ID: 1150518375

View in Genome Browser
Species Human (GRCh38)
Location 17:65838175-65838197
Sequence AAATGTCTGCAGCAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150518375_1150518378 4 Left 1150518375 17:65838175-65838197 CCACCCAACTGCTGCAGACATTT 0: 1
1: 0
2: 3
3: 19
4: 223
Right 1150518378 17:65838202-65838224 AACATTTCCTCAACAGCACATGG 0: 1
1: 0
2: 2
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150518375 Original CRISPR AAATGTCTGCAGCAGTTGGG TGG (reversed) Intronic
900016768 1:156475-156497 AAATGCCTCCAGCAGTTGACTGG + Intergenic
900047028 1:515067-515089 AAATGCCTCCAGCAGTTGACTGG + Intergenic
900069232 1:756782-756804 AAATGCCTCCAGCAGTTGACTGG + Intergenic
901156687 1:7144958-7144980 CAAGCTCTGCAGCGGTTGGGAGG + Intronic
902708852 1:18225218-18225240 AAGTGTGTGCAGGAGTGGGGTGG - Intronic
902929727 1:19722655-19722677 AAATGGCTACAGCAGGTGGTAGG + Intronic
903261319 1:22133227-22133249 AAATGCCTGCAGCAGGATGGAGG + Intronic
904297776 1:29532909-29532931 AAATGTCTCCAGCTGTTGGTGGG - Intergenic
904700275 1:32353775-32353797 ATATGGCTGCAGAACTTGGGGGG - Intronic
905391208 1:37636398-37636420 AAAAGTCTGTGGAAGTTGGGGGG + Intergenic
911061597 1:93752438-93752460 AAATGTCTGCAGCCGTGGGTGGG - Intronic
913001151 1:114581950-114581972 AACTGGCTGCAGCATTTGGCGGG + Intergenic
915361162 1:155287156-155287178 AGATCTCTGCAGAAATTGGGAGG - Exonic
916624814 1:166544023-166544045 AAATTGCTGAAGCAGTTGGGTGG + Intergenic
917734119 1:177904939-177904961 AAATATCTGCAGCAGTTCCAGGG + Intergenic
920119949 1:203648933-203648955 AAAAGGCTGCAGCAGTTAAGTGG - Intronic
922104596 1:222502177-222502199 AAATGCCTCCAGCAGTTGACTGG + Intergenic
922264909 1:223974690-223974712 AAATGCCTCCAGCAGTTGACTGG + Intergenic
923182811 1:231537761-231537783 AAAAGTCTGTAGGGGTTGGGTGG + Intronic
923959885 1:239067608-239067630 ATATGTATGCATCTGTTGGGGGG + Intergenic
924346769 1:243079704-243079726 AAATGCCTCCAGCAGTTGACTGG + Intergenic
924641136 1:245834832-245834854 AAATGACAGCAGCATTTGGTGGG + Intronic
1063962275 10:11316618-11316640 TAATGGCTGCTGCAGTGGGGTGG - Intronic
1064867145 10:19893912-19893934 AAATGACTTCACCAGTTAGGGGG + Intronic
1066729579 10:38425158-38425180 AAATGCCTCCAGCAGTTGACTGG - Intergenic
1068595000 10:58893352-58893374 AAATGTGTTCAGCAGGTGAGGGG - Intergenic
1070488625 10:76954682-76954704 TAAGATATGCAGCAGTTGGGAGG - Intronic
1074554487 10:114475860-114475882 AAATGGCTGCAACAGAGGGGAGG - Intronic
1074628382 10:115220174-115220196 AAATGTCTTCAGCAATAGGCAGG + Intronic
1076973358 11:151548-151570 AAATGCCTCCAGCAGTTGACTGG + Intergenic
1078611200 11:12820969-12820991 AAGTGTTTGCAGCACTTTGGGGG + Intronic
1079111437 11:17607393-17607415 AAAAGTCTGCAGCCTATGGGGGG - Intronic
1080408849 11:32004478-32004500 AAATGCCTGCAGGAGCTGGATGG - Intronic
1080896051 11:36449551-36449573 ACCTGTCTGCATCAGCTGGGAGG - Intronic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081331579 11:41807237-41807259 AAATCTCTGTAGCAGTTGCCTGG - Intergenic
1085182293 11:74546002-74546024 CAATGTATTCAGCATTTGGGAGG + Intronic
1085305657 11:75484303-75484325 GAATGTCTGCACTAGTTGTGAGG + Intronic
1085787172 11:79463578-79463600 ATATGCCTGCAGCAAGTGGGTGG - Intergenic
1088210041 11:107444649-107444671 AATTGTCTACTGCAGTTGGATGG + Intronic
1088699099 11:112396208-112396230 AAATGTCTCTAGTAGCTGGGTGG - Intergenic
1092785650 12:12024249-12024271 AAAAGTCTGCAGGCGTTGGCAGG - Intergenic
1095375935 12:41528846-41528868 AAATGTCTGCAGCAGATGAAAGG - Intronic
1096509344 12:52119050-52119072 AAATAGCTGCACCAGTTAGGAGG - Intergenic
1099844595 12:88013761-88013783 AAATGTCTTAAAAAGTTGGGGGG + Intronic
1100339797 12:93667846-93667868 AAAAGGCTGCAGCATTTGTGTGG - Intergenic
1108767233 13:53646919-53646941 TAATGTGTACAGCAGTTAGGAGG - Intergenic
1109955683 13:69562732-69562754 AAGTGTCTGTGGCAGTTGTGGGG - Intergenic
1110038388 13:70718070-70718092 CAACGGCTGGAGCAGTTGGGAGG - Intergenic
1110323116 13:74182604-74182626 CACTGTGTGCAGCAGTTGGAGGG - Intergenic
1111701275 13:91693112-91693134 TAATGTCTGGAGCAGATGGACGG + Intronic
1112949261 13:104970759-104970781 AAATGTATTTAGCAGTGGGGTGG + Intergenic
1113509608 13:110842625-110842647 AAATGATTGCAGCAATTGAGGGG - Intergenic
1115133827 14:30085813-30085835 AAAAGACTGCAGCAATTGTGAGG + Intronic
1115825413 14:37266707-37266729 AAGAGTCTGAAGCAGTTGTGGGG - Intronic
1118154378 14:63224432-63224454 TTATCTCAGCAGCAGTTGGGGGG + Intronic
1119271857 14:73312779-73312801 AAATATCAGAAGCAGTTGAGGGG - Intronic
1119419072 14:74495655-74495677 AAATGTCTGTATGAGTAGGGAGG - Exonic
1120688253 14:87563682-87563704 AAAAGTTTGCAGCAGGTGTGGGG + Intergenic
1121110825 14:91311664-91311686 AAATGGCTTCAGCAGCTGAGTGG - Intronic
1121397446 14:93638730-93638752 AAATGTCGGCAGCAACTTGGGGG + Intronic
1122549829 14:102543962-102543984 AAATATCTGCATTTGTTGGGTGG - Intergenic
1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1125323582 15:38513954-38513976 AGATCTCTGCAGCAGTAGGAAGG - Intronic
1125932592 15:43611151-43611173 AAAGGTCTGCAGCAGTGCTGCGG + Exonic
1125945690 15:43710613-43710635 AAAGGTCTGCAGCAGTGCTGCGG + Intergenic
1126427871 15:48549091-48549113 AAATTTCTGCAGTAGTTGTACGG + Intronic
1127618716 15:60712561-60712583 AGATGACTGCAGAAGTTAGGTGG - Intronic
1127646237 15:60962193-60962215 AAATTTCTGTAGCTATTGGGTGG - Intronic
1127789372 15:62385342-62385364 AGATGTCTGCCACAGCTGGGAGG + Intergenic
1127894846 15:63288369-63288391 AAATTTCTGCAGTAGTTTAGAGG + Intronic
1129639999 15:77366275-77366297 TAATGACTGCAGTAGCTGGGAGG - Intronic
1132376668 15:101332623-101332645 AAATGTCTGCAGAAGCTGGGTGG + Intronic
1137483432 16:48871625-48871647 AAATGTCCACAGCAGATGTGGGG - Intergenic
1138463211 16:57166119-57166141 GAACATCTGCAGCAGATGGGTGG + Intronic
1139070108 16:63370076-63370098 AAATGTCTGGCGGGGTTGGGGGG - Intergenic
1139675527 16:68520636-68520658 AAATGTCTGGAGAGGTGGGGCGG + Intergenic
1140786815 16:78350191-78350213 ATATGTCTCCATCAGTTGTGAGG + Intronic
1142446892 16:90145982-90146004 AAATGCCTCCAGCAGTTGACTGG - Intergenic
1142460597 17:89343-89365 AAATGCCTCCAGCAGTTGACTGG + Intergenic
1145713384 17:26996530-26996552 CAATGTTTGCAGCAGATAGGAGG + Intergenic
1145785422 17:27590767-27590789 ACATGTTTGCACCAGCTGGGAGG - Intronic
1146700080 17:34949932-34949954 GAATGTATGCTGCAGTTGGTAGG - Intronic
1148359884 17:47003071-47003093 AAATATTTGTAGAAGTTGGGGGG - Intronic
1150518375 17:65838175-65838197 AAATGTCTGCAGCAGTTGGGTGG - Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1151239986 17:72750095-72750117 GAACCTCTGCAGCAGGTGGGTGG + Intronic
1151533568 17:74723999-74724021 AATTTTCAGCAGCTGTTGGGTGG + Intronic
1153508066 18:5823717-5823739 AAATGTCTGAAGGGGTTGGAGGG - Intergenic
1154083411 18:11279709-11279731 ACATCTCTGCAGCAGCTGAGAGG + Intergenic
1155591082 18:27428381-27428403 AGGTGTCTGCAGCAGTGGTGGGG - Intergenic
1156256321 18:35400351-35400373 AAATGTATTCAGCAGTTGTTGGG - Intergenic
1158197011 18:54899089-54899111 AAATGTCTGCATGGGGTGGGGGG - Intergenic
1160046492 18:75391579-75391601 AAATGTCTTCTGCAGCTGGGTGG + Intergenic
1160322502 18:77909567-77909589 AAATGTATGCAACAGTGTGGAGG - Intergenic
1160327043 18:77959780-77959802 AATCGTATGCAGCATTTGGGAGG - Intergenic
1160650314 19:221849-221871 AAATGCCTCCAGCAGTTGACTGG + Intergenic
1161580573 19:5078446-5078468 GAATGCCTGCAGCGGCTGGGAGG - Intronic
1163117253 19:15195990-15196012 AAACGTCTGCTGCCGGTGGGGGG + Intronic
1164674061 19:30090261-30090283 AAAGGTCTGCAGGAGCTGGGAGG - Intergenic
1165271751 19:34713706-34713728 GAATGTCTTCCGCTGTTGGGAGG - Intergenic
1165347349 19:35257277-35257299 ATAAGACTTCAGCAGTTGGGTGG + Intronic
1165393461 19:35551192-35551214 AGATGTCAGCAGCAGCAGGGAGG + Intronic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
926252013 2:11160066-11160088 AGATGTGTGCAGCAGCTGAGGGG + Intronic
926705434 2:15834272-15834294 GAATGTGGGCAGCAGGTGGGAGG - Intergenic
930769945 2:55120777-55120799 GACTGTCAGCAGCTGTTGGGTGG + Intergenic
931199258 2:60081175-60081197 ACATGGCTGCAGTAGTTGGAGGG + Intergenic
931966610 2:67542864-67542886 AGATGTTTGCAGCAGTGGGTGGG + Intergenic
932749608 2:74363046-74363068 CAATGTCTCCAGCAGCTGGCTGG + Exonic
938925026 2:136031209-136031231 TAGTCTCTGCAGCTGTTGGGAGG - Intergenic
941342565 2:164326482-164326504 AAATGCCTTCACCAGTTAGGTGG + Intergenic
943851012 2:192722915-192722937 AAATTTCTGCAGCAGATATGAGG - Intergenic
944591784 2:201224587-201224609 ATATGTATGCAGAAGTGGGGAGG - Intronic
944646548 2:201786092-201786114 AAAGGTCTGAAGGAGTAGGGGGG - Intergenic
946905438 2:224411636-224411658 AAATGTGTGCAGCCGTAAGGTGG + Intergenic
1169236588 20:3934588-3934610 ATATGTCTGCAGGAAGTGGGAGG + Intronic
1170709712 20:18779300-18779322 AAATGGGTGCCGGAGTTGGGGGG - Intergenic
1172075390 20:32292423-32292445 AATTGTTTGTAGAAGTTGGGGGG - Intronic
1176089435 20:63312403-63312425 CTCTGTCTGCAGCAGGTGGGAGG - Exonic
1177084807 21:16690192-16690214 AAATGTCTGCAGCACTGGGGAGG - Intergenic
1178883677 21:36467844-36467866 AAATGTCAGCCCCAGATGGGAGG + Intronic
1182029493 22:27146749-27146771 AAATGCCAGCTGCAGTGGGGTGG + Intergenic
1183044974 22:35212190-35212212 AAATGTCCTCAGCAGCTGGAAGG + Intergenic
1184265734 22:43344860-43344882 AAATGTCTGGAGCAATGGGGTGG - Intergenic
949758997 3:7447609-7447631 AAATGACTGGAGTAGTTGCGGGG + Intronic
951341199 3:21489596-21489618 AAATGACTGCATCAATTGGTTGG - Intronic
951953353 3:28226075-28226097 AAAGGTCTGAAATAGTTGGGAGG + Intergenic
952657037 3:35799257-35799279 AAAAGTCTGCAGGAGTCGGTGGG - Intergenic
953622361 3:44544074-44544096 AATTCCCAGCAGCAGTTGGGGGG - Intergenic
954461675 3:50630340-50630362 ACATGTTTGCAGGAGTTGGGAGG + Intronic
954809904 3:53241340-53241362 AAATGGATGCTGCAGTTGGCCGG - Intronic
955414188 3:58677864-58677886 ACATGTCTGCAGAAGTTTGCTGG + Intergenic
955518070 3:59747779-59747801 ATATGCCTGCAGGGGTTGGGGGG + Intergenic
955581345 3:60426410-60426432 GAATGTTTGTAGCAGTAGGGAGG - Intronic
956719798 3:72107779-72107801 TAATGACTGCAGCAGTGGGAAGG + Intergenic
958583290 3:96053353-96053375 AAATGTTACCAGGAGTTGGGTGG - Intergenic
959413706 3:106058516-106058538 AAAGGTCTGCAAGAGTTGGAAGG + Intergenic
959485547 3:106924684-106924706 AAATATATGCATCAGGTGGGAGG + Intergenic
961698748 3:128725649-128725671 AAATGACTACAGCAATTGTGTGG - Intergenic
964556954 3:157950251-157950273 AAATGACTCCAGTAGTTGAGGGG + Intergenic
966828512 3:183985831-183985853 AAATGTCAGCATCAGCTGGCTGG + Intronic
967113754 3:186318390-186318412 AAATGTGAGCAGCAGATGGAAGG - Intronic
967444666 3:189552704-189552726 AAATGTCTTCTGCTGTTGTGTGG - Intergenic
968367532 3:198198280-198198302 AAATGCCTCCAGCAGTTGACTGG - Intergenic
969234854 4:5858620-5858642 ATGTGTCTGGACCAGTTGGGAGG - Intronic
969467348 4:7365640-7365662 GAGTGTCAGCAGCTGTTGGGCGG - Intronic
971375345 4:26051555-26051577 ACATGTGTGCAGCAGCTGAGTGG + Intergenic
974375995 4:61076456-61076478 AAATGTCTTAACCAGTTAGGTGG - Intergenic
977119486 4:93080196-93080218 AAATGTCTGGAGCTTTTTGGTGG + Intronic
977977412 4:103282773-103282795 AAATGTCTTCTGCTGTTGGGTGG - Intergenic
979255946 4:118607986-118608008 AAATGCCTCCAGCAGTTGACTGG - Intergenic
979332399 4:119432554-119432576 AAATGCCTCCAGCAGTTGACTGG + Intergenic
981033320 4:140147498-140147520 AAAGGTTGGCAGCAGGTGGGGGG + Intronic
982652251 4:158100726-158100748 TAAAGCCTGCAGAAGTTGGGCGG + Intergenic
984444864 4:179824275-179824297 AATTCTCTGCAGCAGCGGGGAGG - Intergenic
984744201 4:183197912-183197934 CAATGTCTGCCGCAGTAGGGAGG - Intronic
988428842 5:31095148-31095170 TAATGTTTGCAGCTCTTGGGGGG + Intergenic
989609483 5:43277529-43277551 CAATGTCTGCAGAAGCTAGGAGG - Intronic
990178244 5:53131227-53131249 ACATGTCTGCATCATTGGGGAGG + Intergenic
991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG + Intergenic
994897228 5:105721680-105721702 AAGTGTCTGAGGCAGCTGGGGGG + Intergenic
995060465 5:107807386-107807408 AAATGACTGCAGCAGCTGATGGG - Intergenic
995825610 5:116295444-116295466 AAATGTCTGCAGTATTAGGTAGG - Intronic
997375052 5:133391780-133391802 AAAGGTCTGCAGCAGGCCGGGGG - Intronic
997680547 5:135747523-135747545 AAATGACTGCAGCAGTGAGAAGG - Intergenic
997878328 5:137568675-137568697 CAAAGACTCCAGCAGTTGGGAGG - Intronic
998014188 5:138719234-138719256 AAAGGCCTGAAGGAGTTGGGAGG - Intronic
998792281 5:145778101-145778123 GAAAGTGTGCACCAGTTGGGTGG - Intronic
1000742047 5:164980483-164980505 AAATGCATGCAACAGTAGGGAGG - Intergenic
1001621269 5:173087399-173087421 AAAAGTATGCAGCTGTTGGCTGG + Intronic
1002726756 5:181303507-181303529 AAATGCCTCCAGCAGTTGACTGG - Intergenic
1004313011 6:14562485-14562507 AAATGTGTGCAGAAGTCTGGCGG + Intergenic
1004354908 6:14922458-14922480 AAATATCTGCAGCATTTAGGTGG - Intergenic
1005510020 6:26504382-26504404 AAATGTTTGCAGCAGTTTGGTGG - Intronic
1006853516 6:37116653-37116675 AAATACCTGCACCAATTGGGAGG + Intergenic
1008332762 6:50262653-50262675 CCATGGCTGCAGCAGCTGGGAGG + Intergenic
1008886124 6:56432856-56432878 CCATGTCTGCAGCATGTGGGTGG - Intergenic
1010021242 6:71162263-71162285 AAATTTCTACAGTAGTTGTGGGG + Intergenic
1010239993 6:73606433-73606455 AAATAGTTGTAGCAGTTGGGAGG - Intronic
1011311786 6:85987944-85987966 GAATGTCTGCAGTAGCTGTGAGG + Intergenic
1011623902 6:89268196-89268218 AAACTTCTGCAGCAGATGTGAGG - Intronic
1012931934 6:105326510-105326532 AAATGTCTGCAGCAGGAAGCTGG + Intronic
1013581337 6:111537437-111537459 CAATCTCTTAAGCAGTTGGGGGG - Intergenic
1015464463 6:133533286-133533308 AAAGGCCTGCAGCAGGTGGGTGG - Intergenic
1017803214 6:157918080-157918102 ATGTGTCTGTAGCAGCTGGGTGG + Intronic
1018433043 6:163737848-163737870 AACTGTGGGCAGCAGGTGGGGGG + Intergenic
1019677193 7:2321059-2321081 AAATGTGTGTAGCCGGTGGGAGG + Intronic
1020964587 7:14849312-14849334 AAATTTCAGCAGCAGTGAGGGGG - Intronic
1022679042 7:32526906-32526928 AAATTTGTGCCGCAGTGGGGAGG - Intronic
1022977208 7:35569704-35569726 ACATGTCTGCAGAAGTGAGGTGG + Intergenic
1023644916 7:42300975-42300997 AAATGTTTGCAGAATTTGTGGGG + Intergenic
1024071645 7:45791133-45791155 AAATGCCTCCAGCAGTTGACTGG - Intergenic
1024517684 7:50273486-50273508 AAATGTGTGCAGCTGTGGGTTGG + Intergenic
1027541452 7:79471912-79471934 AAATGTGAGCAGCACTTGGGAGG + Intergenic
1029184280 7:98727420-98727442 AAACGTCTTCAGGAGTGGGGAGG + Intergenic
1031230970 7:119105772-119105794 AAACCTCTGTAGCAGTTGGCTGG - Intergenic
1032048269 7:128628712-128628734 AAATGCCTCCAGCAGTTGACTGG - Intergenic
1033520506 7:142155661-142155683 AAATGTCTTAAGCAGGTGGCTGG + Intronic
1033855501 7:145556501-145556523 AAATGTCTCATGCAGTTGTGGGG - Intergenic
1034532476 7:151705053-151705075 AAATGTGTTCAGCATTTGGCTGG - Intronic
1035001881 7:155619267-155619289 CACTGTCTGCTGCAGCTGGGGGG - Intronic
1036727334 8:11231582-11231604 AAATGTCCCCAGCAGTGGGGAGG + Intergenic
1037180692 8:16002344-16002366 AAATGTCTGTAGCAGCTTTGTGG + Intergenic
1037905688 8:22714822-22714844 AAATGTCAGCAGCCTCTGGGAGG - Intronic
1042099626 8:65260964-65260986 AAATGTCTTCAGCAGATGCAAGG - Intergenic
1042701568 8:71621140-71621162 AAATGTCTGGAGGGGGTGGGTGG - Intergenic
1047031422 8:120885907-120885929 AATTTTCTGCTGCAGTTGGAGGG + Intergenic
1047058975 8:121200146-121200168 AGATGTCTGCTGCTGTTGGCAGG - Intergenic
1047372588 8:124268119-124268141 AAGTTTCTGCAGCAGATGGCAGG - Intergenic
1047409589 8:124613553-124613575 AAATGTGTGTAACAATTGGGAGG + Intronic
1047477097 8:125243132-125243154 AAATGTATGATGCAGTTGAGGGG + Intronic
1047916273 8:129587180-129587202 GATTGTCTTCACCAGTTGGGAGG - Intergenic
1047949409 8:129917955-129917977 AAATCACTGCAGTAGTAGGGTGG - Intronic
1048750275 8:137664958-137664980 AGATGTCTGCAGGATTTGGAGGG - Intergenic
1048952230 8:139505732-139505754 AAATATCTGCAGCTGTAGTGTGG + Intergenic
1049190924 8:141286895-141286917 CAATGTCAGCTGCAGTGGGGAGG + Intronic
1049326899 8:142026270-142026292 AAAGTGCTTCAGCAGTTGGGAGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051486586 9:17615058-17615080 AAGTGTCCACAGCAGTTGGGAGG - Intronic
1051941641 9:22513222-22513244 GAATGCCTGCAGGGGTTGGGAGG + Intergenic
1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG + Exonic
1053172175 9:35895981-35896003 AAATGTGTGCAGCAGCTGCTAGG - Intergenic
1054715050 9:68548493-68548515 AATTTCCTGCAGCAGCTGGGTGG + Intergenic
1055750783 9:79502529-79502551 AAATGTCCCCTGTAGTTGGGTGG - Intergenic
1055765907 9:79663458-79663480 AACTCTCTGCAGCAGTGGGAAGG - Intronic
1056541930 9:87579136-87579158 AAATGTGTGCATCAGTGGGGAGG - Intronic
1056648748 9:88439035-88439057 AAATATCAGAAGCAGTTGAGGGG - Intronic
1057930966 9:99192607-99192629 AAAAGTCAGCAGCAGCTTGGAGG - Intergenic
1060092812 9:120759144-120759166 AAATGTCTGAAGTGGTTGGGGGG + Exonic
1060097438 9:120804538-120804560 AGATGGCTTCAGCAGTTGGTGGG + Intergenic
1062751873 9:138260985-138261007 AAATGCCTCCAGCAGTTGACTGG - Intergenic
1186168823 X:6855971-6855993 AAATGTGGCTAGCAGTTGGGGGG + Intergenic
1186928555 X:14361505-14361527 AAATGCCTGTGGCAGTAGGGAGG - Intergenic
1193270656 X:79526363-79526385 AAATGTCTCTACCAGTTAGGTGG - Intergenic
1193954241 X:87838661-87838683 TAATTTCTGCAGCTTTTGGGTGG + Intergenic
1194524581 X:94963383-94963405 CAATGTCTTCAGCAATTGGAGGG + Intergenic
1194865571 X:99061831-99061853 AAATGGCTGCAGCTGAAGGGAGG - Intergenic
1197584158 X:128323894-128323916 AAAAGTGTGCAGCAGTTTGGTGG + Intergenic
1198203006 X:134440705-134440727 AAATCTCTGCAGATGGTGGGAGG + Intergenic
1198548537 X:137719812-137719834 AAATGTCTGCAGTGGCTGGTGGG + Intergenic
1199345580 X:146734772-146734794 AAATGCCTGCAGCAGCTTGTTGG - Intergenic
1201248287 Y:12028991-12029013 AAATGTGTGTAGAATTTGGGTGG - Intergenic
1201294231 Y:12450018-12450040 AAACGTCTGAAAAAGTTGGGAGG - Intergenic