ID: 1150512616

View in Genome Browser
Species Human (GRCh38)
Location 17:65773084-65773106
Sequence TTGTCTACGGCTATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150512612_1150512616 2 Left 1150512612 17:65773059-65773081 CCGAGAGACCCAGCAGATAAAGA 0: 1
1: 0
2: 2
3: 26
4: 286
Right 1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 74
1150512611_1150512616 13 Left 1150512611 17:65773048-65773070 CCTCACTGAAACCGAGAGACCCA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 74
1150512613_1150512616 -6 Left 1150512613 17:65773067-65773089 CCCAGCAGATAAAGAACTTGTCT 0: 1
1: 0
2: 0
3: 24
4: 255
Right 1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 74
1150512614_1150512616 -7 Left 1150512614 17:65773068-65773090 CCAGCAGATAAAGAACTTGTCTA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150512616 Original CRISPR TTGTCTACGGCTATGCAGCC AGG Intronic
902554509 1:17239032-17239054 TTGGACAGGGCTATGCAGCCAGG + Intronic
903434366 1:23335423-23335445 TTACCTCCTGCTATGCAGCCCGG - Intronic
907512192 1:54970080-54970102 TTGTCTAGGGCAATGTAGCAAGG + Intergenic
908385886 1:63641348-63641370 CGATCTATGGCTATGCAGCCTGG - Intronic
909978792 1:82073271-82073293 TTGTCTATGGCTAAGCACCTTGG - Intergenic
910542313 1:88373971-88373993 GTGTCTAAGGCTATGCAGAGTGG - Intergenic
918219115 1:182419391-182419413 TTGTCAAAGACCATGCAGCCAGG - Intergenic
922846550 1:228689598-228689620 TCACCTCCGGCTATGCAGCCTGG - Intergenic
923538347 1:234870240-234870262 TTGTCTAAGGCCACACAGCCAGG + Intergenic
1063271292 10:4513042-4513064 TTGTGCACGGCTGTGCAACCTGG + Intergenic
1065631231 10:27683159-27683181 TTATCTCCTGCTATGCAGCCTGG + Intronic
1065849151 10:29772443-29772465 TTGCCTCCTGCTGTGCAGCCTGG + Intergenic
1066396711 10:35031762-35031784 TTGTCCACTGCAATCCAGCCTGG - Intronic
1070018504 10:72559802-72559824 TTACCTCCTGCTATGCAGCCTGG - Intronic
1075066613 10:119293121-119293143 TTGTTTAAGGTTATGCAGCCAGG + Intronic
1084303411 11:68265898-68265920 CTGCCTACAGCTATGCAGCTGGG - Intronic
1087854817 11:103079016-103079038 TTGCCTCCTGCTATACAGCCTGG - Intronic
1087990789 11:104743854-104743876 TTGTCTACTGCAATACAGCTTGG - Intergenic
1092974497 12:13731174-13731196 GTGCCTACAGCTATGCAGTCTGG - Intronic
1097742832 12:63264789-63264811 TCACCTCCGGCTATGCAGCCTGG - Intergenic
1101529214 12:105558988-105559010 TTGTCTCAGGCTCTGCATCCAGG - Intergenic
1103882186 12:124174740-124174762 TTTTCCACGGCTGTGCAGTCAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1110412326 13:75218116-75218138 TTTTCCAGGGCTATGCAGTCAGG + Intergenic
1111712805 13:91838562-91838584 TTGTCTACTTCTGTGCACCCTGG - Intronic
1113782992 13:112987145-112987167 CTGTCTGCGGCCCTGCAGCCGGG - Intronic
1123971050 15:25508078-25508100 TTGTCTATGGCTGTGCAGGTGGG + Intergenic
1124911903 15:33929388-33929410 CTGTCTACAGCTATGCAGTGTGG - Intronic
1127817389 15:62623278-62623300 TTGTCTACGGCTAAGCATGAAGG + Intronic
1128474975 15:67989422-67989444 TTGTCTAAGGCTCTGCTTCCAGG + Intergenic
1142770434 17:2092828-2092850 TTGTCTAAGGATAAACAGCCAGG - Intronic
1143285568 17:5786523-5786545 TTGTCTCCGGCTCTTCAGCCAGG - Intronic
1149639212 17:58192383-58192405 TTGCCCAAGGCCATGCAGCCAGG + Intergenic
1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG + Intronic
1152218919 17:79050134-79050156 TTGGCCATGGCTCTGCAGCCTGG + Intergenic
1156337401 18:36183731-36183753 TTCTCTAGCGCTCTGCAGCCTGG + Intergenic
1161912702 19:7206411-7206433 TCGTCCACTGCTGTGCAGCCTGG - Intronic
1167024661 19:46906441-46906463 TTCTCTCTTGCTATGCAGCCAGG + Intergenic
1168612812 19:57814614-57814636 CTGTTTACGGCTCTGCAACCCGG - Intronic
1168622223 19:57888676-57888698 CTGTTCACGGCTCTGCAGCCCGG - Intronic
925579420 2:5395449-5395471 CTGTCTCAGGCTCTGCAGCCAGG - Intergenic
926016512 2:9457672-9457694 TTGTCTACTGCTATGCCCCAAGG + Intronic
941326195 2:164117879-164117901 TTGTCTATGGCTCTGAAGGCAGG - Intergenic
944445399 2:199783790-199783812 TGGTCTAAAGCCATGCAGCCAGG + Intronic
945098035 2:206238166-206238188 TTGCCTCCTGCCATGCAGCCTGG + Intergenic
945331694 2:208547294-208547316 ATGTCTTGGGATATGCAGCCTGG - Intronic
1172993355 20:39052087-39052109 TTGTCCAAGGTCATGCAGCCAGG + Intergenic
1173407621 20:42780244-42780266 TCGTCCACGGCGATGTAGCCAGG + Exonic
1181166228 22:20984664-20984686 GTGTCTGAGGCCATGCAGCCAGG - Intronic
1184951658 22:47847371-47847393 TAGTCGATGGCTTTGCAGCCTGG - Intergenic
954157987 3:48698176-48698198 TTCTCTAGGTCTATGCAGACTGG + Intronic
955809306 3:62769829-62769851 TTGCCTAAGGTCATGCAGCCTGG - Intronic
961246017 3:125454261-125454283 TTGCCTCCTGCTATGCAGCCTGG - Intronic
973229613 4:47826234-47826256 TTGTCTAAGACTCTGCAGCCAGG + Intronic
980837768 4:138217817-138217839 TGTTCTATGGCTATTCAGCCTGG - Intronic
984812191 4:183805300-183805322 ATGTCTACAGCTATGCAACAAGG - Intergenic
988919347 5:35926177-35926199 TTGTTTCCAGCTATGCTGCCTGG + Intronic
989139486 5:38189074-38189096 TTGTCTGTGGCTAGGCAGCAGGG - Intergenic
995794332 5:115925708-115925730 TTGGCTGAGGCCATGCAGCCAGG - Intergenic
995968414 5:117938103-117938125 TTGTCTCCGGCTCTGCTTCCTGG - Intergenic
1001205711 5:169761136-169761158 TTTTCTAAGGTTATGCAGCTAGG - Intronic
1001658949 5:173375982-173376004 TTGTCTAAAGGTATGCAGCTAGG - Intergenic
1002594972 5:180316138-180316160 ATGTCTAAGGCCATGCAGTCAGG - Intronic
1003101337 6:3178654-3178676 TTGCCTATAGCTATGAAGCCTGG + Intergenic
1007097253 6:39221111-39221133 TTGTCTGAGGCTATGTAGCTAGG - Intronic
1008519655 6:52350974-52350996 TTGTTCACGGCTATGCTCCCAGG - Intergenic
1011815164 6:91181094-91181116 TTGTCCAAGGTCATGCAGCCAGG + Intergenic
1015819607 6:137246324-137246346 TCATCTCCTGCTATGCAGCCTGG + Intergenic
1019851173 7:3559337-3559359 TTGTCCGCGGTTATGCAGCATGG + Intronic
1020807682 7:12810608-12810630 TTGTCTAGGGCTAGGCAGCAGGG - Intergenic
1021372859 7:19871570-19871592 TTATCTTCTGCTGTGCAGCCTGG - Intergenic
1022534075 7:31085007-31085029 TTGTCCAGGGCTATGCAGCCAGG + Intronic
1030624134 7:111825292-111825314 TTGTCTACTGCCATGCAACAGGG + Intronic
1033567220 7:142591024-142591046 ATGTCTAGTGCTAAGCAGCCCGG + Intergenic
1038255567 8:25947934-25947956 TTGTCTTCTGCTCTGCAGCTAGG - Intronic
1044312658 8:90711880-90711902 TTATCTTCTGCTGTGCAGCCTGG + Intronic
1047324101 8:123819695-123819717 TTGGCTTCGGCTTTCCAGCCTGG - Intergenic
1054336834 9:63815613-63815635 TTGTCTACGGCCATACCACCTGG + Intergenic
1059982193 9:119785345-119785367 TTGTCCAAGGCCATGCAACCAGG + Intergenic
1060758089 9:126227161-126227183 CTGCCTAAGGCAATGCAGCCAGG + Intergenic
1186360498 X:8836374-8836396 TGCTCTACTGCCATGCAGCCTGG - Intergenic
1189714537 X:43852073-43852095 TTGTCTGAGGTTATGCAGCCAGG - Intronic
1199667609 X:150113111-150113133 TTGTCTAAGGTAATGAAGCCAGG + Intergenic