ID: 1150510005

View in Genome Browser
Species Human (GRCh38)
Location 17:65741144-65741166
Sequence TATGGTAATCTTCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150510005_1150510010 19 Left 1150510005 17:65741144-65741166 CCTTCCTCATGAAGATTACCATA 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1150510010 17:65741186-65741208 GAACATGAGATGAATGAAAATGG 0: 1
1: 1
2: 3
3: 49
4: 481
1150510005_1150510011 29 Left 1150510005 17:65741144-65741166 CCTTCCTCATGAAGATTACCATA 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1150510011 17:65741196-65741218 TGAATGAAAATGGCAGAGCCTGG 0: 1
1: 0
2: 1
3: 45
4: 463
1150510005_1150510009 -3 Left 1150510005 17:65741144-65741166 CCTTCCTCATGAAGATTACCATA 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1150510009 17:65741164-65741186 ATAAGGCTTAAATGAGATAATGG 0: 1
1: 2
2: 17
3: 97
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150510005 Original CRISPR TATGGTAATCTTCATGAGGA AGG (reversed) Intronic
903108627 1:21108234-21108256 TTAGGTAATATCCATGAGGAAGG + Intronic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
905148574 1:35907765-35907787 TGTGGTAATGTGCATTAGGATGG - Intronic
905542633 1:38772451-38772473 TGTAGAAATCTTCATGAGGCAGG + Intergenic
907545037 1:55252559-55252581 TCTGCTAAGCTTCATGAAGATGG - Intergenic
909812800 1:79952682-79952704 TATGTTGATTTTCATGAGGTTGG - Intergenic
909890516 1:81000462-81000484 CTAGCTAATCTTCATGAGGAAGG - Intergenic
914023603 1:143891844-143891866 TATCTTGATCATCATGAGGAGGG + Intergenic
914662075 1:149799789-149799811 TATCTTGATCATCATGAGGACGG + Intronic
915699779 1:157780948-157780970 ACTGATAATCTTCATGACGAAGG - Intergenic
920165486 1:204032756-204032778 TATGGACATTTTCATAAGGAAGG + Intergenic
920917462 1:210269586-210269608 AATGGTGATCTTCATGAAAATGG + Intergenic
924117058 1:240758165-240758187 TATAGTAATCTGCATTAGCAAGG - Intergenic
924753423 1:246919415-246919437 TATGGAAATCCTCAAGAGGCCGG + Intronic
924835886 1:247646861-247646883 TATGGTAATATTCATTACCATGG - Intergenic
1065357861 10:24859768-24859790 TATTCTAATCTCCATGAGGTTGG + Intronic
1065626985 10:27639782-27639804 TATAGTAATCTAGATGAGGGAGG + Intergenic
1071969175 10:90885526-90885548 TATGGTCTTCTACATAAGGATGG - Intronic
1071979928 10:90994495-90994517 TATGGTAATGTCCAGCAGGAGGG - Intergenic
1076216154 10:128694924-128694946 TTTGTTAATATGCATGAGGAGGG - Intergenic
1078657020 11:13250901-13250923 TATTGTAATATTTATGAGTAGGG - Intergenic
1079936980 11:26629164-26629186 CATTGTAATCTTCATCAGAATGG + Intronic
1080565705 11:33507273-33507295 TTGGGGAGTCTTCATGAGGATGG + Intergenic
1081272135 11:41097720-41097742 TATGGTACTTTTCTTGAGGATGG + Intronic
1084242028 11:67828206-67828228 TATTGTAAACTGCATGTGGAAGG - Intergenic
1085923504 11:80987170-80987192 TATTGTTATTATCATGAGGAAGG + Intergenic
1087290297 11:96313793-96313815 TATGAGGACCTTCATGAGGATGG - Intronic
1092064149 12:5575810-5575832 TAAAGTAATCTTCAGGAGAAGGG - Intronic
1092231466 12:6777994-6778016 TTTGGTCACCTTCCTGAGGAAGG - Intronic
1093139168 12:15487629-15487651 TCTGGTAGTCCTCATGAGCATGG + Intronic
1093934672 12:24988005-24988027 TATGGGAATTATCATCAGGAGGG - Intergenic
1094598475 12:31887327-31887349 GATGGTTGGCTTCATGAGGAAGG - Intergenic
1094795218 12:33964379-33964401 CATGAAAATCTTCTTGAGGATGG - Intergenic
1095789484 12:46148605-46148627 AATGAAAAACTTCATGAGGAAGG - Intergenic
1097066307 12:56323110-56323132 TTTGGTCATCTTCATGCGAATGG + Exonic
1098553044 12:71785723-71785745 TATGGCAGTCTTCATGTTGAGGG - Exonic
1099967650 12:89467301-89467323 TATCTTAAGCTTCTTGAGGATGG - Intronic
1100515426 12:95322985-95323007 TGTGGATATATTCATGAGGACGG + Intergenic
1101978347 12:109382561-109382583 TATGGTATTCTTTATGATAATGG + Intronic
1102409306 12:112703468-112703490 TTTTGTTAACTTCATGAGGATGG - Intronic
1111872258 13:93847656-93847678 AATGCTTATCTCCATGAGGAAGG + Intronic
1112065808 13:95791406-95791428 AGCTGTAATCTTCATGAGGATGG + Exonic
1114332691 14:21653314-21653336 TAAGGTAATCTTTATAAGTAAGG - Intergenic
1114837602 14:26221965-26221987 TATGATAAGCTCCATGAGGCAGG + Intergenic
1115623647 14:35166969-35166991 TCTGGTAAGCTGCATGAAGATGG + Intronic
1116927447 14:50654772-50654794 TATGGAGAACTTCATGATGATGG + Intronic
1117544214 14:56778804-56778826 CAAAGTAATCTTCATAAGGAAGG + Intergenic
1120614201 14:86682026-86682048 TATTGTTATCTTCAGGAGGGTGG + Intergenic
1126209783 15:46088257-46088279 TATTGTAAGCTTTATGAGGAAGG + Intergenic
1131779237 15:95838420-95838442 GATGGTAAGCTCCTTGAGGATGG - Intergenic
1138075628 16:54039614-54039636 ACTTGTAATCTTCATGAGGGCGG - Intronic
1139022660 16:62769981-62770003 TAAGATAATCTTCATAAAGATGG - Intergenic
1141933610 16:87221607-87221629 TATGGTAATGGTTATGATGATGG - Intronic
1149345438 17:55729924-55729946 TAAGGTACTACTCATGAGGAAGG + Intronic
1150510005 17:65741144-65741166 TATGGTAATCTTCATGAGGAAGG - Intronic
1150907519 17:69354078-69354100 TAAGGTAACCTTGATGAGCAGGG - Intergenic
1153288976 18:3481819-3481841 TATGTTAAACTTGATGAAGAGGG - Intergenic
1153975694 18:10267030-10267052 TGTTGTAAGCTTCATGAAGAAGG + Intergenic
1156161781 18:34368178-34368200 CATTGTCATCTTTATGAGGATGG + Intergenic
1156202955 18:34855037-34855059 TAGGGCAAACTTCATGGGGAAGG + Intronic
1158025633 18:52893846-52893868 TACTGTGATCTTCATGAGGGGGG - Intronic
1161899428 19:7107093-7107115 GATGGTAATGGTGATGAGGATGG + Intergenic
1165175961 19:33930021-33930043 GAATGTAAGCTTCATGAGGACGG - Intergenic
1168208194 19:54868215-54868237 AATGGCAATCTTAAAGAGGAAGG - Intergenic
926689318 2:15722201-15722223 CATGGTAATGTTCTTGAGAATGG - Intronic
927578376 2:24219598-24219620 TCTGGGAACCTTCATGAGGATGG + Intronic
934158362 2:89224742-89224764 CATGGTCATCTGAATGAGGAAGG + Intergenic
934208906 2:89957683-89957705 CATGGTCATCTGAATGAGGAAGG - Intergenic
935568292 2:104632766-104632788 AATGGTAATCCTCAAGGGGAGGG - Intergenic
940156676 2:150663924-150663946 TATGGAAATCTTGAAGAGAAAGG - Intergenic
941324006 2:164090256-164090278 TAATGTATTCTTTATGAGGAAGG + Intergenic
943199763 2:184805538-184805560 TTTGGTGATATTCTTGAGGAAGG - Intronic
943799573 2:192041555-192041577 TATGGTTAACTTTTTGAGGAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946788094 2:223269345-223269367 GAAGGTAAACTTCTTGAGGATGG + Intergenic
1170930135 20:20762244-20762266 TGTTGCCATCTTCATGAGGATGG - Intergenic
1172707081 20:36889752-36889774 AATGATAATGTTCATGAGGTTGG - Intronic
1177707499 21:24726385-24726407 GAGTGTAATCTTCATGAGGGTGG - Intergenic
1178226242 21:30722214-30722236 TAGAGAAATCTTCATGAGGATGG - Intergenic
951044863 3:18026786-18026808 TATGGAAGTCTTAATGAGTATGG + Intronic
951207515 3:19940014-19940036 TTGAGTAGTCTTCATGAGGAAGG - Intronic
951502083 3:23399980-23400002 TATTGTAATGTTCAAGAGAAGGG - Intronic
956647903 3:71474972-71474994 GATGGGAAACTCCATGAGGAAGG - Intronic
958733414 3:97982797-97982819 TGAGTTAATCTTCATGAGTAAGG - Intergenic
961761382 3:129171445-129171467 GATTGTGATCTTCAGGAGGATGG - Exonic
963191831 3:142481460-142481482 TCTGGTAAACCTCATGAAGAAGG - Intronic
964568415 3:158084943-158084965 TATGGTAAACTTCAATAAGAAGG - Intergenic
964857533 3:161162885-161162907 TATGGTCTTCTACATGATGAAGG + Intronic
967531764 3:190555710-190555732 AATTGCAAGCTTCATGAGGAAGG + Intronic
968072477 3:195794212-195794234 TAAGGTAATATTCACGAAGATGG - Intronic
969000312 4:3975528-3975550 TATTGTAAACTGCATGTGGAAGG - Intergenic
969158524 4:5234424-5234446 TTAAGTAACCTTCATGAGGATGG + Intronic
969161127 4:5259985-5260007 TAGGGGAATCTTCCTGAGGGGGG + Intronic
970327198 4:14938370-14938392 TAAGGTAATTCTCATGATGATGG + Intergenic
973641033 4:52902920-52902942 TATAGTAGACGTCATGAGGAAGG + Intronic
975645331 4:76540212-76540234 TATTGTTATCTTCAGCAGGAGGG + Intronic
976611848 4:87038810-87038832 TATATTTATCTTCATAAGGATGG - Intronic
978374537 4:108060991-108061013 TATGGAAATCTTTATGAAGGTGG + Intronic
979963426 4:127048844-127048866 TATGGAAATTTGCATGAGAAGGG + Intergenic
980768707 4:137342861-137342883 TATTATAATTTTAATGAGGAAGG + Intergenic
984058926 4:174966813-174966835 TATGCTATTCTTCAAGAGAATGG - Intronic
984211056 4:176849036-176849058 TTTATGAATCTTCATGAGGAGGG + Intergenic
984242370 4:177233144-177233166 TATGGTAAGGTTCATGAGATGGG + Intergenic
989334106 5:40294463-40294485 TATGAAAATCTTCATGTGGGTGG + Intergenic
993055505 5:82975241-82975263 TATGGTATTGTTCATGTGGATGG - Intergenic
995835859 5:116399054-116399076 CATGGCAATCTCCAAGAGGAAGG - Intronic
996064669 5:119067702-119067724 AATGCTAGTCTTCAAGAGGAGGG - Intronic
998264235 5:140655456-140655478 TAAGGTAATATTGATGATGATGG - Intronic
998767850 5:145508042-145508064 TTTGGTAATCTTTATGAACATGG - Intronic
999120142 5:149203207-149203229 GATGGTATTGTTCATGATGATGG - Intronic
1000786208 5:165547085-165547107 TCTGGTAATATTCTTGTGGAAGG - Intergenic
1005430766 6:25754415-25754437 TATTATAATCTTCATGGAGATGG - Intergenic
1007915833 6:45560971-45560993 GATGGTGAGCTTCATGAGGGTGG - Intronic
1009791561 6:68407941-68407963 TATCATAATCTGCATGAAGATGG - Intergenic
1010504886 6:76644979-76645001 TATGGTAATCTTAATCAGGTGGG - Intergenic
1012052971 6:94366646-94366668 TATTGTAATCTCCTTGAGGTTGG - Intergenic
1012472331 6:99586379-99586401 AATGGTAAGCTTAGTGAGGAAGG - Intergenic
1013032479 6:106348055-106348077 AATGGTAAGCTACTTGAGGATGG + Intergenic
1018378953 6:163240405-163240427 TATGGAAGTCTTCACGAGGACGG - Intronic
1018713095 6:166511376-166511398 CATGGTTATCTTCATGGAGAGGG - Intronic
1020407143 7:7849655-7849677 AATGGTAAACTCCATGAGGCAGG - Intronic
1022455067 7:30551505-30551527 TATGGAAATCTTCATTATGCAGG + Intergenic
1023256494 7:38317905-38317927 TCTGGTCACCTTCATGAGGCTGG + Intergenic
1024756013 7:52532367-52532389 TAGGGTCAGCTTCCTGAGGAAGG - Intergenic
1026517214 7:71083264-71083286 AAATGTAATCTTCATGAGAATGG + Intergenic
1027394133 7:77735972-77735994 TATAGTAACCATAATGAGGAAGG + Intronic
1028325278 7:89516853-89516875 TTATTTAATCTTCATGAGGAAGG - Intergenic
1029937050 7:104436655-104436677 TATGGACATCTATATGAGGAAGG + Intronic
1032649188 7:133858640-133858662 TATTGGAAACTTCTTGAGGATGG + Intronic
1035310561 7:157965203-157965225 TATGGTAATCTTCATACATATGG - Intronic
1036376918 8:8208464-8208486 TATTGTGATCTGCATGTGGAAGG + Intergenic
1036852621 8:12214675-12214697 TATTGTGATCTGCATGTGGAAGG - Intergenic
1036873989 8:12457198-12457220 TATTGTGATCTGCATGTGGAAGG - Intergenic
1039029270 8:33292152-33292174 GATGGTAATTTTGATGAGGGTGG - Intergenic
1042430620 8:68702126-68702148 TAATGTAATCTCCATGAGAATGG + Intronic
1042885642 8:73546825-73546847 TATGGTACTCTTCAGGTGGATGG - Intronic
1046528320 8:115410372-115410394 TAAGGTAATATTAATGAGAAGGG - Exonic
1047777616 8:128086398-128086420 TATGCTAATCCTCATGTGAAAGG + Intergenic
1048525862 8:135201856-135201878 TCTGGCAATCATCCTGAGGAAGG - Intergenic
1050563857 9:6862282-6862304 AATGTTAATCTTCATTAGGTAGG - Intronic
1050709861 9:8449270-8449292 TATGGTACTCTGAAAGAGGAAGG - Intronic
1051756332 9:20404896-20404918 TATGGCTATGTTCCTGAGGAAGG + Intronic
1052679568 9:31671803-31671825 TATGGTGATGTTCATGAGTGGGG + Intergenic
1055241174 9:74188291-74188313 TAAGTAAATCTTCCTGAGGAGGG + Intergenic
1189184155 X:39037668-39037690 TATGGTAGTTTGAATGAGGAGGG - Intergenic
1189476192 X:41357958-41357980 TATGGTTGTCTTCATCAGGAGGG - Intronic
1192624871 X:72715952-72715974 TTTGGTAATGATGATGAGGAAGG + Intergenic
1192950408 X:76010454-76010476 TATGGTAATGATAATGATGATGG - Intergenic
1193272556 X:79545875-79545897 TGTGCTATTCATCATGAGGATGG - Intergenic
1193856685 X:86611556-86611578 TATGGCAAGCTTCATGATCATGG - Intronic
1195374260 X:104211095-104211117 TATGGCAATGGCCATGAGGATGG + Intergenic
1196428266 X:115594739-115594761 TATGTTAATTTTCATAAGAAAGG + Intronic
1197047989 X:122023309-122023331 TATGGTAATAATCTTGAAGAAGG - Intergenic
1197598146 X:128492123-128492145 TATGGTAGTTTTCATGAGGTGGG - Intergenic
1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG + Intergenic
1201452198 Y:14128903-14128925 AATGTTAATCTCCATGAGCATGG + Intergenic