ID: 1150503222

View in Genome Browser
Species Human (GRCh38)
Location 17:65671248-65671270
Sequence GGAGCTCTTAAAGTGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150503222_1150503232 11 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503232 17:65671282-65671304 TTGGGAGGTAGCATCCATAAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1150503222_1150503226 -8 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503226 17:65671263-65671285 AGAGCTCCCGAAGGGGAAATTGG 0: 1
1: 0
2: 1
3: 6
4: 92
1150503222_1150503233 12 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503233 17:65671283-65671305 TGGGAGGTAGCATCCATAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
1150503222_1150503227 -7 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503227 17:65671264-65671286 GAGCTCCCGAAGGGGAAATTGGG 0: 1
1: 0
2: 1
3: 5
4: 95
1150503222_1150503228 -4 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 96
1150503222_1150503231 10 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503231 17:65671281-65671303 ATTGGGAGGTAGCATCCATAAGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150503222 Original CRISPR GGAGCTCTTAAAGTGTAGTC AGG (reversed) Intronic
909306473 1:74086065-74086087 GGAGCTATTTAAGTGTCTTCAGG + Intronic
910754992 1:90679974-90679996 TGAGTTTTTAAAGTGTATTCTGG - Intergenic
922597458 1:226824944-226824966 GAACCTCTTAAAGTGTAATATGG + Intergenic
922918379 1:229277821-229277843 GAAGCTCTTACAGTGAAGACTGG - Intronic
923940324 1:238816389-238816411 GGAGGGCTTAGAGTTTAGTCAGG + Intergenic
1063974808 10:11406689-11406711 GGACCTCATAATGTGCAGTCAGG - Intergenic
1067550257 10:47229406-47229428 GGAGCTCTCAAAAAGTAGCCAGG + Intergenic
1067825402 10:49568729-49568751 GGAACTATTGAAGTGCAGTCTGG - Intergenic
1068047277 10:51902937-51902959 GGAGTTCTCAAAATGTGGTCTGG - Intronic
1070625470 10:78047932-78047954 AGAGATCTTAAAGTGTGGTGGGG - Intronic
1071776415 10:88793064-88793086 GGAGCACTTAGAGGGGAGTCAGG - Intergenic
1077697182 11:4404971-4404993 GGAGCTCTTTTAGAGCAGTCCGG + Intergenic
1081457140 11:43234962-43234984 TGTGCTCTTAAACTGTTGTCTGG - Intergenic
1081815929 11:45941570-45941592 GCAGTTCTCAAAGTGTAGTCTGG - Intronic
1087324056 11:96699420-96699442 GAATCTCTTAAAGAGCAGTCTGG - Intergenic
1088988731 11:114932005-114932027 GGAGCTCATGATGTGTAGCCTGG + Intergenic
1091822930 12:3490329-3490351 GAAGCTCTCAAAGTGAAGACAGG + Intronic
1097212835 12:57385786-57385808 GCAGCTCTCAAAGTGTGGCCTGG + Intronic
1098359004 12:69637102-69637124 GGAGTTTTTAAAGTGTAGGCTGG + Intergenic
1104027592 12:125039750-125039772 GTAGTTCTCAAAGTGTGGTCTGG + Intergenic
1107403329 13:40090425-40090447 GGAGCTCATCCAGTGAAGTCAGG + Intergenic
1113555559 13:111231327-111231349 GTAGCTCTTACAGTGTAGAAGGG + Intronic
1114825198 14:26069028-26069050 GAAGCTCTCAAAGTATAGTCAGG - Intergenic
1117836908 14:59817184-59817206 GGACCTCTTATAGTCTAGTGGGG + Intronic
1121964665 14:98293033-98293055 GGAGCTCTTAAACTCCACTCTGG + Intergenic
1122445942 14:101768750-101768772 GGGGTTCTCAAAGTGTGGTCTGG - Intronic
1134823782 16:17267985-17268007 GTGGTTCTTAAAGTGTGGTCTGG + Intronic
1136543971 16:30945304-30945326 GTGGTTCTTAAAGTGTGGTCGGG + Intronic
1137891416 16:52166593-52166615 GGAGGTTTTAACTTGTAGTCTGG - Intergenic
1150503222 17:65671248-65671270 GGAGCTCTTAAAGTGTAGTCAGG - Intronic
1153261569 18:3229259-3229281 GGAGCTTTGAAACTGTACTCAGG + Intergenic
1153789478 18:8564679-8564701 GGAGCTTTTAAACTGTAGAGTGG - Intergenic
1156194179 18:34754556-34754578 GGGGCACTCAAAGTGTAGTAGGG + Intronic
1156775479 18:40782744-40782766 TCAGCTCTTAAAATGTAGTGGGG - Intergenic
1158647898 18:59264198-59264220 GGAGCTCTTGGAATGTAGGCTGG + Intergenic
926256142 2:11202174-11202196 GCAGCTCTCAAAGTATGGTCTGG + Intronic
935201978 2:100865170-100865192 GCAGTTCTCAAAGTGTGGTCTGG - Intronic
943330424 2:186552246-186552268 GGGGCTCTTAAAGTGTAGCAAGG - Intergenic
946028500 2:216687236-216687258 GGAGCTCTCTAAGTGGAGACGGG - Intronic
1173916807 20:46714140-46714162 GGGGCTCATACAGTGTTGTCAGG + Intronic
1177185371 21:17787635-17787657 GGAGCACTTCATTTGTAGTCTGG + Intergenic
1184231160 22:43159193-43159215 GGAGCTCTGAAAGAGAAGACAGG - Exonic
949221074 3:1634579-1634601 GGTTCTCTTGAAGTGTAGTGGGG - Intergenic
950941422 3:16896939-16896961 GGAGATTTTAAAGTATAGCCAGG + Intronic
958130634 3:89417018-89417040 GAAACTCTTAAAGGGTAGTTAGG + Intronic
959852037 3:111098818-111098840 GGGAAACTTAAAGTGTAGTCAGG - Intronic
961996680 3:131252783-131252805 ATAGTTCTTAAAGTGCAGTCTGG - Intronic
963178003 3:142322132-142322154 GTAGGTCTCAAAGTGCAGTCTGG + Intronic
973952212 4:56027600-56027622 GTAGTTCTTAAAGTGCAGTCTGG - Intronic
974970622 4:68821987-68822009 GGAGCTATTACATTGTAGTCAGG - Intronic
974985168 4:69014412-69014434 GGAACTATTACATTGTAGTCAGG + Intronic
974986633 4:69035063-69035085 GGAGCTATTACATAGTAGTCAGG - Intronic
974991850 4:69102519-69102541 GGAGCTATTACATTGTTGTCAGG - Intronic
974999806 4:69208738-69208760 GGAGCTATTACATTGTAGTCAGG + Intronic
975005962 4:69286472-69286494 GGAGCTATTACATTGTAGTCAGG - Intronic
975014381 4:69395413-69395435 GGAGCTATTACATTGTAGTCAGG - Intronic
978134526 4:105241239-105241261 AGAGCCCTTAATGTGTAGTTGGG + Intronic
981042921 4:140239412-140239434 TGAGCTTCTAAAGTGTAGCCAGG - Intergenic
981226092 4:142296120-142296142 GGAACTATTGAAGTGTACTCTGG + Intronic
997594927 5:135100792-135100814 GGGGCACTGAAAGTGCAGTCAGG - Intronic
1000286455 5:159830577-159830599 GCAGTTCTCAAAGTGTAGACTGG - Intergenic
1000529831 5:162406075-162406097 ACAGCTTTCAAAGTGTAGTCTGG - Intergenic
1005930552 6:30481156-30481178 GAACCTCTTAAAGTTGAGTCTGG + Intergenic
1010287474 6:74095964-74095986 GGAGCTCATGAAGAGAAGTCAGG - Intergenic
1012750872 6:103162114-103162136 GAAGTTCTTAAAATGTAGTTTGG - Intergenic
1014526859 6:122511327-122511349 GCAGCTCTTGAAGTGTGGTGGGG - Intronic
1017115280 6:150970167-150970189 GGAGCTTCTCAAGTGCAGTCAGG - Intronic
1018147872 6:160910279-160910301 GCAGTTCTCAAAGTGTGGTCTGG + Intergenic
1021021378 7:15602328-15602350 GGTGCTGTTAAAGTGAAATCAGG - Intergenic
1021140290 7:17016027-17016049 GGAGCTCAAAAGGTGTGGTCTGG + Intergenic
1028550513 7:92057049-92057071 TGGGCTTTTAAAGTTTAGTCAGG + Intronic
1033108469 7:138553743-138553765 GCAGTTCTCAAAGTATAGTCTGG + Intronic
1035304827 7:157925107-157925129 GCAGTTATTGAAGTGTAGTCAGG + Intronic
1040281600 8:46053926-46053948 GGAGATTTGAAAGTGTAGTGAGG + Intergenic
1040638756 8:49306405-49306427 AGAGCTCCTCAAGTGTGGTCAGG - Intergenic
1047955943 8:129975576-129975598 GGTGCTCTTAACTTGTAGCCTGG - Intronic
1055598267 9:77887945-77887967 GTAGTTCTCAAAGTGTAATCGGG + Intronic
1056188641 9:84163136-84163158 GAGGCTCTCAAAGTGTGGTCAGG + Intergenic
1059170258 9:112117998-112118020 GGACTTCTGAAAGAGTAGTCTGG - Intronic
1185567526 X:1107343-1107365 GTAGCTCTTGGAGTGGAGTCGGG - Intergenic
1188084610 X:25888047-25888069 TCAGTTCTCAAAGTGTAGTCTGG - Intergenic
1198774151 X:140161878-140161900 GGAGTTCTGAAAGTTTAGTGAGG - Intergenic
1202138526 Y:21695807-21695829 GCATTTCTTAAAGGGTAGTCCGG - Intergenic