ID: 1150503221

View in Genome Browser
Species Human (GRCh38)
Location 17:65671247-65671269
Sequence GAGCTCTTAAAGTGTAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150503221_1150503228 -3 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 96
1150503221_1150503233 13 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503233 17:65671283-65671305 TGGGAGGTAGCATCCATAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
1150503221_1150503226 -7 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503226 17:65671263-65671285 AGAGCTCCCGAAGGGGAAATTGG 0: 1
1: 0
2: 1
3: 6
4: 92
1150503221_1150503227 -6 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503227 17:65671264-65671286 GAGCTCCCGAAGGGGAAATTGGG 0: 1
1: 0
2: 1
3: 5
4: 95
1150503221_1150503232 12 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503232 17:65671282-65671304 TTGGGAGGTAGCATCCATAAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1150503221_1150503231 11 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503231 17:65671281-65671303 ATTGGGAGGTAGCATCCATAAGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150503221 Original CRISPR GAGCTCTTAAAGTGTAGTCA GGG (reversed) Intronic
905006180 1:34712248-34712270 GAGCTCTCAAACTGCAGTCCTGG + Intergenic
910381539 1:86632137-86632159 GAGCTCTTATAGGGTAGGCCCGG + Intergenic
914440577 1:147702238-147702260 GAGCTCCCAAAGCGTGGTCATGG - Intergenic
916645718 1:166783321-166783343 GAGCTCTTATAATGCAGGCATGG + Intergenic
917544299 1:175947254-175947276 GAGCTTTTAAAGTATAGAGAAGG + Intronic
919447723 1:197730042-197730064 TGGCTCTCAAAGTGTAGTCTAGG - Intronic
920449610 1:206049543-206049565 CAGTTCTCAAAGTGTAGTCCAGG - Intronic
923345983 1:233053076-233053098 AATCTCTTAAAGTGTAGAGAGGG + Intronic
923533894 1:234833502-234833524 CAGCTCTTGATGTGAAGTCATGG + Intergenic
923940325 1:238816390-238816412 GAGGGCTTAGAGTTTAGTCAGGG + Intergenic
1063974807 10:11406688-11406710 GACCTCATAATGTGCAGTCAGGG - Intergenic
1069289468 10:66759715-66759737 GAGCACTTAAAATGTGGCCAGGG + Intronic
1069417639 10:68215092-68215114 GAGCTTTTAATGTGCAGGCAAGG - Intergenic
1071131419 10:82397975-82397997 GAGCACTTACAGTGTATGCAAGG + Intronic
1074878948 10:117636648-117636670 GAGCTCCAACAGTGTGGTCATGG - Intergenic
1076252264 10:128994149-128994171 GAGCTCTTGAAGAGTATTGACGG + Intergenic
1078193943 11:9119202-9119224 TAGCTCTCAAAGTGTTGTCCCGG + Intronic
1081457139 11:43234961-43234983 GTGCTCTTAAACTGTTGTCTGGG - Intergenic
1081815928 11:45941569-45941591 CAGTTCTCAAAGTGTAGTCTGGG - Intronic
1082317439 11:50747157-50747179 GAGCTCTTTAAGGGCAGGCATGG + Intergenic
1089285853 11:117407705-117407727 GAGTTTTTAAGGTGTAGGCATGG + Intronic
1092897313 12:13025065-13025087 GAAATCTTAAATTGTATTCAGGG - Intergenic
1103760217 12:123244063-123244085 AACCTCATAAACTGTAGTCATGG - Intronic
1105335222 13:19460892-19460914 GAGATCCTAAATTATAGTCAGGG - Intronic
1105859697 13:24398494-24398516 GAGATCCTAAATTATAGTCAGGG + Intergenic
1106363269 13:29051768-29051790 GAACACTTTAAGTGGAGTCATGG + Intronic
1106698249 13:32201421-32201443 GAGGGCTTACAGTTTAGTCATGG - Intronic
1110080923 13:71310023-71310045 GAGCACTTTATGTGGAGTCAAGG + Intergenic
1110308709 13:74021595-74021617 AAGCTACTGAAGTGTAGTCATGG - Intronic
1112731084 13:102363491-102363513 GTGCTCTAAAAATGTAGGCATGG + Intronic
1114825197 14:26069027-26069049 AAGCTCTCAAAGTATAGTCAGGG - Intergenic
1115813898 14:37142011-37142033 GTGATCCTAAAGTGTAGTCAAGG + Intronic
1115857085 14:37642107-37642129 GAGATCTGAAAGAGAAGTCAAGG - Intronic
1117405397 14:55397235-55397257 AACCTCTTAAAGTGTAGGAAAGG - Intronic
1118742551 14:68750461-68750483 GAGCTCTGGGAGTGTATTCAAGG - Intergenic
1119767195 14:77197751-77197773 AAGCCCTTAAAGTGAAGTTAGGG - Intronic
1121360576 14:93254606-93254628 GAGCCCTTAAAGTGAAGCCCAGG - Intronic
1121518294 14:94568500-94568522 GAGCTCTCCCAGTCTAGTCAGGG + Intronic
1130433849 15:83876132-83876154 TAGCTCTTCAAATGTAATCATGG + Intronic
1133152670 16:3848327-3848349 AAGCTCTTGAAGTGCAGTCCAGG + Intronic
1137645287 16:50067864-50067886 GAAATCTTAAAGTGTATTGAGGG + Intronic
1138940517 16:61783904-61783926 GAGCTCTTATAGGGCAGTCCTGG - Intronic
1141287291 16:82684293-82684315 GGGCCCTTAAAGGGTAATCAAGG - Intronic
1141718134 16:85738811-85738833 GAGCCCTTTATGTGTATTCATGG + Intronic
1146974060 17:37096086-37096108 CAGCTCTTTAGTTGTAGTCATGG + Intronic
1149222323 17:54429326-54429348 GAGCTCTCAAAGGGCAGACAGGG - Intergenic
1150487407 17:65553427-65553449 TAGCTCTTACAGTGGAGACATGG - Intronic
1150503221 17:65671247-65671269 GAGCTCTTAAAGTGTAGTCAGGG - Intronic
1156294184 18:35774814-35774836 GAGCTCTGAAAGAGGAGTCCCGG - Intergenic
1159882402 18:73870948-73870970 GAGCACATAAAGTGTATTCATGG + Intergenic
1161132695 19:2600844-2600866 GAGTTCTCAAAGTGTGGTCCAGG - Intronic
1167256785 19:48435261-48435283 GGGCACTTAAAGGGTAGACAAGG - Intronic
929488154 2:42373070-42373092 GAGCTGATAAGGTGCAGTCAGGG - Intronic
930792319 2:55347265-55347287 TAGTTCTTAAAGTGTAATCCAGG + Intronic
930842036 2:55857763-55857785 TAGATCTTAAAGGGAAGTCAAGG + Intergenic
932465939 2:71924201-71924223 GAGCTCTTAGCGTGTATTCCAGG + Intergenic
935702845 2:105827391-105827413 GAGATCTTCAAGTATAATCATGG - Intronic
937335801 2:121061772-121061794 GAGTTCTTGAAGTGTGTTCACGG - Intergenic
941529081 2:166642226-166642248 GAGCCCTTAAAATCTACTCATGG - Intergenic
942082006 2:172409107-172409129 GAGCTTTTAAACATTAGTCAAGG + Intergenic
942403195 2:175625103-175625125 CACCTATTAAAGTGAAGTCAAGG + Intergenic
945440938 2:209878875-209878897 CAACTCTTAACATGTAGTCAGGG - Intronic
1168912462 20:1460244-1460266 CAGTTCTCAAAGTGTGGTCATGG + Intronic
1181744988 22:24950076-24950098 GAGCACTTAAAATGAGGTCAGGG - Intergenic
1184231159 22:43159192-43159214 GAGCTCTGAAAGAGAAGACAGGG - Exonic
950941423 3:16896940-16896962 GAGATTTTAAAGTATAGCCAGGG + Intronic
952368264 3:32694220-32694242 GATCCCTGAAAGTGTAGTCTTGG + Intronic
953158510 3:40396562-40396584 GAACTATTAAAATGCAGTCAAGG + Intronic
957524638 3:81363970-81363992 AAGCTCTTAAAGTGTTGCAATGG + Intergenic
957812223 3:85238532-85238554 GAGCTCTTTGAGTGTAGGGAAGG + Intronic
958200701 3:90311252-90311274 GAGCTCTTTTAGGGTAGTCCTGG + Intergenic
959176010 3:102911667-102911689 GTGCTCTTAGAGTGGAGGCAAGG - Intergenic
959235793 3:103719745-103719767 GAGATCTGAAAGTTTTGTCAGGG - Intergenic
966681693 3:182648362-182648384 GTGTTATTGAAGTGTAGTCATGG - Intergenic
966990276 3:185222767-185222789 GGGTTCTTAAAGTGTGGTCCAGG - Intronic
967905838 3:194499135-194499157 GAGCTATTTAAGTGTATTTAAGG - Intergenic
969410067 4:7022225-7022247 GAGCTCTTGGAGTGGAGTCCAGG + Intronic
969430566 4:7151467-7151489 GACCTCTGAGAGTGTAGTGAAGG - Intergenic
970287145 4:14530709-14530731 TAGCTCTTAAAGAGAAGTCAAGG + Intergenic
973952211 4:56027599-56027621 TAGTTCTTAAAGTGCAGTCTGGG - Intronic
974800339 4:66809352-66809374 TAGTTCTTAAAGTGTGGTCTAGG - Intergenic
974970621 4:68821986-68822008 GAGCTATTACATTGTAGTCAGGG - Intronic
974985169 4:69014413-69014435 GAACTATTACATTGTAGTCAGGG + Intronic
974986632 4:69035062-69035084 GAGCTATTACATAGTAGTCAGGG - Intronic
974991849 4:69102518-69102540 GAGCTATTACATTGTTGTCAGGG - Intronic
974999807 4:69208739-69208761 GAGCTATTACATTGTAGTCAGGG + Intronic
975005961 4:69286471-69286493 GAGCTATTACATTGTAGTCAGGG - Intronic
975014380 4:69395412-69395434 GAGCTATTACATTGTAGTCAGGG - Intronic
976920357 4:90433420-90433442 TAGTTCTTAAAGTATGGTCAAGG + Intronic
978128465 4:105164060-105164082 GAGCTACTCAAATGTAGTCAAGG + Intronic
978134527 4:105241240-105241262 GAGCCCTTAATGTGTAGTTGGGG + Intronic
980404332 4:132337176-132337198 AAGCTCTAAAAGTGTGGTTATGG + Intergenic
980947796 4:139339964-139339986 AAGATCTTAAAGTCTAGTAAAGG - Intronic
980950197 4:139367937-139367959 GAGCCCTTAAAATGAAGTGAAGG - Intronic
982467133 4:155745187-155745209 GAGATCTTCAAGTGTCTTCAAGG + Intergenic
983925864 4:173401378-173401400 TAGCTCTTAAAGTGGAATAAAGG - Intronic
986530625 5:8732809-8732831 GAGCTCTTTTAGTGCAGTCCTGG - Intergenic
987791510 5:22574768-22574790 AAGCACTTCAAGTATAGTCATGG - Intronic
988463037 5:31458715-31458737 GAGCACTCAAAGTGTGGTGAGGG + Intronic
988692991 5:33591534-33591556 GAGTGCTTATACTGTAGTCATGG - Intronic
990138005 5:52670572-52670594 GATCTATTAAAGTGTGGTCTAGG - Intergenic
991173146 5:63652389-63652411 GAGATGTGAAAGTGGAGTCATGG + Intergenic
991550809 5:67833876-67833898 GTGCTCTGAAAGTGAAGTCTTGG - Intergenic
992275012 5:75106297-75106319 CAGCTCTTAAACTGTGGTCCAGG - Intronic
993704249 5:91151742-91151764 GAGCACTTAAAATGTGGTGAGGG - Intronic
999765913 5:154740770-154740792 GAGCACTTCAAGTGGAATCATGG + Intronic
1001412734 5:171522310-171522332 GAGCTATAAAAATGTACTCAAGG + Intergenic
1003004112 6:2364807-2364829 GCTCTCTTAAAGTGTTTTCATGG - Intergenic
1003244665 6:4373769-4373791 AACCTCTGAAAGTGTAGTGACGG - Intergenic
1007112540 6:39321227-39321249 CAGTTCTCAAAGTGTAGTCCCGG - Intronic
1009564120 6:65288911-65288933 AAGCACTTAAAGAGTAGTAAAGG + Intronic
1010018030 6:71127085-71127107 GATCCCTGAAAGTGTAGTCTTGG + Intergenic
1013867223 6:114713261-114713283 GGGCTCTTTTAGGGTAGTCAAGG + Intergenic
1016396081 6:143624850-143624872 GAGCTGATAAAGTATAGTCAAGG + Intronic
1028550514 7:92057050-92057072 GGGCTTTTAAAGTTTAGTCAGGG + Intronic
1029048161 7:97653502-97653524 GAGCTCTTAGAGTTTGGTGAGGG - Intergenic
1033875732 7:145816331-145816353 GAGCACTTGAAGTGCAGTTAGGG + Intergenic
1038530094 8:28311694-28311716 GGGCTCTTAAGGTGTAGCCATGG + Intergenic
1038695949 8:29806293-29806315 AAGCTTTGAAAGTGTATTCATGG - Intergenic
1040638755 8:49306404-49306426 GAGCTCCTCAAGTGTGGTCAGGG - Intergenic
1040695685 8:49994875-49994897 CAGATCTTAAAATGTAGTAAAGG + Intronic
1041189143 8:55335863-55335885 GAACTGTCAAAGTGTAGTGATGG + Intronic
1041362037 8:57064850-57064872 GAGCTCTTTCAGGGTAGTCTTGG + Intergenic
1041418884 8:57645160-57645182 GAGCTCTTATAAGGTAGGCATGG + Intergenic
1042398062 8:68314048-68314070 GAGGTCCAAAAGTTTAGTCAAGG + Intronic
1043163743 8:76877367-76877389 AAAGTCTTAAAGTGAAGTCAAGG - Intergenic
1043176585 8:77029147-77029169 GCCCTCTTCAAGTGTGGTCATGG - Intergenic
1050043423 9:1519366-1519388 AAGCTCTTAGACTGTAGTGAAGG + Intergenic
1051264640 9:15298887-15298909 GAGCTCTTGAAGTGTCTTCCAGG - Intronic
1056188642 9:84163137-84163159 AGGCTCTCAAAGTGTGGTCAGGG + Intergenic
1059043811 9:110842783-110842805 GAGCTCTGACAGTGTAAACAAGG + Intergenic
1059637275 9:116183349-116183371 GAGCTCTTAAATTCTAGCAAGGG + Intronic
1060463734 9:123883563-123883585 TAGTTCTTAAAGTATGGTCACGG - Intronic
1060858595 9:126935216-126935238 AAGAGCTTAAAGTCTAGTCAAGG - Intronic
1188084609 X:25888046-25888068 CAGTTCTCAAAGTGTAGTCTGGG - Intergenic
1189012634 X:37061811-37061833 AAGGTGTTAAAGTGCAGTCATGG + Intergenic
1195056415 X:101149963-101149985 GAGGTTTTGAAATGTAGTCAAGG + Intronic
1195530051 X:105943838-105943860 GTGCTCTTAAATTGTGGTTATGG + Intronic
1197641552 X:128973693-128973715 GGGAGCTTACAGTGTAGTCATGG - Intergenic
1198775887 X:140178597-140178619 GAGCTCTTAAATAGTAGCAAAGG + Intergenic
1199274384 X:145924431-145924453 GAGCTTATAATGTATAGTCATGG - Intergenic
1202596602 Y:26547392-26547414 GAGATCCTAAATTATAGTCAGGG + Intergenic