ID: 1150503228

View in Genome Browser
Species Human (GRCh38)
Location 17:65671267-65671289
Sequence CTCCCGAAGGGGAAATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150503220_1150503228 25 Left 1150503220 17:65671219-65671241 CCACAGGGTGACATCACAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 96
1150503222_1150503228 -4 Left 1150503222 17:65671248-65671270 CCTGACTACACTTTAAGAGCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 96
1150503221_1150503228 -3 Left 1150503221 17:65671247-65671269 CCCTGACTACACTTTAAGAGCTC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150503228 Original CRISPR CTCCCGAAGGGGAAATTGGG AGG Intronic
903392826 1:22976733-22976755 CTCCCTATGGGGATATTGTGGGG - Intergenic
904163055 1:28535398-28535420 CTCCAGCAGGGCAAATTGGCAGG + Intronic
906066224 1:42982444-42982466 CTCCTGAGGAGCAAATTGGGAGG - Intergenic
906821431 1:48934413-48934435 CTCTCTAAAGTGAAATTGGGAGG + Intronic
907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG + Intronic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
915212312 1:154319498-154319520 CTCCCAAGGGGGAATCTGGGTGG + Intergenic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915738265 1:158098338-158098360 CTTCTGTAGGGGAAAATGGGAGG + Intronic
1065708044 10:28489278-28489300 TTCCTGAAGGGGAACCTGGGTGG - Intergenic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1069174342 10:65271554-65271576 CACCCCAAGGGAAAAATGGGGGG - Intergenic
1070568793 10:77625014-77625036 CTCCTGGAGGGGGAATTTGGAGG + Intronic
1071027481 10:81132619-81132641 CTCCCCAAGGGTCAAATGGGGGG + Intergenic
1074284302 10:112083513-112083535 CTGCAGAAGAGGAAAATGGGAGG - Intergenic
1081680319 11:44998021-44998043 CTCCCAAAGGGCAGATTGGAAGG - Intergenic
1087468392 11:98540104-98540126 CTCCCCAAGGGGAAATATCGTGG + Intergenic
1088051956 11:105527403-105527425 CACAAGAGGGGGAAATTGGGAGG - Intergenic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1099365144 12:81758953-81758975 CTCCAGGAGGGGAGACTGGGTGG - Intronic
1102644205 12:114393338-114393360 CTCTGGAAGGGCAAAGTGGGAGG - Intronic
1103159529 12:118717005-118717027 TTCACAAAGGGGAAATTGTGAGG + Intergenic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1108377407 13:49826347-49826369 CTCATGAAGGGGAATTTGTGAGG + Intergenic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1109456851 13:62604063-62604085 CTCCCCAGGGAGAAACTGGGAGG + Intergenic
1113711843 13:112470265-112470287 CACCTGCAGGGGAAATGGGGAGG - Intergenic
1116006522 14:39297462-39297484 CTCCCAAATGGGAAATGTGGAGG - Intronic
1116283374 14:42939486-42939508 CTCCAGAAGGGAATTTTGGGAGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124969203 15:34468306-34468328 CTCCCAAAGTGGCAATTGGCTGG - Intergenic
1126205299 15:46038500-46038522 CTCCCTATGGGGAAAATGGGTGG - Intergenic
1127902914 15:63354470-63354492 CTCCCCAAGGGGAGATTTGGGGG - Intronic
1129390087 15:75216037-75216059 CTCCAGAAGGGGACCCTGGGGGG - Intergenic
1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG + Intergenic
1131919089 15:97303342-97303364 CTCCTGGATGGGAAATGGGGTGG - Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133654431 16:7846609-7846631 ATCCCCAAGGGGAAGATGGGAGG - Intergenic
1136566630 16:31074363-31074385 CTCCCGAAGCGGAAGTTTCGCGG + Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1141921802 16:87140469-87140491 CTCCGGAAGAGGAAAGTCGGTGG - Intronic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149909373 17:60553009-60553031 CTCCCCAAAGGGAAATCAGGTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1154018339 18:10639618-10639640 CTCCAGAAAGGGACATTTGGGGG - Intergenic
1154186534 18:12189972-12189994 CTCCAGAAAGGGACATTTGGGGG + Intergenic
1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG + Intronic
1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG + Intronic
1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155650 19:2730935-2730957 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1168140232 19:54381025-54381047 GTCACGAAGGGGAAAGTGGGAGG - Intergenic
929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG + Intergenic
929911498 2:46093426-46093448 CTTTGGAAGGGGAAATTGAGGGG - Intronic
930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG + Intronic
937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG + Intergenic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
947286817 2:228526480-228526502 ATCCAGAAGGGGAAAATGAGGGG - Intergenic
1172639448 20:36432079-36432101 CTCGCCACGGGGAAATTGGAGGG - Exonic
1174189969 20:48733528-48733550 CTCCCGAAGTGGTAACAGGGTGG - Intronic
1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG + Intergenic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
951544929 3:23815223-23815245 CTCTGGAAGGGCAAAGTGGGTGG - Intronic
951566472 3:24017039-24017061 TTCTTGAAGGGGAATTTGGGAGG - Intergenic
964030345 3:152131250-152131272 CTCAAAAGGGGGAAATTGGGAGG + Intergenic
971614948 4:28776866-28776888 CTCCCGAAGGTTAAATTAGTTGG + Intergenic
974137078 4:57832365-57832387 CTCCCAAAGAGCAAAATGGGAGG + Intergenic
981996648 4:150982666-150982688 TTCCAGAAGGGGAAATGTGGTGG - Intronic
985362207 4:189187440-189187462 CTCCCAAATAGGATATTGGGAGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
998099374 5:139419372-139419394 CTCCAGAGAGGGAAATAGGGGGG + Intronic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1001332535 5:170772500-170772522 CACACGGAGGGAAAATTGGGAGG - Intronic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006987856 6:38188677-38188699 CTTCCAAAGAGGAATTTGGGAGG - Intronic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008842992 6:55927224-55927246 CTCCCGAAGAGGGAAGTGAGAGG + Intergenic
1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG + Intergenic
1011521281 6:88209441-88209463 CTCCGGAAGAGGAAAGTGAGTGG + Intergenic
1012713095 6:102632953-102632975 CTCTTGAATGGGAAAGTGGGAGG + Intergenic
1013509489 6:110831536-110831558 CTTCGGAAGGTGAAAGTGGGAGG - Intronic
1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG + Exonic
1018276028 6:162132653-162132675 CACCTGAAGTGGAAATGGGGAGG + Intronic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019265515 7:115339-115361 GTCCAGAAGGGGAAACTTGGCGG - Intergenic
1025789976 7:64680160-64680182 CTCTCAAAGGGGAAATAGTGGGG - Intronic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1037903910 8:22704141-22704163 CTCCAGAAGGGAGAGTTGGGGGG - Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG + Intergenic
1056687214 9:88776541-88776563 TTCCAAAAGGGGAAAATGGGGGG - Intergenic
1057067998 9:92073105-92073127 CTCTCAAAGGGGAAATTGCTGGG - Intronic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG + Intergenic
1193162899 X:78247727-78247749 TTCCAGAAGGGGAAAATGGGTGG + Intergenic
1194635014 X:96335290-96335312 TCCCTGAAGGGGAGATTGGGTGG - Intergenic
1197808279 X:130417639-130417661 CTCCCATAGGGAAAATGGGGAGG + Intergenic
1198508760 X:137328046-137328068 CTCAGGAAGGGGAAATATGGTGG - Intergenic