 AAGAGGGGAGGGGAGGAGGAGGG - Intronic
1113901878 13:113802217-113802239 GATTGGCCTGGGCAGGAGGAGGG + Intronic
1113988330 13:114337379-114337401 TAGTGGGCAGGGCAGGGTAGTGG - Intergenic
1114535877 14:23422134-23422156 TTATGGGCTGGGGAGGAGGAAGG + Intronic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1115680830 14:35736048-35736070 AGGTGGGCAGGGCAGAAGCAGGG + Intronic
1115754780 14:36519859-36519881 GAGCGGGGAGGGCAGGAGGTGGG + Intronic
1116710296 14:48359808-48359830 CAGGGGGCAGGTCAGTAGGAAGG + Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117339948 14:54784223-54784245 TATGGGCCAGGGCAGGAGGTTGG + Intronic
1117478552 14:56119683-56119705 TAGTGGGCAGTGAAAGGGGAGGG + Intronic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118025215 14:61761804-61761826 TGCGTGGCAGGGCAGGAGGAGGG + Intergenic
1118317892 14:64736920-64736942 CAGTGAGCGGGGGAGGAGGAGGG + Intronic
1118360690 14:65054078-65054100 TGCTGGGCAGGGCTGGAGGATGG + Intronic
1118653498 14:67923016-67923038 TAAGGGGAAGGGCAGGAGGCAGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118903448 14:70005462-70005484 GAGTGGGCAGGGCAGGAGACAGG - Intronic
1118904461 14:70013570-70013592 GAGTGGGCAGGGTTTGAGGAGGG + Intronic
1119086754 14:71746237-71746259 GGGAGGCCAGGGCAGGAGGATGG - Intergenic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119519662 14:75276987-75277009 GAGCGGGGAGGGCAGGAGGCGGG - Intergenic
1119759780 14:77142007-77142029 GAGAGGGAAGGGCAGGATGATGG - Intronic
1119805007 14:77476808-77476830 TAGAGGCCAAGGCAGGAGGTAGG + Intronic
1119842057 14:77800480-77800502 GAGTGGGCAGAGCTGGAGGAGGG + Intronic
1119945552 14:78689914-78689936 TAGTGGGGAGGAGCGGAGGAGGG - Intronic
1121020964 14:90579932-90579954 TCATGGCCAGGGCAGGAGGCAGG - Intronic
1121050602 14:90816740-90816762 TAGGGGTCTGGGCAGGATGAAGG + Intergenic
1121301383 14:92874174-92874196 TAGAGGTTTGGGCAGGAGGAAGG + Intergenic
1121405991 14:93719716-93719738 TACTGGCCAGGTCAGGAGCAGGG + Exonic
1121413343 14:93762638-93762660 TGGGGGTCAGGGCAGGAGCAGGG - Intronic
1121565116 14:94903596-94903618 CACTGGGCAGTGCAGGAAGAGGG + Intergenic
1121620172 14:95341078-95341100 TGTAAGGCAGGGCAGGAGGATGG + Intergenic
1121818336 14:96945085-96945107 TGGTGGGCTGGGCAAGGGGAAGG - Intergenic
1121850871 14:97220000-97220022 TAGTGGGAAGGGCAGGATCCTGG - Intergenic
1122044990 14:99016971-99016993 TTGTGGGGAGGGCAGGGGGTGGG - Intergenic
1122254297 14:100465365-100465387 TGGTGGCCAGGGCTGGGGGAGGG - Intronic
1122428537 14:101625517-101625539 TAGGGAGCAGGGCAGGAGAAAGG + Intergenic
1122542532 14:102506186-102506208 CAGAGGGCAGGCCTGGAGGAAGG + Exonic
1122651492 14:103229363-103229385 TAGGGTGTGGGGCAGGAGGAAGG - Intergenic
1122654889 14:103251501-103251523 TAGTTTGGTGGGCAGGAGGATGG - Intergenic
1122898332 14:104771538-104771560 TGGAGGGCAGGGCAGGAGGGTGG + Intronic
1122960491 14:105091780-105091802 CAGTGGGCGGGGGTGGAGGACGG + Intergenic
1123436622 15:20259255-20259277 TAGAGGCCAAGGCAGGTGGATGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124078432 15:26468881-26468903 GAGTGTGGAGGGCAGGAGGGGGG + Intergenic
1124447855 15:29754368-29754390 GAGGGGGGAGGGTAGGAGGAGGG + Intronic
1124855271 15:33381557-33381579 GAGTGGTCAGGGCAGGAAGAAGG - Intronic
1124954402 15:34350639-34350661 TAGGTGTCAGGGCAGGTGGATGG + Intronic
1125093706 15:35826678-35826700 AAGTGGGGAGGGCAAGAGGGTGG + Intergenic
1125386541 15:39142717-39142739 TGGCTGGCAGAGCAGGAGGAAGG - Intergenic
1125502167 15:40246562-40246584 GGGTGGTCAGGACAGGAGGAGGG + Intronic
1125535294 15:40438811-40438833 TAATGGGCAGGGATGGAGGCCGG - Intergenic
1125586487 15:40824239-40824261 TAGTGGAGAGGTCAGGAGTAAGG - Intronic
1125728942 15:41882245-41882267 TAGTGGGGAGGGGTGGAGGCGGG - Intronic
1126120892 15:45250638-45250660 GAGAGGCCAAGGCAGGAGGATGG + Intergenic
1127047522 15:55043016-55043038 TGGTGGGTGGGGCAGGAGGGTGG + Intergenic
1127585020 15:60370280-60370302 TCTTGGGCAGGGCGGTAGGAGGG - Intronic
1127830631 15:62747940-62747962 GAGTAGGCAGCGGAGGAGGAGGG + Intronic
1127889009 15:63230975-63230997 TAGTAGAGAGGGGAGGAGGAAGG - Intronic
1128147164 15:65338067-65338089 TAGTGCTGAGGGGAGGAGGAGGG - Intronic
1128756123 15:70185213-70185235 TGGTGGGAAGGAGAGGAGGAGGG + Intergenic
1129146707 15:73654522-73654544 GGGAGGGCAGGGCAGGTGGACGG + Intergenic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129364701 15:75047177-75047199 CTGTGTGCAGGGCAGGAGCAAGG - Intronic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130791991 15:87165166-87165188 TAGGGGCTAGGGCAGGAGGTGGG - Intergenic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1131059504 15:89395922-89395944 GAGGGGGCTAGGCAGGAGGAGGG - Intergenic
1131313157 15:91309086-91309108 TAGTTGGCAGGGGCGGAGGAGGG - Intergenic
1131370170 15:91874419-91874441 TGGTGGCCAGGGCTGGGGGAAGG - Intronic
1131429872 15:92378216-92378238 TAATGGGCAGGAGAGGAGGCAGG - Intergenic
1131443766 15:92478345-92478367 TTGTGGTCTGGACAGGAGGAGGG + Intronic
1132313954 15:100877676-100877698 CAGAGAGCAGGTCAGGAGGATGG - Intergenic
1132623354 16:878722-878744 GGGTGGGCAGGGCAGGGGAAGGG + Intronic
1132720465 16:1313159-1313181 TGCAGGGCAGGGCAGGAGCATGG - Intronic
1132829008 16:1918491-1918513 GAGTGGGCGGGGGAGGGGGAGGG - Intergenic
1133050619 16:3115472-3115494 GAGGGGGCATCGCAGGAGGATGG + Exonic
1133149667 16:3818179-3818201 TGGGGGGCCGGGGAGGAGGACGG + Intronic
1133174534 16:4004015-4004037 AAGAGGCCAAGGCAGGAGGATGG + Intronic
1133304283 16:4800102-4800124 GAGGGGGCAGGGGAGGAGGCTGG + Intronic
1133428633 16:5716013-5716035 AAGTGGGCAAGGCAGGAATAAGG + Intergenic
1133625117 16:7563883-7563905 CAGTGGGCAGGGTTGGAGGTTGG - Intronic
1133736524 16:8620119-8620141 TGGTGGGGAGGGCACTAGGAAGG - Intergenic
1133739498 16:8640691-8640713 TAGATGGAAGGGCAGGAAGATGG + Intronic
1133958939 16:10474940-10474962 GGGAGGTCAGGGCAGGAGGATGG + Intronic
1133993371 16:10728059-10728081 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
1134818661 16:17227805-17227827 TAAAGGGCAGAGCAGGAGGCTGG + Intronic
1135110924 16:19690314-19690336 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
1135166105 16:20140556-20140578 CAGTGGGTGGGGCAGAAGGAAGG - Intergenic
1135186836 16:20322812-20322834 GAGGGGGCAGGGCAGGAGGGAGG - Intronic
1135420769 16:22304255-22304277 CAGTGGGAAGGGCAGGGGCAAGG + Intronic
1136008144 16:27345086-27345108 GGGTGGGCAGGGGAGGAGGTGGG + Intronic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136374876 16:29859411-29859433 TGAGGGGCTGGGCAGGAGGATGG - Intronic
1136500051 16:30665498-30665520 AGCAGGGCAGGGCAGGAGGATGG - Intronic
1136602499 16:31303264-31303286 GAGAGGCCAAGGCAGGAGGATGG - Intronic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1138388343 16:56651892-56651914 GAGAAGTCAGGGCAGGAGGAAGG - Exonic
1138475060 16:57265729-57265751 TAAAGGACAGGGCAGGAGGCCGG + Intronic
1138537006 16:57665769-57665791 GAGTGGCCAGGGGAGGAGGGAGG - Intergenic
1138930688 16:61652352-61652374 TATTGGGCAGGGCATGATGTAGG + Exonic
1139345533 16:66300664-66300686 AAGTGGGGAGGCCAGGATGAAGG - Intergenic
1139353003 16:66349265-66349287 TAGTGGGGAGAGTTGGAGGAGGG + Intergenic
1139478545 16:67215646-67215668 AGTTGGGCAGGGCTGGAGGAAGG - Intronic
1139549290 16:67664589-67664611 CAGTGGGAAGGGCAGGGGTATGG - Intronic
1139590545 16:67930673-67930695 AAGTGGGCAGTGCAGGTGGGTGG - Intronic
1140012734 16:71152507-71152529 TGGGGGAGAGGGCAGGAGGAGGG - Intronic
1140264670 16:73409975-73409997 TAGTGGGTGGGGCAGGGGGGTGG + Intergenic
1140344140 16:74195817-74195839 TATTGGGAAGGGTAGGAAGATGG - Intergenic
1140980116 16:80100431-80100453 AAGTGGGAGGGGCAGGAGTAGGG + Intergenic
1141173328 16:81704440-81704462 AAGTGGGTAGGGGAGGGGGAGGG - Intronic
1141724392 16:85777559-85777581 TAGGAGGCTGAGCAGGAGGATGG - Intronic
1141944083 16:87297814-87297836 AAGGGAGCAGGGGAGGAGGAAGG + Intronic
1142104346 16:88294292-88294314 AAGTGCACAGGGCAGGAGGTAGG - Intergenic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142172255 16:88628872-88628894 TAGGGGGCAGGGCAGAGGGACGG + Intronic
1142180689 16:88668192-88668214 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180712 16:88668268-88668290 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180735 16:88668344-88668366 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180747 16:88668382-88668404 GAGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142243495 16:88957827-88957849 TGGTGGGCAGGGCAGAGGGAGGG + Intronic
1142325290 16:89411015-89411037 GGGTGGCCAGGGCAGGAGGCAGG + Intronic
1142454436 16:90210476-90210498 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142666679 17:1467579-1467601 TGGGGGGCCAGGCAGGAGGAGGG + Intronic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142969298 17:3600757-3600779 GAGTGGCCAGGGCAGGAGGAGGG - Intergenic
1143090877 17:4448549-4448571 TTATGGGCAGGGCAGAGGGAAGG - Intronic
1143197564 17:5087792-5087814 GAAAGGGCAGGGCAGGAGAAAGG - Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143619836 17:8074462-8074484 TGGTGGTGAGGGGAGGAGGAGGG - Intronic
1143778801 17:9218626-9218648 TGGGGGGCGGGGCAGGAGGAAGG - Intronic
1143923564 17:10349994-10350016 TAGAGCACAGGGCAGCAGGAAGG - Intronic
1143983316 17:10889737-10889759 TAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1144018614 17:11220687-11220709 GAGAGGGCAGGGCAGGAGGGAGG - Intergenic
1144125050 17:12195711-12195733 CTGGTGGCAGGGCAGGAGGAAGG - Intergenic
1144134675 17:12281937-12281959 AAGAGGGCAGAGCAGGTGGAAGG - Intergenic
1144221191 17:13101357-13101379 ACATGGCCAGGGCAGGAGGAAGG - Intergenic
1144472476 17:15557073-15557095 TGGTGAGCAGGGCATGGGGAAGG - Intronic
1144659452 17:17058622-17058644 TGGTGAGGAGGCCAGGAGGAGGG - Intronic
1144924001 17:18787615-18787637 TGGTGAGCAGGGCATGAGGAAGG + Intronic
1145961126 17:28887037-28887059 TAGTGGGGAGGGAAGAAGGGAGG + Intronic
1145993306 17:29091943-29091965 CAGTGGGCTGGGCAGGGGGAAGG + Intronic
1146266706 17:31457721-31457743 CAGAGGGTAGGGCAGCAGGAGGG - Intronic
1146441157 17:32896368-32896390 AAGTTGGGTGGGCAGGAGGAAGG - Intergenic
1146477527 17:33174961-33174983 TAGGGGGCAGGGAGAGAGGAGGG - Intronic
1146547092 17:33749079-33749101 TCCTGGGCAGGGGAGCAGGAAGG + Intronic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147419096 17:40313220-40313242 TCCTGGGCAGGGCAGGAGGAGGG - Intronic
1147586931 17:41658202-41658224 TCCTAGGCAGGGCAGCAGGAGGG + Intergenic
1147659108 17:42107834-42107856 TATGGGGCAGGGCAGGGGGCGGG - Intronic
1147834065 17:43317568-43317590 TAGTGGGCAGCACAGGTGCAAGG - Intergenic
1148051798 17:44773198-44773220 TTGGGGCCAGGGCTGGAGGAGGG - Intronic
1148768190 17:50051574-50051596 AAGTGGGCTGAGCAGGAGCAGGG - Intergenic
1148831055 17:50431731-50431753 TTGAGGCCAAGGCAGGAGGATGG - Intronic
1148906428 17:50915246-50915268 GGCTGGGCATGGCAGGAGGAGGG + Intergenic
1149578030 17:57727688-57727710 AGGAGGGAAGGGCAGGAGGAGGG + Intergenic
1149994497 17:61399624-61399646 TGGGGGCCGGGGCAGGAGGAGGG + Intergenic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151150955 17:72086462-72086484 TGGTGGGGATGGGAGGAGGAAGG - Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151418664 17:73983505-73983527 TTGTGGGCAGGGCTGGGCGAGGG - Intergenic
1151443408 17:74148196-74148218 AGGTGGGGAGGGCAGGAGCAGGG - Intergenic
1151454560 17:74218220-74218242 AGGTGGGCAAGGGAGGAGGAAGG - Intronic
1151476356 17:74346233-74346255 CAGTGGCCTTGGCAGGAGGACGG + Intronic
1151767276 17:76139006-76139028 GAATGGACAAGGCAGGAGGATGG - Intronic
1151785206 17:76271988-76272010 CAGAGGGCGAGGCAGGAGGACGG - Intergenic
1151821206 17:76497909-76497931 AAGTGGGCAGTGCAGGAGGTGGG - Intronic
1152191697 17:78892072-78892094 TGTTGGGCTGGGGAGGAGGACGG - Exonic
1152289240 17:79429457-79429479 CAGCAGGCTGGGCAGGAGGAGGG + Intronic
1152337593 17:79707237-79707259 ACGTGGGCAGGGGAGGAAGAAGG - Intergenic
1152573510 17:81130570-81130592 CATTGTGCATGGCAGGAGGAGGG - Intronic
1152719918 17:81918406-81918428 TACTGCGCAGGGCAGGGGTAGGG + Exonic
1153000428 18:450455-450477 TAATGGCCAGAGCAGGAGGAAGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1153399908 18:4672523-4672545 GAGTGTGGAGGGTAGGAGGAAGG + Intergenic
1153950982 18:10057487-10057509 TAGGGGACAGGGAAGGAGAATGG + Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1154066724 18:11113505-11113527 GGGTGGGCAGAGCAGGAAGAAGG - Intronic
1155709715 18:28861158-28861180 TAGTGTCCAAGGCAGGAAGAAGG - Intergenic
1156260102 18:35438606-35438628 GGCTGGGCAGGGCAGGATGAAGG - Intergenic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1157383671 18:47245405-47245427 TAGTGGGTAGGTGAGGAGGCTGG + Intronic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1158329882 18:56350109-56350131 TGGAAGCCAGGGCAGGAGGATGG - Intergenic
1158500363 18:57995489-57995511 TAGTGGGAAGGGCAGGTGCATGG + Intergenic
1158610073 18:58931695-58931717 GAGAGGCCAAGGCAGGAGGATGG + Intronic
1159031215 18:63234236-63234258 TATTGGAGGGGGCAGGAGGAGGG - Intronic
1159122147 18:64183539-64183561 AAGCGAGAAGGGCAGGAGGATGG - Intergenic
1159245371 18:65798651-65798673 TTGTGGGGAGGTCAGGAGTAGGG + Intronic
1159518036 18:69483032-69483054 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
1160021429 18:75184899-75184921 GAGGGGGCAGGAAAGGAGGAAGG + Intergenic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1160413162 18:78688451-78688473 AAGAGGGCAGGAAAGGAGGAAGG - Intergenic
1160590932 18:79944281-79944303 TAGTGTGCAGAGCAGCAGGTGGG + Intronic
1160660103 19:293963-293985 CAGTGGGCAGGGAAGGCTGAGGG + Intergenic
1160705125 19:525947-525969 CAGAGGGGAGGGGAGGAGGAGGG + Intergenic
1160777362 19:862289-862311 TAGGGGGCGGGGCTCGAGGAGGG + Intronic
1160844620 19:1160952-1160974 GGGTGGGCAGGGCCCGAGGACGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161044139 19:2125905-2125927 GAGAGGTCAAGGCAGGAGGATGG + Intronic
1161140197 19:2642731-2642753 GAGAGGCCAAGGCAGGAGGATGG - Intronic
1161321404 19:3643353-3643375 TGGCGTGCAGGGCAGGAGGTCGG + Exonic
1161375551 19:3937653-3937675 GAGTGGGCATTGCAGGAGGGCGG - Intronic
1161375742 19:3938158-3938180 TAGCGGGCATTGCAGGAGGGTGG - Intronic
1161537534 19:4829396-4829418 CAGTGGGCAGGGGAGGCGGGCGG - Intronic
1161704718 19:5814257-5814279 TACAGGGCTGGGCAAGAGGAAGG + Intergenic
1161821598 19:6533693-6533715 GAGGGGGCAGGGAAGGGGGAAGG - Intronic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1163012687 19:14435076-14435098 TGGTGGGCAGCGGAGGAGCAGGG + Intronic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163717277 19:18879697-18879719 GACTGGGCAGGGAAGGAGGTGGG - Intronic
1163717302 19:18879760-18879782 GACTGGGCAGGGAAGGAGGTGGG - Intronic
1163727790 19:18932411-18932433 TAGGGGGCGGGGCCAGAGGAGGG + Intronic
1163812025 19:19439078-19439100 GAGGGAGCAGGGCCGGAGGAGGG + Intronic
1165058907 19:33195284-33195306 TGCGGGGCAGGGCTGGAGGAGGG + Intronic
1165116304 19:33531058-33531080 GAGAGGCCAAGGCAGGAGGATGG - Intergenic
1165303475 19:34988314-34988336 AAAAAGGCAGGGCAGGAGGAGGG - Intergenic
1165407207 19:35638144-35638166 GAGTGGTCAGGGCAGGATGGGGG + Intergenic
1165870788 19:38971542-38971564 GAGAGGCCAAGGCAGGAGGATGG + Intronic
1166361758 19:42255437-42255459 CAGTGGGCAGGAGAGGAGGAGGG - Intergenic
1166375174 19:42323894-42323916 GAGTGCGAAAGGCAGGAGGAGGG - Intronic
1166393017 19:42420605-42420627 TAGTGGGCAGGACTAGGGGATGG - Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166944700 19:46389860-46389882 GAATGGGAGGGGCAGGAGGATGG - Intronic
1166959364 19:46488496-46488518 TAGAGAGGAGGGCAGGATGAAGG - Intronic
1166981457 19:46634457-46634479 GGCGGGGCAGGGCAGGAGGAGGG - Intronic
1167011757 19:46813346-46813368 TGGGGAGCAGGGAAGGAGGAGGG + Intergenic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167455658 19:49595793-49595815 ATGTGGCCAGGCCAGGAGGAGGG - Exonic
1167564181 19:50246029-50246051 AAGGAGGGAGGGCAGGAGGAAGG - Intronic
1168002899 19:53463411-53463433 GAGTGGGCGGGGCAAGAGGGAGG + Intergenic
1168074748 19:53974119-53974141 TAGTTGCCAGGGCTGGAGGGTGG - Intronic
1168402150 19:56091598-56091620 GAGTGGGGAAGGCAGGAGGTGGG + Intronic
1168636101 19:57998768-57998790 GAGGAGGCTGGGCAGGAGGACGG + Intronic
924971883 2:135905-135927 TACATGGCAGAGCAGGAGGAAGG - Intergenic
925060098 2:884442-884464 TAGTGAGCAGAACAGCAGGAGGG + Intergenic
925082097 2:1078491-1078513 AGCTGGGCAGGGCAGGTGGATGG + Intronic
925100341 2:1238868-1238890 TGGTGGGCAGGGCAGGGGCAGGG - Intronic
925361471 2:3283374-3283396 GGGTGGTCAGGGCAGGAGGTGGG - Intronic
926148801 2:10413173-10413195 GGATGGGCAGGGGAGGAGGAAGG - Intronic
926442256 2:12902218-12902240 GAGAGGCCAAGGCAGGAGGATGG - Intergenic
926687987 2:15712929-15712951 CAGTGGGCAGGGGAGAAGGAAGG - Intronic
926694465 2:15761448-15761470 AAGAGGGCATGGCAGGTGGACGG + Intergenic
927172225 2:20379767-20379789 TTGTGGGGTGGGCAGGGGGAGGG - Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927739244 2:25552672-25552694 CAATGGGCAGGGCAGGCGGAAGG - Intronic
927744817 2:25608928-25608950 TAGTGGGGATGGCAGCAGTAGGG + Intronic
927767286 2:25822447-25822469 TTGTGAACAGGGCAGGGGGACGG - Intronic
928283096 2:29965887-29965909 CAGTGAGCAGGGTAGAAGGAGGG + Intergenic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
929032861 2:37664909-37664931 GAGGGGGAAGGGCGGGAGGAGGG + Intronic
929592341 2:43155445-43155467 AGGAGGGCAGGGCAGGAGGCAGG - Intergenic
929969921 2:46565171-46565193 TAGTGGGAGGGGCAGGAGTGGGG + Intronic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930235649 2:48886541-48886563 GAGTGGGGAGGGTAGGAGGAGGG + Intergenic
930570824 2:53084638-53084660 TGGTGGGAAGGGTAGGAGGAAGG + Intergenic
930752377 2:54945891-54945913 CTGTGGGCAGGGCAGGATCATGG - Intronic
930836774 2:55802568-55802590 GAGTGAGCAGGGCAGAAGAAAGG - Intergenic
931090458 2:58880542-58880564 TGGGAGGCAGGGAAGGAGGAAGG + Intergenic
931151202 2:59575419-59575441 TGGTGGTCAGGCTAGGAGGAAGG + Intergenic
931918479 2:66985895-66985917 TATTGGGAAGAGCAGGAGAAAGG + Intergenic
932087256 2:68773500-68773522 AAGTGGGGAAGGCAGGAGGAAGG + Intronic
932136173 2:69230948-69230970 GAGTGGGGAAGGTAGGAGGAGGG - Intronic
932693466 2:73933509-73933531 TGGTAGGCAAGGCGGGAGGAGGG + Intronic
932695198 2:73950543-73950565 GAATGGGGAGGGCAGGAGAATGG - Intronic
932855515 2:75229901-75229923 GAGTGGGCAAGACAGGAGGCAGG + Intergenic
933167901 2:79095493-79095515 AGGTGGGAAGGACAGGAGGAGGG + Intergenic
933432542 2:82202047-82202069 TAGTGAGAAAGGCAGGAGAATGG + Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934780352 2:96965999-96966021 TGGAGGCCAGGGCAGGAGGGAGG - Intronic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
935098363 2:99968799-99968821 TAAAGGGAAAGGCAGGAGGAAGG - Intronic
935847715 2:107184834-107184856 AAGGGAGAAGGGCAGGAGGAAGG + Intergenic
937460959 2:122085561-122085583 TTGGGGGCATGGCAGGGGGAAGG - Intergenic
937723868 2:125135939-125135961 GAGAGGCCAAGGCAGGAGGATGG - Intergenic
937946058 2:127338475-127338497 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
937985949 2:127638181-127638203 CAGTGGGCAGAGGAGGAGGTGGG - Intergenic
938065749 2:128281134-128281156 GAGGGGGCAGGGCAGGGAGATGG - Intronic
938287587 2:130130229-130130251 TAGTGGGCAGGAAAGAAAGACGG + Intergenic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
938395018 2:130939046-130939068 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
938428007 2:131208630-131208652 TAGTGGGCAGGAAAGAAAGACGG - Intronic
938468917 2:131542642-131542664 TAGTGGGCAGGAAAGAAAGACGG - Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939995028 2:148911964-148911986 AAGAGGGAGGGGCAGGAGGAAGG - Intronic
941846020 2:170133910-170133932 TGGTGGGGGGAGCAGGAGGAGGG + Intergenic
942085247 2:172437542-172437564 TTGGGGGCAGGGCAGGAGTATGG + Intronic
942143252 2:172999330-172999352 TAGTGTCCAGGACAGGAGGGAGG - Intronic
942251841 2:174053894-174053916 TAGGGGGCGGGGAAGGAAGAGGG + Intergenic
943322655 2:186464905-186464927 TGTAGGGCAGGGCAGAAGGATGG - Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943403810 2:187454024-187454046 TATTGGGCAAGGCAGGTGGGTGG - Intergenic
943532666 2:189103884-189103906 TAGGAGGAAGGGAAGGAGGAAGG - Intronic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
944059664 2:195559173-195559195 AAGTGGGGAGGGCATCAGGAGGG + Intergenic
944440548 2:199739264-199739286 TAGAGGGTAGGGAAAGAGGAAGG - Intergenic
944803806 2:203261459-203261481 CAGGAGGCAAGGCAGGAGGATGG + Intronic
945213796 2:207412211-207412233 GAGTTAGCAGGTCAGGAGGATGG - Intergenic
946187729 2:217990743-217990765 TGGTGGGCATGGCAGGTGGAGGG - Intronic
946200614 2:218068859-218068881 GAGTGGGGAGGGCAGGGCGAGGG - Intronic
946386048 2:219385223-219385245 TAGTGGGCAGGTCTGGGGTAGGG + Intronic
946424500 2:219585970-219585992 GACTAGGCAGGTCAGGAGGAGGG + Intergenic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946924727 2:224615574-224615596 TGTTGGGCAGGGTAGGTGGAGGG + Intergenic
946999477 2:225437185-225437207 TAGTGGGCTGGACTGGAGCACGG + Intronic
947330518 2:229024924-229024946 GGGTGGACAGGGCAGCAGGAGGG + Exonic
947367314 2:229410019-229410041 TGGTGAGGAGGGCAGGAAGAGGG - Intronic
947470868 2:230400284-230400306 GAGTGCGCATGGCAGGTGGAAGG - Intronic
947567155 2:231201483-231201505 GAGTGGGCAGATGAGGAGGATGG - Intronic
947720749 2:232367995-232368017 CAGAGGGCACCGCAGGAGGAAGG - Intergenic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
948035969 2:234858485-234858507 TGGGGGGCAGGGCAGGACAAGGG - Intergenic
948229214 2:236337352-236337374 GTGTGGGCTGGGCAGGAGGAGGG - Intronic
948465560 2:238150154-238150176 CAGTGGCCTGGGCTGGAGGAAGG - Intronic
948598874 2:239096933-239096955 CAGGGAGCAGGGCAGGAGGCAGG + Intronic
948768091 2:240233634-240233656 TTATGGGCAGGGCTGGAGGCGGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948806801 2:240456573-240456595 TAATGGGCTGGGCAGTGGGAGGG - Intronic
948835733 2:240625164-240625186 AAGTGGGCTGGGGAGGAGGAAGG + Intronic
948990557 2:241551853-241551875 GGGTGGGCAGGGCAGGAAGTGGG - Intergenic
949032348 2:241803056-241803078 CCGTGGGCAGAGCAGGAGGAGGG - Intronic
949085894 2:242155131-242155153 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168909865 20:1439100-1439122 CAGAGGCCAGGCCAGGAGGATGG + Intergenic
1169072705 20:2743020-2743042 TGGTGGGCAGGGGAGTTGGAGGG - Intronic
1169111336 20:3036160-3036182 TAGTGGGCAGGAGAGCAGCAGGG + Intronic
1170429555 20:16263820-16263842 GAGAGCGCAGGGCTGGAGGAGGG + Intergenic
1170673184 20:18454050-18454072 AAGTGGCCAAGGCAGGAGGCAGG + Intronic
1170837251 20:19895022-19895044 TGGTGGGCAAGGCTGGAGGCAGG - Intronic
1170872065 20:20214870-20214892 TAGGGCGCAGGGCAGGCAGAAGG + Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1171242873 20:23585939-23585961 CAGGGGCCAGGGCAGGACGAGGG - Intergenic
1171340198 20:24421336-24421358 CAGTGGGCGGGGCAGGAGCTGGG + Intergenic
1171356413 20:24549217-24549239 GAGTGGGCAGAGTAGGAGGAAGG - Intronic
1171395806 20:24832365-24832387 CACTGGGCAGGACAGGAGAAGGG - Intergenic
1171407099 20:24918802-24918824 AAGTGTGCAGGGCAGGAGTGAGG - Intergenic
1171936919 20:31283527-31283549 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1171976161 20:31596039-31596061 TAGTGGGCAGGGGAGGAGTTTGG + Intergenic
1172072332 20:32267339-32267361 TAGAAGCCAAGGCAGGAGGATGG - Intergenic
1172516054 20:35534365-35534387 TGGTGGGCAGGCCAGTGGGAGGG - Intergenic
1172846133 20:37930903-37930925 AACAGGGCAGGGCAGGAGGTGGG + Intronic
1172973294 20:38888753-38888775 TGGTGGGCAGAGGAGGAGGGAGG + Intronic
1173288989 20:41697877-41697899 TAGTGGGCAAGGGAAGAGGAGGG - Intergenic
1173388249 20:42608447-42608469 TTTGGGGCAGGGCAGGAGGAAGG + Intronic
1173596046 20:44258933-44258955 TAGGGGACAGGGGAGGGGGATGG - Intronic
1173696437 20:45018969-45018991 AGGTGGCCAAGGCAGGAGGATGG - Intronic
1173791940 20:45833768-45833790 GAGCGGGCGGGGCAGGAGGCGGG + Intergenic
1174206835 20:48846550-48846572 GAGTGGGCAGGGCAAGACCAAGG - Intergenic
1174636398 20:52004158-52004180 TATTGAACATGGCAGGAGGAGGG - Intergenic
1174752214 20:53122836-53122858 TGGGGGACAGGGCATGAGGAAGG + Intronic
1174886657 20:54343087-54343109 AAGAAGGCAGGGAAGGAGGAAGG - Intergenic
1175224837 20:57439133-57439155 TGTGGGGCAGGGCAGGAGGCTGG - Intergenic
1175576034 20:60061402-60061424 TAGTGGGTAGGGGAAGAGGAGGG + Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175834473 20:61984858-61984880 ACGGGGACAGGGCAGGAGGAGGG + Intronic
1175901329 20:62361018-62361040 TAGGGGGCTGGGCTGGGGGAGGG - Intronic
1176195832 20:63836039-63836061 GCGTGGGCAGGGCAGGGGCAGGG + Intergenic
1176195899 20:63836224-63836246 GCGTGGGCAGGGCAGGGGCAGGG + Intergenic
1176195909 20:63836251-63836273 GCGTGGGCAGGGCAGGGGCAGGG + Intergenic
1176197921 20:63846212-63846234 GATGGGACAGGGCAGGAGGAAGG - Intergenic
1176254238 20:64142533-64142555 CAGTGGGCTGGGCAGAGGGAGGG + Intergenic
1176343357 21:5718400-5718422 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1176501470 21:7606056-7606078 TAGGGGGAAGGGCATGGGGAAGG + Intergenic
1176537678 21:8116469-8116491 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1177041305 21:16114653-16114675 CAGAGGCCAAGGCAGGAGGATGG + Intergenic
1177477076 21:21637246-21637268 GACTGGGGAGGGTAGGAGGAAGG - Intergenic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1177862515 21:26470925-26470947 TAGTGCGCTGGGCAGGCTGAGGG + Intronic
1178356930 21:31917142-31917164 TGTTTGGCAGGGAAGGAGGAGGG + Intronic
1178359048 21:31932887-31932909 AAGAAGGCAGCGCAGGAGGATGG - Intronic
1178610158 21:34073270-34073292 TAGCAGGCATGGCAGGAGGCGGG + Intronic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1178702647 21:34846342-34846364 GTGGGGGCAGGGCAGGAGAAGGG - Intronic
1178967166 21:37131620-37131642 TAGTCAGCAGGGCAGGAGTGTGG + Intronic
1179030131 21:37712800-37712822 TAGTTGGGTGGGGAGGAGGAAGG - Intronic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179291324 21:40020697-40020719 AGGTGAGCAGGGCAGAAGGAGGG - Intronic
1179304438 21:40141692-40141714 TGGAGGGCAGGGGAGGAGGCAGG + Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179370811 21:40804611-40804633 AAGTGGGCAGGGCAGGAGGCAGG - Intronic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1179714477 21:43280286-43280308 TAGAGGGAAGGGGAGGTGGAGGG + Intergenic
1179726508 21:43344140-43344162 GTGTGGGCAGGGCTGGAGGGGGG + Intergenic
1180050864 21:45330525-45330547 CAGTGAGCAGGGCAGCAGGGCGG - Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180129266 21:45816482-45816504 GAGGGGGAAGGGGAGGAGGAGGG - Intronic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180923818 22:19538274-19538296 GAGGGGGGAGGGAAGGAGGAAGG + Intergenic
1180949765 22:19715711-19715733 CAGCAGGCAGGGCAGGAGGGCGG + Intronic
1180997967 22:19974865-19974887 CACTGGGCAGAGCAGCAGGACGG - Intronic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181096355 22:20507752-20507774 TAGTGGTCGGGGCAGGGGGCTGG + Intronic
1181171412 22:21012255-21012277 TGCAGGGCAGGGCAGGAGAATGG + Intronic
1181349482 22:22244898-22244920 GTGGGGGCAGGGCAGGATGAAGG - Intronic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182278974 22:29207185-29207207 ACATGGGCAGGGCTGGAGGACGG + Intronic
1182456928 22:30457767-30457789 GAGCTGGCAGGGAAGGAGGAGGG - Intronic
1182560226 22:31153724-31153746 GAGTGGGCAGGTTAGGAGCATGG - Intergenic
1182669538 22:31984204-31984226 TAGGGAGAAGGGCAGGAGGCTGG + Intergenic
1183264317 22:36816256-36816278 TGGAGGACAGGGGAGGAGGAAGG + Intronic
1183292729 22:37012610-37012632 TATGGGACAGGGCAGGAGCAGGG + Intronic
1183410156 22:37650286-37650308 GAGGGAGCAGGGCAGAAGGAGGG - Intronic
1183432509 22:37774303-37774325 TAGGAGGTAGGGCAGGAAGAGGG - Exonic
1183902711 22:41018573-41018595 TAGTGGGCACGACAGGTGGATGG + Intergenic
1183928878 22:41224917-41224939 CCCTGGGCAGGCCAGGAGGAAGG - Intronic
1183929435 22:41227645-41227667 GAGAGGGCGGGGCTGGAGGAGGG - Intronic
1184230775 22:43157268-43157290 TGGAGGGCGGGGCAGGAGGGCGG + Intronic
1184306213 22:43604023-43604045 TTGTGGCCAGAGCAGGATGAAGG - Intronic
1184347244 22:43921497-43921519 ATGTGGGCAGGACAGGAGCAGGG - Intergenic
1184895665 22:47405203-47405225 TGGTGGCCAGGGCGTGAGGATGG + Intergenic
1185042782 22:48513965-48513987 GAAAGGGAAGGGCAGGAGGAAGG - Intronic
1185115437 22:48932312-48932334 GAGGGGGGAGGGTAGGAGGAGGG - Intergenic
1185229761 22:49673456-49673478 CAGAGGGCAGGGGAGGGGGAAGG + Intergenic
1185372040 22:50465433-50465455 TGGTGGGAGGGGCAGAAGGATGG - Intronic
1203242624 22_KI270733v1_random:32824-32846 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
949614618 3:5739623-5739645 GAGAGGGGAGGGGAGGAGGAGGG - Intergenic
949810460 3:8001355-8001377 GAGTGGGCAGGTCAGGAGGCAGG - Intergenic
950167959 3:10815990-10816012 CAGTGGGCAGGGCCGCGGGAAGG + Intergenic
950916159 3:16647296-16647318 TAGAGGGGAGGGCAGGAGTGTGG - Intronic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
952557775 3:34552934-34552956 AAGGAGGAAGGGCAGGAGGAGGG - Intergenic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
952780363 3:37091134-37091156 GAGAGGCCAAGGCAGGAGGATGG + Intronic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953354601 3:42244972-42244994 CACTGAGCAGGGCAGGGGGAAGG - Intergenic
953423799 3:42775718-42775740 TAGGGACTAGGGCAGGAGGAGGG - Intronic
953492289 3:43362351-43362373 AAGTTGGCAGGGAAGGAGGCTGG + Intronic
953712474 3:45286165-45286187 ATGGGAGCAGGGCAGGAGGAAGG - Intergenic
954181665 3:48886132-48886154 GGATGGGCAGGGCAGAAGGAGGG + Intronic
954458169 3:50611248-50611270 TAGCAGGCAGGGCAGCAGGCAGG + Intronic
954639028 3:52087097-52087119 GAGTGGGGCGGGCAGTAGGAGGG + Intronic
954705745 3:52479640-52479662 TGGTGAGCATGGCAGGAGGATGG - Intronic
954755902 3:52839678-52839700 TGATGGGGAGGGAAGGAGGATGG - Exonic
954856338 3:53647110-53647132 TCGTGGGCGGGGTAGGGGGAGGG + Intronic
954861633 3:53695440-53695462 GGCTGGGCGGGGCAGGAGGAGGG - Intronic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955403920 3:58613474-58613496 GGCTGGGCAGGGCAGGATGAGGG - Intronic
955823924 3:62924915-62924937 TAGTGGGCAGGGAAGCTGGCTGG + Intergenic
956159671 3:66335895-66335917 TGGTGGGGAGGGAAGGAGGGAGG + Intronic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956724504 3:72145940-72145962 CAGTGGGCAGGGCTGAGGGATGG + Intergenic
956960925 3:74399822-74399844 GGCTGGGAAGGGCAGGAGGAAGG - Intronic
957196284 3:77072370-77072392 TAGTGTGGGCGGCAGGAGGAGGG - Intronic
957566459 3:81890533-81890555 TTGTGGGAAGTGCAAGAGGAAGG + Intergenic
957943662 3:87036613-87036635 TGGTGGGCTGGGCAGGAAAATGG + Intergenic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
959401624 3:105909304-105909326 TAGTGGGCAGGGTTTGGGGAGGG - Intergenic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960610652 3:119552096-119552118 AAGTGGTCAGAGCAGGAGGGTGG - Intronic
961801334 3:129452409-129452431 TGCTGGGCAGGGCAGGGGGTTGG + Intronic
962755930 3:138465412-138465434 TCCTGGGCAGGTGAGGAGGAGGG + Exonic
963974837 3:151468883-151468905 TAGGCAGCAGGGCAGGGGGAGGG - Intergenic
964411583 3:156403420-156403442 TAGTGGGCAGGTAAGGGGAAGGG + Intronic
964498257 3:157318500-157318522 TGGGGGGCAGAGCAGGAGGTGGG + Intronic
964508045 3:157421112-157421134 TAGAGGGCAGTGATGGAGGAAGG + Intronic
964729563 3:159850711-159850733 ACGTGGCCAGAGCAGGAGGAAGG + Intronic
964760133 3:160127609-160127631 TAGTGGGGAAGACAGGAGAATGG + Intergenic
965563337 3:170082832-170082854 GAGAGGCCAAGGCAGGAGGATGG - Intronic
966490468 3:180522486-180522508 GAATGGGGAGGGCGGGAGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966731828 3:183158099-183158121 GAGTGGGAAGGGCCAGAGGAGGG - Intronic
966887249 3:184383499-184383521 TGATGGGCAGGGATGGAGGAGGG - Intronic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967882657 3:194312959-194312981 TGGTGGGAAGGGAAGGAGGGAGG - Intergenic
967906721 3:194507682-194507704 ACCTGGGCAGGACAGGAGGAGGG - Intergenic
968024911 3:195433094-195433116 TAGTGGGTAGTGCAGGGGGTGGG - Intronic
968262343 3:197335404-197335426 AAGAGGGAAGGGAAGGAGGAGGG + Intergenic
968298145 3:197593055-197593077 CAGAGGGCAGGGAAGGAGAAGGG + Intergenic
968590916 4:1459234-1459256 TGGTGGAGAGGGGAGGAGGATGG + Intergenic
968612464 4:1563497-1563519 TTCTGGGCAGGACAGGAGGAAGG - Intergenic
968664424 4:1813349-1813371 CAGCCGGCTGGGCAGGAGGATGG + Exonic
968815549 4:2819872-2819894 TAGGGGGCAGGGCATGATGTTGG + Intronic
968943461 4:3651427-3651449 GCGTGGGCAGGGCAGGCAGAGGG + Intergenic
969110585 4:4841718-4841740 TAGTGGGACGGGGAGGAGGCTGG - Intergenic
969351460 4:6600402-6600424 TCCAGGGCAGGGCAGGCGGAGGG - Intronic
969466045 4:7357065-7357087 TAGTGAGCAGGGAAGGAGACAGG - Intronic
969779953 4:9393250-9393272 GTATGAGCAGGGCAGGAGGAGGG + Intergenic
971232198 4:24808886-24808908 TGGTAGGCTGGGCAGGAGGTTGG - Intronic
971748189 4:30611841-30611863 ACGTGGCCAGAGCAGGAGGAAGG - Intergenic
971899689 4:32643509-32643531 GAGTGTGGAAGGCAGGAGGAGGG + Intergenic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972136291 4:35898836-35898858 TAGTTGCAAGGGCAGGAGAAAGG - Intergenic
972418004 4:38861680-38861702 TAGTAAGGAGGGTAGGAGGATGG - Intergenic
972611132 4:40656665-40656687 TAATTAGCAGGGCAGGAGGAGGG - Intergenic
972960755 4:44448852-44448874 CCGTGGGGAGGGCGGGAGGAGGG + Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973246437 4:48015883-48015905 GAGTGGGCAGGGCTGGCGGGTGG - Intronic
975139344 4:70903397-70903419 GAGGGGGAAGGGCAGAAGGATGG + Intronic
975149892 4:71008958-71008980 AACTGGGAAGGGTAGGAGGAGGG + Intronic
975372351 4:73603473-73603495 TGGGGGGCAGGTCAGGGGGAGGG + Intronic
975598344 4:76072151-76072173 TGGAAGCCAGGGCAGGAGGATGG - Intronic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
977021643 4:91767638-91767660 TAGTTGTCAGGGCTGGAGGGAGG - Intergenic
977566752 4:98588060-98588082 GACTGTGCAGGGCGGGAGGATGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
979226147 4:118287248-118287270 GAGTGGCTAAGGCAGGAGGATGG - Intronic
979237600 4:118420030-118420052 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
979386168 4:120067493-120067515 TAGGGGGCAGGACAGGAATAAGG + Intergenic
979392664 4:120144828-120144850 GAATGGGCAGGGAAGGAGGCAGG - Intergenic
979788590 4:124749612-124749634 GAGTGGGCAGGGCTAGAGGGTGG + Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980191754 4:129533503-129533525 TATAGGGCAGGGAAAGAGGAAGG + Intergenic
980200278 4:129648152-129648174 TAGGGGGAAGGGGAAGAGGAGGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
981092114 4:140742747-140742769 GAGTGGGAAAGACAGGAGGAGGG - Intronic
981459905 4:145001034-145001056 TAGGGTGCAGGGCAGGGGGAGGG + Intronic
981928335 4:150164008-150164030 CAGAGGCCAAGGCAGGAGGATGG - Intronic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
982199381 4:152945313-152945335 TAGGGTGCAGGGGTGGAGGAAGG - Intronic
983966991 4:173824424-173824446 AAGAGGACAGGGCAGTAGGATGG + Intergenic
984149400 4:176108012-176108034 AAGTGGGGAGGGCAGGAGGAAGG - Intronic
984653487 4:182293228-182293250 TCGTGGGCAGTGGAGGAAGATGG - Intronic
985047073 4:185951384-185951406 CAGTGAGCTGGGCTGGAGGAAGG - Intronic
985275002 4:188229622-188229644 GAGAGGCCAAGGCAGGAGGATGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985746576 5:1651797-1651819 CAGAGGGCAGGGCAGGGGTAGGG + Intergenic
986673527 5:10164184-10164206 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
988340852 5:29969156-29969178 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
988348533 5:30070632-30070654 AAGTGGGGAGGGTGGGAGGAGGG - Intergenic
988800773 5:34694663-34694685 TACTGGGCAGCCCAGGAGGCAGG - Intronic
990124198 5:52494520-52494542 TGGAGGGCAGGGCAGGGTGATGG - Intergenic
991038505 5:62152348-62152370 TATTGGTCTGGGCAGGAGAATGG + Intergenic
991408092 5:66321054-66321076 GAGTGGGGAGGGGAGGATGAGGG + Intergenic
992312129 5:75511604-75511626 TAGTGGGCCAGGCAGGAAGATGG - Intronic
992564636 5:77985493-77985515 TGGTGGTGGGGGCAGGAGGATGG + Intergenic
994511874 5:100714355-100714377 GAGGGCGGAGGGCAGGAGGAGGG - Intergenic
995254869 5:110034812-110034834 AACTGTGCAGAGCAGGAGGATGG - Intergenic
995515233 5:112947934-112947956 CAGTGGGCAGGGCAGGATCTGGG + Intergenic
996339218 5:122417717-122417739 AGGTGGGGAGGGAAGGAGGAAGG - Intronic
996681578 5:126233168-126233190 GAGAGGGGAGGGTAGGAGGAGGG + Intergenic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
997315491 5:132931172-132931194 TGGGAGGCCGGGCAGGAGGATGG + Intronic
997681804 5:135761755-135761777 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
997975340 5:138438788-138438810 GTGTGGGCAGGGCAGGAGGTGGG + Intergenic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998172368 5:139880235-139880257 GAGAGGGCAGTGCAGCAGGAAGG + Intronic
998734685 5:145123139-145123161 TTGGGGGCAGGGCAGGATCATGG - Intergenic
999059719 5:148620357-148620379 CAGTGGGGATGGCAGTAGGAAGG + Intronic
999148151 5:149409323-149409345 TAAGAGGCAGGGCAGGAGGTGGG - Intergenic
999200321 5:149811839-149811861 TGGTAGGCAGGGCAACAGGATGG - Intronic
1000033210 5:157420786-157420808 GAGTGGGAAGGGCAGGAGGGGGG + Intronic
1001547872 5:172581646-172581668 CAGTGGGCAGTGCTGGAGGCTGG - Intergenic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002564252 5:180100983-180101005 TCGTCGGCAGGGCAGGGTGAGGG + Exonic
1002666967 5:180831979-180832001 TTCTGGGGAGGGGAGGAGGAGGG - Intergenic
1002738031 5:181411995-181412017 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1002811908 6:639261-639283 CAGTGGCAAGGGCAGGAGAAGGG - Intronic
1002918190 6:1545884-1545906 TTGTGGGCAGGGCAGGAGAGAGG + Intergenic
1003022620 6:2524324-2524346 CAGAGGGCACTGCAGGAGGAAGG - Intergenic
1003310418 6:4965394-4965416 GAGTGGGAGGGGCAGGAGGGAGG - Intergenic
1003366629 6:5481278-5481300 TAATAGGCAGGGAAGGGGGAGGG + Intronic
1003367758 6:5492868-5492890 TGGGTGGCAGGGCAGGAGCAAGG - Intronic
1003378910 6:5604480-5604502 GAATGGGCAGGGGAGGAGGTGGG + Intronic
1003393929 6:5736954-5736976 TAGTGTGGAGGGCGAGAGGAAGG - Intronic
1004169586 6:13285490-13285512 GAGAGAGCAGGGGAGGAGGAGGG - Intronic
1004173203 6:13315251-13315273 GAGTAGGCTGAGCAGGAGGAGGG - Intronic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004951598 6:20679154-20679176 GGGAGGCCAGGGCAGGAGGAGGG - Intronic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1005068732 6:21844610-21844632 TAATGGCCAGAGCAGGAGTAGGG - Intergenic
1005307846 6:24530902-24530924 GAGTGGGCAGGGCAAGGGCAGGG - Intronic
1005483866 6:26280725-26280747 TAGTGGGAAGGCCGTGAGGAAGG + Intergenic
1005487916 6:26318786-26318808 AAGAGGGCAGGGCATGAGCATGG + Intergenic
1006510580 6:34519097-34519119 GAGTGGGCTAGGGAGGAGGAGGG + Intronic
1006624941 6:35390781-35390803 GAGAGGCCAAGGCAGGAGGATGG + Intronic
1006929387 6:37678581-37678603 GAGTGGGGAGGGCAGTAGAATGG - Intronic
1007161204 6:39792946-39792968 CAGTGGGCAGGGCAGCCGTAAGG + Intronic
1007390173 6:41546326-41546348 GAGGGGGCGGGGGAGGAGGAGGG - Intergenic
1007502453 6:42308784-42308806 GAGGGGGGAGGGCAGGAGGAGGG + Intronic
1007574409 6:42915905-42915927 TGGGGGCCAGGGCAGGAGTAGGG + Intergenic
1007704907 6:43784557-43784579 CGGTGAGCCGGGCAGGAGGAAGG + Exonic
1007811052 6:44485909-44485931 TGATGGGGAGGGCAGGGGGAAGG - Intergenic
1007958194 6:45935965-45935987 TAGTGGGGAGGGCATAAAGATGG - Intronic
1008657531 6:53631002-53631024 TGGTGGACAGGGCTGTAGGAAGG - Intergenic
1009537896 6:64913399-64913421 AAGTGAGCAGGGAAGGAGAAAGG - Intronic
1010969559 6:82248789-82248811 TGCTGGGAAGGGCAGTAGGAGGG - Intergenic
1011160131 6:84380782-84380804 CAGTGGGCTGGGCAGGTGGGTGG + Intergenic
1011208031 6:84922570-84922592 TAGGAGGCAGGGCAGGAGGCAGG + Intergenic
1011310867 6:85978010-85978032 TAGAGAGCAGGGCAGGGGGCAGG + Intergenic
1011708060 6:90023405-90023427 ATGTGGCCAGAGCAGGAGGAGGG - Intronic
1011871815 6:91903977-91903999 TAGTGTGAAGGGTGGGAGGAGGG + Intergenic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012332998 6:98017189-98017211 TAGGGGTCAGGGTAGGAAGATGG + Intergenic
1012835301 6:104256925-104256947 TAGAGGGCAGGTGAGGGGGAGGG - Intergenic
1013073300 6:106748678-106748700 TGGAGGGCAAGGCAGGAGGTAGG - Intergenic
1013348404 6:109284372-109284394 TACTGGGCATTGCAGCAGGAGGG - Intergenic
1013367044 6:109444373-109444395 AACTGGGCAGGGAAGCAGGAGGG + Intronic
1013547752 6:111175932-111175954 GGGTGGCCAAGGCAGGAGGATGG - Intronic
1013688876 6:112616651-112616673 TAGTGGGAAGGGGATGAGGCAGG + Intergenic
1015252928 6:131145791-131145813 TGGAGGCCAAGGCAGGAGGATGG - Intronic
1015295603 6:131588675-131588697 TACTGGGAGGGGTAGGAGGATGG + Intronic
1015624725 6:135168574-135168596 TAGCAGGCAGGGTAGAAGGAGGG - Intergenic
1015636342 6:135278733-135278755 TGGTGGGGAGGGCGAGAGGAGGG + Intergenic
1016492906 6:144627114-144627136 TAGGGGGCTGGGGAGGAGCATGG + Intronic
1017017540 6:150113884-150113906 TAGTGGGGAGGACGGGTGGAAGG - Intergenic
1017708640 6:157147352-157147374 TGGCGGGCAGGGCCGGAGGCGGG - Intronic
1017708827 6:157147832-157147854 TGGCGGGCAGGGCCGGAGGCGGG - Intronic
1018205778 6:161436096-161436118 CAGAGAGCAGGGGAGGAGGATGG + Intronic
1018220656 6:161575015-161575037 TTGTGAGCACGGCATGAGGATGG - Intronic
1018705442 6:166460641-166460663 TAGTTAGCAGGGCAGCAGCAGGG + Intronic
1018725834 6:166612831-166612853 TAGTGCGCAGGGCCAGAGGGAGG - Intronic
1018986072 6:168638076-168638098 TCCTGGGCAGGGCAGGGGCAGGG - Intronic
1019070931 6:169344297-169344319 CTCTGGGCAGGGCAGGAGGCAGG + Intergenic
1019164793 6:170091115-170091137 CAGGGGGCAGGGCAGGGGGCAGG - Intergenic
1019243132 6:170687554-170687576 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1019351727 7:557151-557173 GAGATGGGAGGGCAGGAGGAGGG - Intronic
1021530098 7:21634661-21634683 GAGAGTGGAGGGCAGGAGGAGGG + Intronic
1021680032 7:23120974-23120996 TAGAGGGAAGGGGAGGCGGAAGG - Intronic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1022028818 7:26473119-26473141 CAGTGGGTGGGCCAGGAGGAAGG - Intergenic
1022522842 7:31019144-31019166 GTGTGGGTAGGGCAGGAGGGAGG + Intergenic
1023756729 7:43425483-43425505 TAGTGGATAGCGCAGGAGGCTGG - Intronic
1023921347 7:44632541-44632563 TAGGAGGCAAGGCAGGAGGATGG - Intronic
1024519298 7:50290042-50290064 CAGTGGGCAGGGCAGGGGATGGG - Intergenic
1024970864 7:55068894-55068916 TGGTGGGCAGAGCAGTTGGAGGG + Intronic
1025758817 7:64371251-64371273 AAGTGGGCAGGGCTTGAGCAGGG - Intergenic
1026039961 7:66859922-66859944 TGGAGGGCAGTGAAGGAGGATGG - Intergenic
1026863892 7:73810929-73810951 TGATGGGGAGGGGAGGAGGAAGG + Intronic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027238149 7:76310286-76310308 GTCTGGGCAGGGCAGGAGCAGGG + Intergenic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028165980 7:87538980-87539002 TGGTGGGCAGTGCAGGCAGAAGG - Intronic
1028520183 7:91721247-91721269 TAGTGGGCCAGGCAGGTGGGTGG - Intronic
1028683314 7:93564268-93564290 TGGTGGGCAGGTCAGATGGAAGG + Intronic
1029195147 7:98800274-98800296 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1029538062 7:101167275-101167297 ATGGGGGCAGGGGAGGAGGAAGG + Intergenic
1029716438 7:102329768-102329790 GGGAGGCCAGGGCAGGAGGATGG + Intergenic
1029723069 7:102382975-102382997 GGGAGGCCAGGGCAGGAGGATGG + Intronic
1030379001 7:108789993-108790015 GAGAGTGAAGGGCAGGAGGAGGG - Intergenic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1031417760 7:121513164-121513186 TAGAGTTTAGGGCAGGAGGATGG + Intergenic
1032035491 7:128518263-128518285 TGGAGGCCAAGGCAGGAGGATGG + Intergenic
1032044993 7:128598016-128598038 GAGAGGCCAAGGCAGGAGGATGG - Intergenic
1032115183 7:129110875-129110897 GAGTGGGCAGTGGAGGAGGCAGG + Intergenic
1032121232 7:129158534-129158556 TAGAGTGAAGGGTAGGAGGAAGG - Intronic
1032192982 7:129775058-129775080 GAGTGGGCAGGCTAGGAGCAGGG - Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1032471030 7:132179547-132179569 CAGTGGGCAGTGCTGGAGGCTGG - Intronic
1032471112 7:132180000-132180022 TAGTGACCAGGGCAGGATGACGG + Intronic
1033939626 7:146636181-146636203 TTCTGGGCAGGGCAGGGGGGCGG + Intronic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1035022237 7:155806627-155806649 GACTGGGCAGGGCAGGCTGATGG - Intronic
1035029510 7:155848361-155848383 GAGCGGGCAGGGAAGGAGGGAGG - Intergenic
1035205434 7:157291420-157291442 TGGAGGGCAGGGGAGGAGGAGGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035504990 8:120609-120631 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
1035543760 8:462744-462766 AAGAGGGAAGGGTAGGAGGAGGG + Intronic
1035705534 8:1671694-1671716 AGCTGGGCAGGGAAGGAGGACGG - Intronic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035900879 8:3457206-3457228 CAGTGAGGAGGGCAGGATGAGGG - Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036090672 8:5661568-5661590 TAGGAGGGAGGGCAGGAGCAGGG + Intergenic
1036137563 8:6175878-6175900 GAGAGGGCAGGGCAGGAAGAGGG - Intergenic
1036191042 8:6670861-6670883 TAGTTGGCTGGGCAGGGGGTCGG + Intergenic
1036585855 8:10122677-10122699 GAGTGTAGAGGGCAGGAGGAAGG - Intronic
1036992796 8:13617882-13617904 TTGTGAGCAGGGAAGGAGGGAGG + Intergenic
1037176284 8:15950078-15950100 TGGTGTGCAGGGCAGGAGTATGG - Intergenic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037326095 8:17692670-17692692 GAGGGTGCAGGGTAGGAGGAGGG + Intronic
1037542653 8:19887421-19887443 GGGTGGCCAAGGCAGGAGGATGG - Intergenic
1037562685 8:20088973-20088995 TATTGGGGAGGGGAGGAAGATGG - Intergenic
1037751272 8:21683914-21683936 TGGTGGGCAGGGAAGGAGAGGGG + Intergenic
1037757585 8:21721264-21721286 CAGTGGGCAGGATAAGAGGAAGG - Intronic
1037767409 8:21780657-21780679 GAGAGGGGAGGGCAGGGGGATGG - Intronic
1037895867 8:22654494-22654516 TGGTTGCCAGGGCTGGAGGAGGG - Intronic
1038156667 8:24998052-24998074 CAGTGGGCAGGCCAGGAAAATGG - Intergenic
1038704416 8:29880473-29880495 GAGTTGGCAAGGCAGCAGGAGGG + Intergenic
1039026556 8:33264665-33264687 TTTGGGGCAAGGCAGGAGGATGG + Intergenic
1039486810 8:37916511-37916533 TAATTGGAAGGGCGGGAGGAGGG - Intergenic
1039615966 8:38955204-38955226 GGGTGGGAAGGGCAGGAGGGGGG - Intronic
1039944120 8:42115597-42115619 TAGTGGGCAGGGGCAGCGGATGG - Intergenic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1041161016 8:55044049-55044071 TAGTGGGAAGGGAAGAAGCAGGG - Intergenic
1041523324 8:58778409-58778431 TAGTGAGGAGGGTGGGAGGAGGG + Intergenic
1041601168 8:59718778-59718800 GAGTAGGCAGAGAAGGAGGAAGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041718135 8:60950606-60950628 CAGTGGGCAGGGAAGTGGGAGGG + Intergenic
1042659473 8:71137849-71137871 TGGTGGGTAGGGCAGAAAGAAGG + Intergenic
1042931968 8:74022922-74022944 TAAGGGGCAGGGGAGGAAGATGG - Intronic
1043968022 8:86501046-86501068 GAATGGGGAGGGCAGGAGGTAGG + Intronic
1044557930 8:93584850-93584872 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1044666820 8:94640790-94640812 GCGAGGGCAGGGGAGGAGGAGGG - Intergenic
1044922447 8:97180533-97180555 TGGTGGGCAGGGGAGGTGGGGGG - Intergenic
1045048055 8:98297674-98297696 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045238428 8:100376734-100376756 GAGTGGGAAGGTCAGGAAGAAGG + Intronic
1045318994 8:101067380-101067402 TAGGGGAGAGGGCAGGAGGCAGG + Intergenic
1045407705 8:101883457-101883479 GAGTGGTGAGGGGAGGAGGAAGG - Intronic
1045940857 8:107736446-107736468 TATGTGGCAGGGAAGGAGGAGGG + Intergenic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046694258 8:117320881-117320903 GAGTGGGGAGGGTAGAAGGAGGG + Intergenic
1047913087 8:129552505-129552527 TAGTGGTCAGGGGAGTATGATGG - Intergenic
1048158196 8:131983340-131983362 AAGTGGGGAGGGCAAGAGCATGG + Intronic
1048167390 8:132075628-132075650 TTGTTGGCAGTGAAGGAGGAAGG - Intronic
1048483036 8:134819239-134819261 GAGTGGGAAGGGGAAGAGGAAGG + Intergenic
1048511808 8:135069885-135069907 TAGGGGGCAGGGCAGGACCATGG - Intergenic
1048526101 8:135204437-135204459 GAGTGGGGAGGGCAGGAGAGGGG + Intergenic
1048577753 8:135706358-135706380 TAGTGGTCAGGACATGAGCAAGG + Intergenic
1048613161 8:136046169-136046191 TACTGCGCAGAGCATGAGGAGGG + Intergenic
1048800307 8:138188687-138188709 CAGTGGGCAGGGCTGCAGGAAGG - Intronic
1049206866 8:141367568-141367590 CCGTGTGCAGGGCAGGAGGTGGG + Intergenic
1049245593 8:141560556-141560578 TGGAGGGCAGGGGAGGAGGGAGG + Intergenic
1049276108 8:141720900-141720922 GAGAGGCCAGGGCCGGAGGAGGG - Intergenic
1049850779 8:144829136-144829158 CAGTGGGCAGAGCAGGAGGTGGG - Intronic
1050090855 9:2015896-2015918 TGGGGGACAGGGGAGGAGGATGG + Intronic
1050345449 9:4681414-4681436 TGGTGGGCAGTGCAGTAGGTGGG - Intronic
1050428768 9:5539781-5539803 GCCTGGGCAGGGCAGGGGGATGG + Intronic
1050648507 9:7748590-7748612 AAGAGGCCAGTGCAGGAGGAAGG + Intergenic
1051396100 9:16622722-16622744 GGGTGGCCAGGCCAGGAGGAGGG + Intronic
1051696567 9:19774188-19774210 TGGTGGGTTGGGGAGGAGGAGGG + Intronic
1052040782 9:23736477-23736499 GAGTGGGGAGGGGAGGAGCAGGG + Intronic
1052228274 9:26116314-26116336 TTGTGGGCGTGGCAGGGGGAGGG + Intronic
1052511847 9:29432319-29432341 TAGGGGGCTGGTCAGGAGGTGGG - Intergenic
1052991254 9:34520541-34520563 TACTGGGCAGGGGAGGGGTAGGG + Intronic
1053233825 9:36434339-36434361 GGGAGGGCAGGGGAGGAGGATGG + Intronic
1053472734 9:38358413-38358435 GGGAGGCCAGGGCAGGAGGATGG + Intergenic
1053510969 9:38687475-38687497 CAGTGTGCAGAGCAGGAGGCGGG - Intergenic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1056068085 9:82957806-82957828 TTGTGGGCAGGGGAAAAGGAAGG + Intergenic
1056481270 9:87008834-87008856 TAGTCAGGAGGCCAGGAGGAAGG - Intergenic
1056782344 9:89560270-89560292 TAGTGGGCAGGGAAGGGAGCTGG + Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057214619 9:93220950-93220972 GGGTGGGCAGCCCAGGAGGAGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057575538 9:96239250-96239272 TAGTGAGAGGGGCAGGAAGAAGG + Intronic
1057935932 9:99238954-99238976 TGGTGGGCAGAGCGGGGGGAGGG - Intergenic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058872773 9:109216886-109216908 GAGGGGGCAAGGCAGGAGAAGGG - Intronic
1059368232 9:113804059-113804081 GGGAGGGCAAGGCAGGAGGATGG + Intergenic
1059490973 9:114667098-114667120 GGGTGGGAAGGGCAGAAGGAAGG + Intergenic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1060063471 9:120482411-120482433 GAGTTGGAAGGGTAGGAGGAAGG - Intronic
1060200407 9:121649078-121649100 AAGGGGGCAGGGCAGGAGCTAGG - Intronic
1060227770 9:121805812-121805834 GCCTGGGCAGGGGAGGAGGAAGG + Intergenic
1060460636 9:123851172-123851194 TGGTGGGGAGTGCAGCAGGAGGG - Intronic
1060541721 9:124435456-124435478 GAGAGGTCAAGGCAGGAGGATGG + Intergenic
1060647233 9:125291392-125291414 TAGTGAGGAGGGCAGGTTGAGGG + Intronic
1060652043 9:125336634-125336656 TAGGGGGCAGGCCAGGTGTAGGG - Intronic
1061004170 9:127918980-127919002 GGGTGGCCAGGGCAGGTGGAGGG - Intergenic
1061677697 9:132227722-132227744 GAGTGGGCAGGCCCTGAGGATGG - Intronic
1061809697 9:133155150-133155172 TAGTGGGCTGGGGAAGGGGAGGG - Intronic
1062149602 9:135010869-135010891 TCGTGGACAGGGCAGGTGGAGGG - Intergenic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1062273533 9:135720481-135720503 GGGAGGGCTGGGCAGGAGGAGGG - Intronic
1062371243 9:136239990-136240012 AGGTGGGCAGAGCAGGAGAAGGG - Intronic
1062453953 9:136627109-136627131 AGGTGGGCAGGGCAGGGGGCTGG - Intergenic
1203458950 Un_GL000220v1:15907-15929 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1203603321 Un_KI270748v1:36778-36800 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1185855043 X:3526065-3526087 TATTGTGCAAGGTAGGAGGAAGG - Intergenic
1186194867 X:7100028-7100050 TAGGGGGCCGGGGAGGGGGACGG - Intronic
1186402333 X:9271342-9271364 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1186473955 X:9842819-9842841 AAGAGGGGAGGGAAGGAGGAGGG - Intronic
1186481894 X:9902300-9902322 TAGAGGGGAGGGCAAGTGGATGG + Intronic
1186884583 X:13900400-13900422 TACTGGGAAGGGCTGGAGGGAGG + Intronic
1187132251 X:16514163-16514185 AAGGGGGGAGGGAAGGAGGAAGG + Intergenic
1187699011 X:21946889-21946911 TGTTAGGCAGGGAAGGAGGATGG + Intronic
1187936483 X:24341191-24341213 GAGTGGGCAGGGAAGATGGAAGG + Intergenic
1188035058 X:25308010-25308032 GAGAGTGGAGGGCAGGAGGAAGG - Intergenic
1188535732 X:31194734-31194756 TTGTGGGCAAGGCAGGAGGGTGG + Intronic
1188567412 X:31542859-31542881 TAGAGGGCAGGGCATGAATAAGG + Intronic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1188878977 X:35468670-35468692 GTGTGGGGAGGGGAGGAGGATGG + Intergenic
1189161819 X:38817156-38817178 CAGTGGGGAGGGGAGGGGGATGG - Intergenic
1189332654 X:40153076-40153098 TCCTGGGCAGGGCAGGAAGCTGG - Intronic
1189446385 X:41085248-41085270 GAGGGGGCTGGGCAGGAGCAGGG + Intergenic
1189907359 X:45775138-45775160 GAGTGGGCAGGGTGGGAGAAAGG + Intergenic
1189996760 X:46646523-46646545 TAGTGGGGAGGGGCAGAGGAAGG + Intronic
1192170784 X:68853203-68853225 CAATGGGCAGGACATGAGGACGG - Intergenic
1192950921 X:76015076-76015098 TAGGGGGCAGGGGAGTAGAATGG - Intergenic
1193519775 X:82514207-82514229 GAGAGGCCAAGGCAGGAGGATGG - Intergenic
1193932179 X:87566913-87566935 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195712598 X:107785867-107785889 CAGAGAGCAGGGCAGGAGAAGGG + Intronic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1196665029 X:118306585-118306607 AAGAGGGGAGGGTAGGAGGAGGG + Intergenic
1196729137 X:118923706-118923728 TAGGGGGAAGGGCAGGAGTTAGG - Intergenic
1196769574 X:119280660-119280682 GAGTGGGTAGGGCAAGGGGAGGG - Intergenic
1196893705 X:120312735-120312757 TGGTGGCCAGGGGAGGTGGAGGG + Intergenic
1196943745 X:120803634-120803656 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1198962494 X:142197007-142197029 CATGGGGCAGGGCAGGAGGATGG - Intergenic
1199095872 X:143737891-143737913 TAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1199679937 X:150217301-150217323 TAGTGAGGCGGGCAGGAAGACGG + Intergenic
1199827718 X:151516295-151516317 TGGTGGGGAGGGAAGGAGGGAGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200059800 X:153479202-153479224 TGGTGGCCACGGCAGGACGATGG - Intronic
1200225217 X:154413316-154413338 TCCTGGGCAGAGCAGGAGGAGGG - Intronic
1200276232 X:154735668-154735690 TAGGGGCCAGGGCAGAAGCAGGG - Intronic
1200281102 X:154777856-154777878 TAGTGGGCCTGGCAGGAGCGGGG + Intergenic
1200365449 X:155657649-155657671 CACTGGGCAGGGGAGGAGGATGG + Intronic
1200808557 Y:7458717-7458739 TATTGTGCAAGGTAGGAGGAAGG + Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201298351 Y:12485061-12485083 TGGAGGGCGGGGCAGGGGGAAGG + Intergenic