ID: 1150501613

View in Genome Browser
Species Human (GRCh38)
Location 17:65656334-65656356
Sequence CTCTAGGTACAGATTGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150501613_1150501618 7 Left 1150501613 17:65656334-65656356 CCTTTATCAATCTGTACCTAGAG 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1150501618 17:65656364-65656386 TGTCTTTGGATTTTTCAGTTTGG 0: 1
1: 1
2: 9
3: 164
4: 1524
1150501613_1150501619 8 Left 1150501613 17:65656334-65656356 CCTTTATCAATCTGTACCTAGAG 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1150501619 17:65656365-65656387 GTCTTTGGATTTTTCAGTTTGGG 0: 1
1: 0
2: 5
3: 51
4: 526
1150501613_1150501615 -7 Left 1150501613 17:65656334-65656356 CCTTTATCAATCTGTACCTAGAG 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1150501615 17:65656350-65656372 CCTAGAGTTAGCCCTGTCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150501613 Original CRISPR CTCTAGGTACAGATTGATAA AGG (reversed) Intronic
905285726 1:36879094-36879116 CTCTATGTACAGAGAGCTAATGG - Intronic
907293152 1:53430636-53430658 TTTTAGGTACAGATGGACAAAGG - Intergenic
909513394 1:76480000-76480022 CTATAGCTACTGGTTGATAAAGG + Intronic
912389902 1:109295767-109295789 TTCTTGGTACAGGTTGTTAATGG + Intronic
919653888 1:200179012-200179034 TTCTAGTTACAGGTTGAAAAGGG - Intergenic
921503902 1:215942640-215942662 CTCCAGGTACAAATGTATAAAGG + Intronic
1064648057 10:17480299-17480321 CTATCGGTACAGATTTAAAATGG + Intergenic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1069383693 10:67865145-67865167 CTGCAGGTACAGATTTTTAAAGG - Intergenic
1075927567 10:126265392-126265414 ATCTAGGCACTGATTGTTAATGG + Intronic
1079768410 11:24425282-24425304 CTCTAGGTAAAGAATGACAGAGG + Intergenic
1084868820 11:72081713-72081735 ATCTGGGGACAGATTGAGAAGGG - Intronic
1085040010 11:73321438-73321460 CTTTGGGTTCAGACTGATAAGGG + Intronic
1085703341 11:78764320-78764342 CTCGATGTACAGAAAGATAATGG - Intronic
1085891806 11:80588366-80588388 CTCTGGGTTCAGTTTGATAGTGG + Intergenic
1088813127 11:113404856-113404878 CTCCAGGAAGAGAATGATAATGG + Intergenic
1089080368 11:115771605-115771627 ATCTAGGTACAAGGTGATAAAGG + Intergenic
1094003001 12:25716464-25716486 CTCTAGGCACAAAATAATAAGGG + Intergenic
1101530114 12:105566108-105566130 CTCTTGATATAGATTGACAATGG + Intergenic
1106532223 13:30604109-30604131 CTCTTTGTGCAGATTGAAAAGGG - Intronic
1107344704 13:39446637-39446659 CTCTAGCTACAGAATGAAGATGG - Intronic
1108602184 13:52004525-52004547 CTCTAGTTAGAGATAGTTAATGG - Intronic
1109443930 13:62408189-62408211 CTCTAGGTACTTATGGTTAAGGG - Intergenic
1110142362 13:72146489-72146511 CTCTAGGGAGAGATTTAAAATGG - Intergenic
1114402408 14:22422034-22422056 CTCTAGGCAAAGTTGGATAAGGG - Intergenic
1114882831 14:26807719-26807741 ATCTAGGTACATATCAATAATGG + Intergenic
1114931480 14:27474249-27474271 CTATATGTACAGCTTGAGAAGGG - Intergenic
1116106996 14:40521670-40521692 ATCTATGTTCATATTGATAAAGG - Intergenic
1116124197 14:40760329-40760351 CTCCTGGTAAAGATGGATAAAGG - Intergenic
1117044984 14:51804284-51804306 CTCCAGGTACAGTTTGATCCAGG - Intergenic
1120091532 14:80337783-80337805 ATGTATGTACAGATTGGTAAAGG - Intronic
1120538679 14:85728819-85728841 CTCTAGTTTCAGAGTGGTAAAGG - Intergenic
1128929594 15:71692170-71692192 ATCTAGGCACAGACTGATAAAGG + Intronic
1130817471 15:87453098-87453120 CTTCAGATACAGATAGATAATGG + Intergenic
1132201814 15:99960127-99960149 CTGTAGGTAAATATGGATAACGG + Intergenic
1134753983 16:16650241-16650263 CTATAAGTTCAGATTTATAAGGG + Intergenic
1134992076 16:18708803-18708825 CTATAAGTTCAGATTTATAAGGG - Intergenic
1137324033 16:47414972-47414994 CTCTAGGGACAAATTGAAACTGG + Intronic
1141789860 16:86227105-86227127 CTCAAGGTACAAAATGACAATGG - Intergenic
1144234532 17:13245017-13245039 CCCCAGGGACAGATTGACAACGG - Intergenic
1150501613 17:65656334-65656356 CTCTAGGTACAGATTGATAAAGG - Intronic
1151164419 17:72191753-72191775 TTCTAGAAACACATTGATAAGGG + Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1159196756 18:65125686-65125708 CACTAGCTCCAGCTTGATAAGGG - Intergenic
1161742758 19:6033897-6033919 CTCAAGATACTGTTTGATAAAGG - Intronic
934593190 2:95577459-95577481 CTCCAGGTACAGACTGACCATGG + Intergenic
938043158 2:128092973-128092995 CCCTAGGGTCAGAATGATAAGGG + Intronic
938177155 2:129144353-129144375 CTCTAGCTAAAGATTTGTAAAGG - Intergenic
941312700 2:163953652-163953674 CTACAGGTATAGATAGATAAGGG - Intergenic
945454028 2:210028186-210028208 AGTTAGGTCCAGATTGATAATGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169599488 20:7241154-7241176 CTCTAGGTCTAGATTTCTAATGG - Intergenic
1171069510 20:22054005-22054027 CTCTAGGTACAGAATGTGATTGG + Intergenic
1174738610 20:52989689-52989711 CTCTAGGGAGAGACTGAGAAAGG - Intronic
1178276869 21:31246841-31246863 CTCTTGGTACAGTTTGACCATGG + Intronic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
950382913 3:12632514-12632536 GTAAAGATACAGATTGATAAAGG + Intronic
951359286 3:21705339-21705361 TTCTTGGTACAGATTAAGAAAGG + Intronic
952867665 3:37865010-37865032 CTTTAGATACAGATTTACAAAGG + Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
957237298 3:77610959-77610981 CATCAGGTACAAATTGATAAAGG - Intronic
960638386 3:119806127-119806149 CTCTAGGCACTGACTGACAAGGG - Intronic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
965475182 3:169147568-169147590 CTATAGGGACAGACTGATTATGG + Intronic
965922913 3:173941007-173941029 CGCTTGGTACAGTTTTATAAAGG + Intronic
971373553 4:26037851-26037873 ATCTAGGTGCAGATAGAGAATGG - Intergenic
971632605 4:29013130-29013152 ATCTAGGTAAACATTGAAAAGGG + Intergenic
972937365 4:44154473-44154495 CTGTAATTACAGATTTATAATGG - Intergenic
973955453 4:56058921-56058943 CTCAATGGACAGATTCATAAAGG - Intergenic
977959992 4:103075037-103075059 ATCTAGTTACAGGATGATAAAGG + Intronic
983390363 4:167123545-167123567 ATCTTGGTACAGACAGATAATGG - Intronic
986898682 5:12403947-12403969 ATCTAGGGACAGATTGATATGGG - Intergenic
990867652 5:60397894-60397916 CTCTATGAACAAATTGATTAGGG - Intronic
992573609 5:78086991-78087013 CTATATGTGCAGATTGATATAGG - Intronic
992883572 5:81134944-81134966 CTCTAGTTACATTTTTATAATGG + Intronic
993756747 5:91740561-91740583 TTCTAGGTACAGATTTTAAAAGG - Intergenic
993835676 5:92817619-92817641 GACTATGTACAGAGTGATAAGGG - Intergenic
994440193 5:99792320-99792342 CTCTTGGAACAGATTTATTATGG + Intergenic
995206872 5:109489799-109489821 CTCAGGGTACAGCTTAATAAGGG + Intergenic
1001019056 5:168167377-168167399 CTCTAAGTTCAGGGTGATAAAGG - Intronic
1009158702 6:60255155-60255177 CTCTAGGTAGAGGTTGTTCAGGG + Intergenic
1010813085 6:80322578-80322600 CTCTAAGTAAAGATGGTTAAGGG - Intronic
1013267262 6:108512207-108512229 CTCTATGCACAGAATGAAAATGG + Intronic
1017900117 6:158712450-158712472 CTATGGGTACAGGTTGACAAGGG - Intronic
1019804736 7:3115277-3115299 TTCTAGGAAAAGATTGATCATGG - Intergenic
1020329572 7:7003741-7003763 CTCCAGCTACATATTGATCATGG - Intergenic
1020430995 7:8116015-8116037 CATTAGGTACAATTTGATAAAGG + Intronic
1021106954 7:16648096-16648118 TTCTAGAAACAGATTCATAATGG + Intronic
1023670407 7:42570450-42570472 ATCTAGGCACAGAATGATGATGG + Intergenic
1024769877 7:52709357-52709379 CTCTAGTTCCAGATTGACAAGGG + Intergenic
1032593605 7:133216393-133216415 ATCTAGGTATAAATTGAGAAGGG + Intergenic
1035172067 7:157022278-157022300 CTCTAGGTCCATATTTAAAACGG - Intergenic
1036076665 8:5509698-5509720 ATCAAGGTAGAGATGGATAATGG + Intergenic
1037060259 8:14499750-14499772 ATCTATATACAAATTGATAAGGG - Intronic
1043715660 8:83482353-83482375 TTCTAGGTACAGTTTGCTGAAGG - Intergenic
1044707634 8:95024390-95024412 CTATAGGTAGTGGTTGATAATGG + Intronic
1047182657 8:122604310-122604332 CTTTGTGTACAGATTGATCATGG - Intergenic
1051026214 9:12614779-12614801 CACTTGGTGCTGATTGATAAGGG + Intergenic
1051387710 9:16527459-16527481 CACTTCGTACAGTTTGATAAAGG - Intronic
1055046027 9:71925112-71925134 CTCTAGGGACACATTTATTAAGG + Intronic
1055164213 9:73171870-73171892 CACTAGGTAGAGCTGGATAAAGG + Intergenic
1058693608 9:107540047-107540069 CTCTAGAGACAGACAGATAAGGG + Intergenic
1059658865 9:116381531-116381553 CTCTGGGTTCAGATAAATAATGG + Intronic
1060835156 9:126750331-126750353 CTCTGGGTACTGATTAGTAAAGG - Intergenic
1188117146 X:26258340-26258362 CTCTAAGAACAGGTTGATCAAGG + Intergenic
1196028203 X:111064962-111064984 GTCTAGGTATAGATTCATGAAGG + Intronic