ID: 1150503220

View in Genome Browser
Species Human (GRCh38)
Location 17:65671219-65671241
Sequence TTTTCTGTGATGTCACCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150503220_1150503224 13 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503224 17:65671255-65671277 ACACTTTAAGAGCTCCCGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1150503220_1150503225 14 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503225 17:65671256-65671278 CACTTTAAGAGCTCCCGAAGGGG 0: 1
1: 0
2: 1
3: 4
4: 51
1150503220_1150503223 12 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503223 17:65671254-65671276 TACACTTTAAGAGCTCCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 214
1150503220_1150503228 25 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 96
1150503220_1150503227 22 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503227 17:65671264-65671286 GAGCTCCCGAAGGGGAAATTGGG 0: 1
1: 0
2: 1
3: 5
4: 95
1150503220_1150503226 21 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503226 17:65671263-65671285 AGAGCTCCCGAAGGGGAAATTGG 0: 1
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150503220 Original CRISPR TTTTCTGTGATGTCACCCTG TGG (reversed) Intronic
901906606 1:12417623-12417645 TTTTATGTCATATCACCCTGTGG - Intronic
902070549 1:13731436-13731458 TTCTCTCTGATTTCACCATGAGG + Intronic
908494677 1:64682430-64682452 TTTTCAGTCATGTCCCCTTGGGG + Intronic
908958613 1:69667985-69668007 TTTTATTTGAGGTCACCATGAGG + Intronic
909962221 1:81860590-81860612 TTTTGTGTCATGTTACCATGGGG - Intronic
910540793 1:88354722-88354744 TTTTCTGAGATGCCACATTGGGG + Intergenic
911431285 1:97790641-97790663 TTTTCTGTGTTCTCACCATTTGG + Intronic
911682345 1:100731883-100731905 CTTTATGTGGTGTCACCCTGAGG + Intronic
911768485 1:101708766-101708788 TTCTCTTTCATGCCACCCTGGGG + Intergenic
911931392 1:103908463-103908485 TATTCTGTAATGGCAGCCTGAGG + Intergenic
915751509 1:158214642-158214664 TTTTGTGTGATGTCCCTCTGTGG + Intergenic
916471739 1:165130123-165130145 CTTTATGAGATGTCACCCTGAGG - Intergenic
916476359 1:165173237-165173259 TTTGATGAGATGTCACCCTGTGG + Intergenic
920171871 1:204077003-204077025 TTTTCTATCACATCACCCTGTGG - Intronic
921730627 1:218574072-218574094 TTTTCTCTGATGTAAATCTGTGG - Intergenic
923505012 1:234598093-234598115 TTTTCTGTGATGACAGCAGGGGG + Intergenic
1065971187 10:30807019-30807041 TTTTCTCTGATGTCACCAGGGGG - Intergenic
1067367047 10:45642078-45642100 ATTTTCGTCATGTCACCCTGTGG + Intronic
1067805570 10:49390615-49390637 TTTTGTGGGATGACACCATGAGG - Intronic
1068521171 10:58079340-58079362 TTTTCTGATATTTCTCCCTGAGG + Intergenic
1068883190 10:62072045-62072067 TTCTCTGTTCTGTCACCCTAGGG - Intronic
1070780256 10:79133432-79133454 TTCTCTGTGCTGTACCCCTGAGG - Intronic
1070961144 10:80501056-80501078 GTTTCTGTGAATTCACGCTGAGG - Intronic
1071183643 10:83015791-83015813 TTTTCAGTGCTACCACCCTGAGG + Intergenic
1074053074 10:109897604-109897626 TTTACTGTGGTGTTACCTTGGGG - Intronic
1075024355 10:118973359-118973381 TTTTCTGTTCTGTCATTCTGGGG - Intergenic
1075612233 10:123863455-123863477 TTCTCTGTGAGGTCAGCCTCGGG - Intronic
1076215736 10:128692274-128692296 TTTTCTGGGATTTCACCCAAGGG - Intergenic
1076264223 10:129096937-129096959 TTTACTGTGATGATACACTGTGG - Intergenic
1079611938 11:22443820-22443842 TCATCTGTGATGTCATCCTCTGG + Intergenic
1079971005 11:27035125-27035147 GTTTCTGTGAAGTCCCCCAGTGG - Intergenic
1083384528 11:62297704-62297726 TTTTCTCTCATGGCTCCCTGAGG + Intronic
1083602196 11:63955672-63955694 TTCTCTCTGGTGTCACCCTGTGG + Exonic
1085996017 11:81914962-81914984 TTTTCTTTGACTTCACCCTAGGG + Intergenic
1087272102 11:96122166-96122188 TTTTCTGTGCTGTCGCCCCAGGG - Intronic
1088754266 11:112872659-112872681 TTTCCTGAGATTTCTCCCTGAGG - Intergenic
1090610485 11:128466602-128466624 TTCTCTGTGATGTCAGCATACGG + Intronic
1090709011 11:129369353-129369375 TTTAATGTGCTGTCACCCAGTGG + Intergenic
1091975662 12:4822675-4822697 GTTTCTGTGATGTCAGACTGTGG + Intronic
1092366316 12:7879984-7880006 TTTTTGGAGATGTCACTCTGAGG - Intronic
1092521119 12:9274307-9274329 TTTCCTGTGAAATCACCCCGTGG + Intergenic
1092573655 12:9754537-9754559 TTTCCTGAGATGCCACCCTGGGG + Intronic
1092848802 12:12608634-12608656 TTCTCTGTGATGTTCCCCAGGGG + Intergenic
1098500328 12:71184699-71184721 CATTCTGTGATCTCACTCTGTGG - Intronic
1098585374 12:72147379-72147401 TATTCTGCCTTGTCACCCTGGGG + Intronic
1099896224 12:88650801-88650823 TGTTCTGTGCTGTCACACTAAGG - Intergenic
1101116694 12:101538999-101539021 TTTTCAGTGATGTGCCCCTTAGG + Intergenic
1103272803 12:119687583-119687605 TTGGCTACGATGTCACCCTGGGG + Exonic
1104156162 12:126134996-126135018 TTTTCTTTCATGTCAACCTTGGG + Intergenic
1106572119 13:30936098-30936120 TTTTTTGTAGTGTCACCATGTGG + Intronic
1107021236 13:35754067-35754089 TTTTATTTGATGTTACCATGAGG + Intergenic
1107868290 13:44725069-44725091 TTTTCTCTCATGTTGCCCTGTGG + Intergenic
1109603902 13:64666570-64666592 TTTTCTGTGCTGTTACACTTGGG - Intergenic
1109648571 13:65293613-65293635 TTTGCTGTGATGTCTTCCTAGGG + Intergenic
1114143373 14:19943060-19943082 TTTTCTTTGTTGTTACTCTGGGG - Intergenic
1114834781 14:26191131-26191153 TGTTCTTTGATGTCATCCTAAGG + Intergenic
1119085752 14:71737386-71737408 TTCTCTGTGGTGTGCCCCTGAGG + Intronic
1122791949 14:104187713-104187735 TACGCAGTGATGTCACCCTGAGG - Intergenic
1124070699 15:26390632-26390654 TTTTCTGAGATCTCACTCTCAGG - Intergenic
1124843990 15:33272769-33272791 TTTGCTTTGATGTTACCATGAGG + Intergenic
1125120207 15:36147855-36147877 TTTTCTGTGTGGTTACCATGGGG - Intergenic
1127264067 15:57346995-57347017 TTTGCTGTGAAGTCGCCCAGGGG - Intergenic
1128759676 15:70207875-70207897 TTTTCTGTGATGTCAGCGTTTGG - Intergenic
1128854577 15:70997988-70998010 TTTTCTTAGTTGTTACCCTGGGG + Intronic
1131631436 15:94181099-94181121 TCTTCTGTAACATCACCCTGTGG - Intergenic
1132297219 15:100748459-100748481 TCTTCTCTGACGTCACCCTTTGG + Intergenic
1135606493 16:23829891-23829913 TTTTCTATGTTGTTACCATGGGG + Intergenic
1135952295 16:26926498-26926520 TTTTCTTTGTGGTTACCCTGGGG - Intergenic
1137649699 16:50109455-50109477 TTTGCTGTGGTGGCACACTGGGG - Intergenic
1140225297 16:73071855-73071877 TTCCCAGTGGTGTCACCCTGTGG - Intergenic
1140246655 16:73255984-73256006 TTCACAGTGATGACACCCTGAGG + Intergenic
1141995266 16:87633094-87633116 TATTTTGTGATGGCAGCCTGAGG - Intronic
1143548271 17:7613265-7613287 CATTCTTTGATTTCACCCTGGGG - Intronic
1144194821 17:12881221-12881243 TTTTCTGTGATGTCATTCAATGG + Intronic
1149501160 17:57153467-57153489 TTTTCTGGGTGGTAACCCTGAGG + Intergenic
1150503220 17:65671219-65671241 TTTTCTGTGATGTCACCCTGTGG - Intronic
1150655227 17:67034775-67034797 TTTTCTCTAGTGTTACCCTGAGG - Intergenic
1155061737 18:22234823-22234845 TCTTCTGTGCTGTCATTCTGAGG - Intergenic
1159410114 18:68061774-68061796 TTTTCTTTTATGTCTTCCTGGGG - Intergenic
1160565455 18:79784186-79784208 TCCTGTGTGATGTCATCCTGTGG - Intergenic
1164748902 19:30636535-30636557 CTTTCTGTGCTTCCACCCTGTGG - Intronic
1164903880 19:31951051-31951073 TTGTCTGTGATGTGGTCCTGTGG + Intergenic
1166291482 19:41866429-41866451 TTTCCAGTGATGTCACTCTCTGG + Intronic
1166993540 19:46707610-46707632 CATTCTGTGATGAGACCCTGTGG - Intronic
1167661787 19:50799580-50799602 TCTTCTGTGATGTCCCCCTTAGG - Intronic
924980684 2:217842-217864 TTGGCTCTGAAGTCACCCTGAGG + Intronic
926003460 2:9353063-9353085 TTTCCTGTGATGACTCTCTGGGG - Intronic
926225615 2:10964960-10964982 GTTTCTGTAATGTCACACTTGGG + Intergenic
927568640 2:24138312-24138334 TTTTCTGTGTTTTCCCCATGTGG + Intronic
928448379 2:31353739-31353761 TTTTCTGTGATGTTTGGCTGGGG - Intronic
931284118 2:60818397-60818419 TGTACTGTGACCTCACCCTGTGG + Intergenic
931368352 2:61639006-61639028 TATTCACTGATGTCACCTTGTGG - Intergenic
932920843 2:75913725-75913747 TTTTATTTGAGGTCACCATGAGG + Intergenic
935135970 2:100302215-100302237 TTTGCCTTAATGTCACCCTGTGG - Intronic
937341621 2:121094974-121094996 TATTCTGTTATGACATCCTGCGG + Intergenic
937793769 2:125992739-125992761 TTTGCTTTGAGGTCACCATGAGG + Intergenic
937920635 2:127127107-127127129 TCTTCTGTGCTCTCTCCCTGTGG - Intergenic
938140710 2:128792163-128792185 TCTCCTGCGATGTGACCCTGTGG - Intergenic
938200936 2:129372792-129372814 TTTATTGTGATATCACCATGGGG + Intergenic
938258171 2:129876807-129876829 TTTTCTCTCTTGCCACCCTGTGG + Intergenic
938725050 2:134100482-134100504 TTTACTCTGATGCCTCCCTGAGG - Intergenic
939784829 2:146495913-146495935 GATTCTGTGGTGTCACTCTGTGG - Intergenic
940960334 2:159778379-159778401 GTTTATGTAATGGCACCCTGAGG + Intronic
941213645 2:162676764-162676786 TTTTCTGTGAAGTTACACTGGGG - Intronic
941742453 2:169049394-169049416 TTTTATTTGAGGTTACCCTGAGG - Intergenic
942488986 2:176470859-176470881 TTTTCTGAGATGTCATGTTGGGG + Intergenic
944792557 2:203146402-203146424 TTTTCTATGATTTCACTATGAGG - Intronic
944836195 2:203582305-203582327 TTTTCTGTGATACTACCCAGAGG - Intergenic
945925742 2:215801845-215801867 TTTTCTGTGATGTCTTCGTTTGG - Intergenic
946334991 2:219030428-219030450 TTAGCTGTGATGGTACCCTGGGG - Intronic
947796794 2:232898231-232898253 TTTTCTGTGATGTGGCGCTGTGG - Intronic
1170981516 20:21218782-21218804 TTTTCTGTGATTTCATTTTGTGG + Intronic
1173043489 20:39488020-39488042 TTGTCTGATATTTCACCCTGAGG - Intergenic
1175189546 20:57202118-57202140 TGTCCTGTGGTGTCACCTTGGGG + Intronic
1175501995 20:59456974-59456996 TTCTCTGTGCTGTCAGCCCGCGG - Intergenic
1177606316 21:23382302-23382324 TTTTCTTAGATGTGATCCTGGGG - Intergenic
1177875212 21:26624420-26624442 TTTTCTTTGAGGTCACCAAGGGG - Intergenic
1178277259 21:31250228-31250250 TTTTCTATGAAGTCACTCAGAGG - Intronic
1179639994 21:42741306-42741328 TTTTCTGAGAAGACAGCCTGTGG + Intronic
1180178582 21:46105689-46105711 TTTTCTTTGTTGTTACCATGGGG - Intronic
1181416352 22:22762213-22762235 TTTCCAGTGGTGTCACCCTGAGG - Intronic
1182451160 22:30422707-30422729 TTTTCCCTGCTGCCACCCTGTGG - Exonic
1183357405 22:37367036-37367058 TATTCCCTGATATCACCCTGTGG - Intergenic
1184587349 22:45456993-45457015 TCTTCTGTGATGTTACAGTGAGG - Intergenic
949178489 3:1096760-1096782 TTTTCTCTGATGTCCCCCAAAGG + Intronic
950349353 3:12332572-12332594 TTTTATGTAATGCCACCCAGAGG + Intronic
950658740 3:14453426-14453448 TTTTTACTGATGCCACCCTGGGG - Intronic
950973914 3:17219812-17219834 TTTTCCTTGATGTCATCCTTTGG + Intronic
951357333 3:21683792-21683814 CTTTCCTTGCTGTCACCCTGGGG - Intronic
952193689 3:31050106-31050128 TTTTCTGTGAGATGAGCCTGTGG - Intergenic
952712526 3:36445746-36445768 TTTTCTGGGATGTCATTCTAAGG - Intronic
954191013 3:48960939-48960961 ATTTCTGTAAAGTCTCCCTGAGG - Intronic
955838817 3:63089430-63089452 TTTTTTGAGATGCCACTCTGCGG - Intergenic
956178710 3:66499275-66499297 TTTTCTGTGCTGTCAGGATGTGG - Intronic
957937963 3:86968682-86968704 GTCTTTGTGATGTCACACTGGGG + Exonic
958775003 3:98471758-98471780 TTTCCTGTGATGCCAGCCTCTGG - Intergenic
959634181 3:108543675-108543697 TTTGGTGTGATATCTCCCTGTGG + Intergenic
959965075 3:112345044-112345066 TTTTCTGCCATGTCACAATGAGG - Exonic
960142954 3:114168698-114168720 TGGTCTGTGATGACACCATGGGG + Intronic
961452331 3:127008021-127008043 ATGTCTGGGATGTCACCGTGTGG + Intronic
961986769 3:131142739-131142761 TTTTCTCTTCTGCCACCCTGTGG + Intronic
965524438 3:169701309-169701331 TTTTCTCTGCTATCACCCTAGGG + Intergenic
965859824 3:173135249-173135271 TTTGCTGTGGTATCAACCTGTGG - Intronic
967372800 3:188766835-188766857 TTTTCTGTTATGTTTACCTGTGG + Intronic
970000545 4:11361427-11361449 ATTTCTGTGAAGTTACACTGAGG + Intergenic
970287471 4:14533940-14533962 TTTTCAGGAATCTCACCCTGTGG + Intergenic
970434535 4:16020767-16020789 TATTCTGTCATGTCACACGGAGG + Intronic
972404757 4:38735063-38735085 TTTTGGATGAAGTCACCCTGTGG + Intergenic
972801125 4:42476597-42476619 TTTTTTTTAATCTCACCCTGTGG - Intronic
972901119 4:43684820-43684842 TTATTTGTGATGTCTCCTTGGGG + Intergenic
973638340 4:52880178-52880200 TTTTCGCTGTTGTCTCCCTGGGG + Intronic
973847707 4:54929723-54929745 TTTTCTATTCTGTCACCCTTTGG + Intergenic
974125436 4:57690823-57690845 TTATCTCTGATGTTACCCTTTGG + Intergenic
976952280 4:90848895-90848917 TTTTCTCTCCTGCCACCCTGTGG + Intronic
978065786 4:104399321-104399343 TTTTCTGTTAAGTCACCCAGTGG - Intergenic
979140347 4:117164513-117164535 TTTTCTGTGATCTGACCATGTGG - Intergenic
979879169 4:125932474-125932496 TTTTATTTGAGGTCACCATGAGG - Intergenic
983307152 4:166004796-166004818 TTCTCTATGATGTAAACCTGGGG + Intronic
984313038 4:178088308-178088330 TTTTCTGTGACTTTACCATGTGG - Intergenic
985141475 4:186844413-186844435 TTTTCTGTGCTGTGCCACTGTGG + Intergenic
985207773 4:187558854-187558876 TTTACTGTGATGCCAGCCTCTGG - Intergenic
986569340 5:9149026-9149048 TTTGTTTTGATGTCATCCTGTGG + Intronic
986952318 5:13103629-13103651 TCTTCTGTGATTTGACCATGTGG - Intergenic
987844371 5:23262838-23262860 TTTTCTGTCATCTCAGCCTTTGG + Intergenic
987950253 5:24665333-24665355 TCTTCTGTGATGTCACACTAAGG - Intergenic
991974575 5:72173629-72173651 TTTGTTGTGATGAAACCCTGTGG - Intronic
993550073 5:89262428-89262450 TTTTCTGTGAGGTTTCCATGAGG + Intergenic
994217628 5:97156897-97156919 TTTTATTTGATGTTACCATGAGG + Intronic
994971150 5:106739805-106739827 TCTTTTGTCATGTCAGCCTGTGG + Intergenic
995630038 5:114122963-114122985 TTTTCTGTAATGTAACCAGGAGG + Intergenic
996351251 5:122544434-122544456 TTCTCTGTGATTTCTCTCTGTGG - Intergenic
999032743 5:148312348-148312370 TTTCCTGTGAGGTCATCCAGAGG - Intergenic
1003224632 6:4192370-4192392 TTCTTTCTGAGGTCACCCTGTGG + Intergenic
1004027781 6:11836062-11836084 TGTTCTGTGTTGTCACCCACAGG - Intergenic
1004917431 6:20345056-20345078 TCTGCTGAGATGTCACCTTGGGG + Intergenic
1005086930 6:22016271-22016293 TGTTCTGTGTTGTCAGCCTCTGG + Intergenic
1005843533 6:29760236-29760258 TTTTCTGTGGGAGCACCCTGTGG + Intergenic
1006811081 6:36821077-36821099 TTAACTCAGATGTCACCCTGTGG - Intronic
1007071340 6:39040560-39040582 TCTTCTGGGCTGTCAGCCTGTGG + Intergenic
1009286746 6:61828002-61828024 TGTTCTGTGAGGTAACCCTGTGG + Intronic
1010110119 6:72217758-72217780 TTTTCGGTGATGTTAAGCTGTGG + Intronic
1010680108 6:78789156-78789178 TTTTCTGGGATGTCCCTCTCTGG - Intergenic
1011170447 6:84499070-84499092 TTCTCTGTGTTCTCACCATGTGG - Intergenic
1011255823 6:85419820-85419842 TCTTCTGTGTGGTGACCCTGTGG - Intergenic
1015257437 6:131195209-131195231 TTTGCTTTGAGGTTACCCTGAGG + Intronic
1015861121 6:137681107-137681129 TTGACTGTGATTTCTCCCTGAGG - Intergenic
1016028526 6:139313692-139313714 TTTTTTTTTAAGTCACCCTGTGG + Intergenic
1016703263 6:147077649-147077671 TTCCCTGAGATGTCTCCCTGGGG - Intergenic
1017328358 6:153166572-153166594 TTTTCTGAAAAGTCACACTGGGG - Intergenic
1017562285 6:155641368-155641390 CTTTCTTAGTTGTCACCCTGGGG + Intergenic
1018290898 6:162291728-162291750 TTTCCTTTCATGTTACCCTGAGG + Intronic
1018365331 6:163114386-163114408 TTTTCTTTGTGGTCACCCTAAGG - Intronic
1018491957 6:164303058-164303080 TGTTCTGTGATGTCCTCCTTGGG + Intergenic
1022520699 7:31005191-31005213 TTTTCATGGATGCCACCCTGGGG - Intergenic
1022895661 7:34748416-34748438 CTTTCTGTCTGGTCACCCTGGGG - Intronic
1025281410 7:57628362-57628384 TGGTCTCTGATGTCAACCTGGGG - Intergenic
1025303319 7:57837145-57837167 TGGTCTCTGATGTCAACCTGGGG + Intergenic
1026665887 7:72339429-72339451 TTTTCTGTGTTTTCATGCTGGGG - Intronic
1028675994 7:93461164-93461186 TATTTTATGAAGTCACCCTGAGG - Intronic
1029106922 7:98185044-98185066 TTTTCAGTGATTTAGCCCTGCGG + Exonic
1029694130 7:102202000-102202022 TGTTCTGTGGTGTCTCGCTGCGG - Exonic
1030084380 7:105804172-105804194 TTTTCTGGGAAGACACCCTGAGG - Intronic
1030875423 7:114807572-114807594 TTTTCTGTCCTGTCCCCCTAGGG - Intergenic
1031199278 7:118658940-118658962 TTCTCAGTGCTGTCACACTGTGG - Intergenic
1031414594 7:121480334-121480356 TTCTCTGTGCTGCTACCCTGAGG - Intergenic
1031798599 7:126212320-126212342 TTTTCTTTGATTTCACTCTCGGG + Intergenic
1033599814 7:142881088-142881110 CTTTCTGTGCTGTCCCCTTGTGG - Intronic
1034257501 7:149732741-149732763 TTTTTTGTGGGGTGACCCTGGGG - Intronic
1034882507 7:154773220-154773242 TTTCCTCTGGTGTCCCCCTGAGG - Intronic
1035665048 8:1374587-1374609 CTTCCTGTGATGTAACCATGTGG + Intergenic
1036757386 8:11480378-11480400 TTTTGTGTGATCTCAACCTCAGG + Intergenic
1037369587 8:18161722-18161744 TGTGCTGTGGTATCACCCTGTGG - Intergenic
1038306970 8:26413702-26413724 TGTCCTGGGCTGTCACCCTGAGG + Intronic
1038839701 8:31172000-31172022 TTCTCTGTCATGTTATCCTGAGG + Intronic
1044297489 8:90545651-90545673 TTTTCTTTGACGACACCCTAAGG - Intergenic
1045304712 8:100949912-100949934 TATTCTGTGGTGTCACTGTGTGG - Intronic
1047218112 8:122895516-122895538 GTCTCTGTGCTCTCACCCTGTGG + Intronic
1049802363 8:144523876-144523898 AATTCTGTTAAGTCACCCTGTGG + Exonic
1050301467 9:4262989-4263011 TATTCTCTGAAGGCACCCTGGGG - Intronic
1051603933 9:18901630-18901652 TTTTCTTTGTTGTTACCATGGGG - Intronic
1053442299 9:38126480-38126502 CATTCTGTGATGTCACCCACTGG + Intergenic
1053449068 9:38178349-38178371 TTTTCTGGGATCTCATCCTCAGG - Intergenic
1053836369 9:42140178-42140200 TTTTCTTTAATGTCTCCGTGGGG - Intergenic
1058603175 9:106693138-106693160 TTTTAAGTGAGGTCACCCTAAGG - Intergenic
1061544083 9:131293821-131293843 ATTGCAGTGATGTCACCGTGTGG - Intronic
1062619209 9:137411898-137411920 TTTTCTGTGGTGTTTCCCTGAGG + Intronic
1185550271 X:977529-977551 TTTTCTGTGGTTTCACGATGCGG - Intergenic
1187024068 X:15414937-15414959 TTTTCTGTTATGTCACCTTTAGG - Intronic
1189676644 X:43467750-43467772 GTTCCTGTGTTGGCACCCTGAGG - Intergenic
1190149798 X:47935960-47935982 TTTTCTGATATTCCACCCTGAGG - Intronic
1190691404 X:52916176-52916198 AGTTCTGTTGTGTCACCCTGTGG - Intergenic
1190694579 X:52939616-52939638 AGTTCTGTTGTGTCACCCTGTGG + Intronic
1191179365 X:57543143-57543165 TTTTATTTGAAGTCACCATGAGG - Intergenic
1191745750 X:64484687-64484709 TTTTGTTTGAGGTTACCCTGAGG + Intergenic
1191972371 X:66831332-66831354 TTTTCTTTGAGGTTACCATGAGG + Intergenic
1192241866 X:69337787-69337809 TTTTCTTAGTAGTCACCCTGGGG + Intergenic
1194026821 X:88763279-88763301 TTTTCTTTCATGTCAACCTTGGG + Intergenic
1194144803 X:90248510-90248532 TTTTCTTTAATTTCACCCTTGGG - Intergenic
1195851863 X:109292291-109292313 TTTTCTTTGAGGTGACCATGAGG + Intergenic
1196106551 X:111902582-111902604 TTTACTGTAATGCTACCCTGGGG - Intronic
1196248307 X:113427659-113427681 TTTTCTCCCATATCACCCTGTGG - Intergenic
1197268665 X:124402780-124402802 TTTTCTGTGATGAGTCCATGAGG + Intronic
1197570201 X:128141344-128141366 AATTCTGTGGTGTCACACTGTGG - Intergenic
1198765311 X:140074293-140074315 TTTTCTAAGATGTTACCCTTTGG + Intergenic
1198771670 X:140137495-140137517 TTTTCTAAGATGTTACCCTTTGG + Intergenic
1199037255 X:143066074-143066096 TTTGATTTGATGTCACCATGAGG - Intergenic
1199739341 X:150718509-150718531 TGTTCTGTGATGTCACTATAAGG - Intronic
1200490561 Y:3817814-3817836 TTTTCTTTAATTTCACCCTTGGG - Intergenic
1200742491 Y:6869197-6869219 TTTCCTTTGATGTCACAATGGGG + Intronic
1201356274 Y:13099967-13099989 TTGTCTGATATGCCACCCTGAGG + Intergenic
1202196773 Y:22305895-22305917 TTTCCTATGATGTCCCACTGTGG + Intergenic