ID: 1150507267

View in Genome Browser
Species Human (GRCh38)
Location 17:65712081-65712103
Sequence CCCTTCCCTGCTTGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150507261_1150507267 11 Left 1150507261 17:65712047-65712069 CCATCGACTGCTGCGAGTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1150507267 17:65712081-65712103 CCCTTCCCTGCTTGGTCAGAGGG 0: 1
1: 1
2: 2
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150507267 Original CRISPR CCCTTCCCTGCTTGGTCAGA GGG Intronic