ID: 1150511746

View in Genome Browser
Species Human (GRCh38)
Location 17:65759863-65759885
Sequence TACTTACAACAGATTTATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150511746 Original CRISPR TACTTACAACAGATTTATCG GGG (reversed) Intronic
901295088 1:8155072-8155094 TTCTGACAACAGAATTATCTAGG - Intergenic
905350222 1:37340589-37340611 AACTTACAATGGATTTATCAGGG + Intergenic
906735956 1:48128330-48128352 TACTTTCTACAGTTTTATTGAGG - Intergenic
908026636 1:59958843-59958865 TACTAAAAACAGATTTTTGGAGG - Intergenic
910134383 1:83950122-83950144 TAGTTACAACAGTTTTATCTAGG + Intronic
910313924 1:85860123-85860145 TTTTTAAAACAGATTTATTGAGG + Intronic
910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG + Intergenic
910873452 1:91855878-91855900 TAAATACAAGAGATTTATTGGGG - Intronic
912571243 1:110624613-110624635 TAGTTTTAACAGCTTTATCGAGG - Intronic
914385483 1:147165767-147165789 TACCTACAACAGAATTGTCAGGG + Intronic
915825742 1:159074093-159074115 TTTTTAAAATAGATTTATCGAGG + Intronic
915984837 1:160454005-160454027 TTCTAAAAACAGATTTATTGAGG - Intergenic
918868473 1:189934980-189935002 TACTTAAAATAGATTTATAAAGG - Intergenic
919327030 1:196120990-196121012 TACTTAAAAGAGATTTTTCTGGG - Intergenic
919917762 1:202149453-202149475 TTCTTACAACAGTTTTCTGGGGG + Intronic
922916520 1:229262496-229262518 TTCTTACAACAGGTTTATAAGGG - Intergenic
1067392788 10:45880525-45880547 TTCTTAAGACAGATTTATTGAGG - Intergenic
1067861113 10:49849648-49849670 TTCTTAAGACAGATTTATTGAGG - Intronic
1068079875 10:52306695-52306717 TCCTTAAAAAAGATCTATCGAGG - Intergenic
1068364235 10:56024688-56024710 TACATATATCAGATTTATCCAGG + Intergenic
1071218755 10:83437815-83437837 TATTTACTAAAGATTTATCCAGG - Intergenic
1078303657 11:10160175-10160197 TACTTCTAACAGATTTTTGGTGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1081287494 11:41288962-41288984 TACTCAAAAGAGATTTATCCTGG - Intronic
1084579023 11:70010881-70010903 GACTTACCACATATTTATAGTGG + Intergenic
1086603304 11:88662603-88662625 TAGTTAGATCAGATTTATAGAGG - Intronic
1087700539 11:101431760-101431782 TACATACAAGAGATTTATTGGGG - Intergenic
1088011777 11:105011561-105011583 TAGTTCCAACAGATTTTTCATGG - Intronic
1090996708 11:131872778-131872800 TAATTAGACCAGATTTATAGGGG + Intronic
1093078596 12:14783446-14783468 TACTAAAAATGGATTTATCGTGG + Intergenic
1093470420 12:19495420-19495442 TTGTTACTACAGATTTATAGCGG + Intronic
1094572764 12:31655974-31655996 TACTTTTAACAGCTTTATTGAGG - Intronic
1095715425 12:45341076-45341098 TACTTAAAACAGTTGTATCAAGG - Intronic
1102185227 12:110942365-110942387 AACTTGCAAGAGATTTATTGAGG - Intergenic
1104342091 12:127959932-127959954 TACTTATATCTGATTTATCGTGG + Intergenic
1110076923 13:71257366-71257388 TACTTAAAAAATATTTATTGAGG - Intergenic
1113394425 13:109933438-109933460 TACTTACATGAGAATTATCTGGG + Intergenic
1113751555 13:112780142-112780164 TACTTACAACATTTTTACTGAGG + Intronic
1115343474 14:32317536-32317558 AACTTACAATGGATTTATTGGGG + Intergenic
1125709186 15:41770437-41770459 TACATACAATAGTTTTTTCGTGG + Intronic
1126808018 15:52372503-52372525 TACTTATCACAGATATATGGAGG + Intronic
1134009533 16:10841568-10841590 TTCTTATAACAGTTTTATTGAGG + Intergenic
1135385046 16:22031353-22031375 TTTTTAAAACAGATTTATTGAGG + Intronic
1147869285 17:43576217-43576239 TATGTATAACATATTTATCGTGG + Intronic
1148258859 17:46161557-46161579 TACTTACAAGAGATGTATCCTGG - Intronic
1149010215 17:51848695-51848717 TCCTTACAAAACATTTATAGTGG + Intronic
1150511746 17:65759863-65759885 TACTTACAACAGATTTATCGGGG - Intronic
1155564128 18:27114049-27114071 TATTTACATCAGCTTTATCTAGG - Intronic
1159255951 18:65945924-65945946 TTTTTACACCAGATTTATTGAGG + Intergenic
1164905266 19:31962316-31962338 TATTAACAACACAATTATCGTGG + Intergenic
927285133 2:21349441-21349463 GACTTAAAACAGATATATCTGGG + Intergenic
928159105 2:28905509-28905531 TTTTTACAAGAGATTTTTCGAGG + Intronic
928529852 2:32179886-32179908 AATTTACAACAGATATATAGTGG - Intronic
931464770 2:62476492-62476514 TACTTACAATGGGTTTATCAGGG - Intergenic
935148225 2:100410777-100410799 TACTTAAAACACATTGATTGGGG + Intronic
939608149 2:144277354-144277376 TACTTTGAACACATTTATGGTGG - Intronic
945972446 2:216243797-216243819 TACATACAAGAGATTCATTGAGG - Intergenic
1170497315 20:16938722-16938744 TTCTTACAATAGCTTTATTGAGG + Intergenic
1178446073 21:32643956-32643978 TACTTACAAAAGAATTATGAAGG + Intronic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
951387153 3:22056468-22056490 TACTCACTACAGTTTTATCTTGG - Intronic
951950618 3:28196599-28196621 TTCTTCCTACAGATTTCTCGTGG - Intergenic
953041235 3:39256646-39256668 TATTTACAACATATTTATCATGG - Intergenic
955402310 3:58601279-58601301 TACTTACATCAGTTTTTTCTGGG - Intronic
955843207 3:63133643-63133665 TAGTTACAACAGTTTTTTGGTGG - Intergenic
955852617 3:63237515-63237537 TTCTAACACCTGATTTATCGCGG + Intronic
956393681 3:68801582-68801604 TACCTACTACACATCTATCGTGG + Intronic
963691936 3:148515676-148515698 TACTTACCACAGACTTTGCGAGG + Intergenic
964835204 3:160930401-160930423 CACTTGCAAGAGATTTATGGGGG + Intronic
966391633 3:179459025-179459047 TACATACAACAGATTTGTAAGGG + Intergenic
967622938 3:191656081-191656103 TAGTTACACCAGATTTTTAGAGG - Intergenic
970815437 4:20150692-20150714 TGCTTAAAACAGCTTTATTGAGG - Intergenic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
978217462 4:106222337-106222359 TTCTTACAATAAATTTATTGGGG - Intronic
979058416 4:116023397-116023419 TTCTTTCATCAGATTTATTGAGG - Intergenic
979560450 4:122096043-122096065 AAGTTACAAGAGATTTATCGTGG + Intergenic
980034506 4:127868376-127868398 TACTTGCAACAGTTTTATTATGG - Intergenic
980957220 4:139441668-139441690 AACTTACAACGGGTTTATCTGGG + Intergenic
982828828 4:160033634-160033656 TACTTACTAAATATTTATCGTGG + Intergenic
986506873 5:8460841-8460863 TACTTACAACAGCTTTATGTGGG + Intergenic
986980436 5:13441901-13441923 CACTTAGAACAGAATTATTGGGG + Intergenic
987926438 5:24348539-24348561 TAATTACTATAGATTTATCCTGG + Intergenic
993062207 5:83051915-83051937 TACTGATAACAGATTCATCTAGG - Intergenic
994896108 5:105705186-105705208 TAGTTTCAACAGCTTTATAGTGG - Intergenic
995464208 5:112434493-112434515 TACTTACACCACATTCATCATGG + Intergenic
995882298 5:116856745-116856767 TTTTTAAAACAGATTTATTGAGG - Intergenic
996239769 5:121182245-121182267 TTCTTACCACAGATTTATTCTGG + Intergenic
1000918944 5:167116129-167116151 TACATGCAAGAGATTTATTGCGG + Intergenic
1009427862 6:63534516-63534538 TACTTACAAAACATTTATGCTGG + Intronic
1009481578 6:64165166-64165188 TAGTTTTAACAGATTTATTGAGG - Intronic
1009590161 6:65658376-65658398 TAGTTGCAACAGATGTATCATGG + Intronic
1024757800 7:52556723-52556745 TATTTACAACAGTCTTATCTTGG + Intergenic
1028629028 7:92913437-92913459 AACTAATAACAGATTTAACGTGG + Intergenic
1030382422 7:108827630-108827652 ACCTCACAACAGATTTAGCGGGG + Intergenic
1033322671 7:140354096-140354118 TGCTTTCAACAGGTTTATCATGG + Intronic
1033821346 7:145138331-145138353 TACTGAGAACAAATTTATTGTGG + Intergenic
1034010189 7:147521275-147521297 TAATTACAACAAAATTATAGTGG - Intronic
1041318178 8:56585439-56585461 TATTTACACCAGATTTCTAGGGG + Intergenic
1041609407 8:59827382-59827404 TACTTTCAACATATTTATAAGGG + Intergenic
1046723669 8:117651505-117651527 TACTTATTTCAGATTTATCAAGG - Intergenic
1047162632 8:122397832-122397854 TACTTTTAACAGCTTTATTGAGG - Intergenic
1051593684 9:18801899-18801921 TACTTTTAACAGCTTTATCAAGG + Intronic
1059863414 9:118488756-118488778 TACCCACAACAGTTTTATGGAGG + Intergenic
1188914816 X:35897325-35897347 AACTTACAACAGAGTTACCTGGG + Intergenic
1189121529 X:38400441-38400463 GACTTGCAAGAGATTTATTGAGG + Intronic