ID: 1150520656

View in Genome Browser
Species Human (GRCh38)
Location 17:65864265-65864287
Sequence GAGTCATATTTTAAGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 284}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150520649_1150520656 15 Left 1150520649 17:65864227-65864249 CCACTCCATGTGTCCACCTAACT 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG 0: 1
1: 0
2: 0
3: 37
4: 284
1150520652_1150520656 -1 Left 1150520652 17:65864243-65864265 CCTAACTATCCATTACCTCTTCG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG 0: 1
1: 0
2: 0
3: 37
4: 284
1150520650_1150520656 10 Left 1150520650 17:65864232-65864254 CCATGTGTCCACCTAACTATCCA 0: 1
1: 0
2: 2
3: 28
4: 454
Right 1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG 0: 1
1: 0
2: 0
3: 37
4: 284
1150520651_1150520656 2 Left 1150520651 17:65864240-65864262 CCACCTAACTATCCATTACCTCT 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG 0: 1
1: 0
2: 0
3: 37
4: 284
1150520653_1150520656 -10 Left 1150520653 17:65864252-65864274 CCATTACCTCTTCGAGTCATATT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG 0: 1
1: 0
2: 0
3: 37
4: 284
1150520648_1150520656 29 Left 1150520648 17:65864213-65864235 CCTCGGGCAGTTTGCCACTCCAT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG 0: 1
1: 0
2: 0
3: 37
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150520656 Original CRISPR GAGTCATATTTTAAGATGCT GGG Intronic
900825921 1:4926898-4926920 CAGTCATATTCTGAGATCCTGGG - Intergenic
907296161 1:53456432-53456454 TAGTCATGTTTTAAGATGCAGGG - Intergenic
907637122 1:56146444-56146466 GAGTGAGATTTGAAGAAGCTGGG - Intergenic
908039107 1:60088234-60088256 TAGTCATATTTTGAGGTACTTGG + Intergenic
910071599 1:83221045-83221067 CAGTCATATTCTAAGGTACTTGG + Intergenic
910159153 1:84255049-84255071 GAGTCATATCATAAGAGGCGTGG + Intergenic
910362321 1:86425881-86425903 CAGTCATATTTTTATATGCATGG - Intronic
910756374 1:90697114-90697136 CACCCATGTTTTAAGATGCTTGG - Intergenic
911221133 1:95248351-95248373 GAGTCAGATTTGAAGATGAAAGG - Intergenic
911562479 1:99423431-99423453 GAGTCATATTTTATGTTCCATGG - Intergenic
912667285 1:111593626-111593648 GAGTCATAACTTAAGCTGCCAGG - Intronic
913007102 1:114645230-114645252 CAGTCATATTCTGAGGTGCTGGG - Intronic
916267214 1:162902847-162902869 AAGTCATATTCTAAGATACTGGG + Intergenic
916642142 1:166741608-166741630 GAGTCACAGTTTATCATGCTGGG - Intergenic
917114617 1:171590042-171590064 GATTTACATTTTAAGCTGCTGGG - Intronic
917287734 1:173439388-173439410 GAGTCTAATTTTGAGATGTTGGG - Intergenic
917712774 1:177704147-177704169 GACTCACATTTTTAGAAGCTGGG - Intergenic
918511829 1:185320760-185320782 AGGTCATATTTTGAGATACTGGG + Intergenic
920262851 1:204701367-204701389 GAATCATATTGTAACATGCATGG - Intergenic
920896962 1:210061312-210061334 GAGTCAAATTTGAAGCTTCTGGG + Intronic
1062777988 10:171152-171174 GTGTCATATATTCTGATGCTTGG - Intronic
1063998451 10:11642768-11642790 GACTCCTATTTCAAGAAGCTTGG - Intergenic
1065294640 10:24262662-24262684 GAGTCTCAATTTAAGGTGCTAGG + Intronic
1065357870 10:24859956-24859978 CAGTCATATTTTAATTTGGTGGG - Intronic
1065872833 10:29970730-29970752 GATTCATATCTTCAGATGCAAGG + Intergenic
1066235917 10:33484335-33484357 AAGGCATGTTTTAAGATGCAAGG - Intergenic
1066506160 10:36046476-36046498 GATTTAAGTTTTAAGATGCTGGG + Intergenic
1067218159 10:44320582-44320604 GTGTCATATCTTAAAATGCAAGG - Intergenic
1067770659 10:49121349-49121371 CAGTCACATTTTGAGGTGCTAGG + Intergenic
1068133114 10:52920146-52920168 CAGTCACATTTTGAGATACTAGG - Intergenic
1068191310 10:53656388-53656410 TAGTCATATTCTAAGGTGCTGGG - Intergenic
1068855694 10:61795248-61795270 CAGTCATATTTTGAGGTACTGGG - Intergenic
1069113564 10:64476128-64476150 ATGTCATATTCTAAGAAGCTAGG + Intergenic
1069798326 10:71067293-71067315 AAGTCATATTTTTGGTTGCTGGG + Intergenic
1070010568 10:72470008-72470030 AAGTCATATTCTGAGATACTGGG + Intronic
1071024952 10:81101359-81101381 GAGTCATATTTTACTATTTTTGG + Intergenic
1071412625 10:85412027-85412049 CAGTCATATTGTAAGGTGCCAGG - Intergenic
1071672407 10:87620966-87620988 GAGTCATATGCTAAGAGACTTGG + Intergenic
1072063704 10:91843466-91843488 GAGTCATATTCTAAGGTACTGGG + Intronic
1074409151 10:113210842-113210864 GATTTCTATTTTAAGAAGCTAGG - Intergenic
1075954607 10:126511740-126511762 CAGTCTTATGTTAAAATGCTGGG + Intronic
1076393815 10:130123795-130123817 CAGTCATATTTCCACATGCTGGG - Intergenic
1077804634 11:5578392-5578414 GAGTTATTTTTTGAGGTGCTGGG - Intronic
1078947339 11:16084271-16084293 GAGTAATACTTTAAGGTGATAGG - Intronic
1079180371 11:18188342-18188364 TACTCATATTTTGAGATACTGGG + Intronic
1079440682 11:20511722-20511744 AAATCATAATTTAAGCTGCTGGG + Intergenic
1080510762 11:32968009-32968031 GAAGCATATTTTATGATGCAAGG - Intronic
1080580428 11:33637854-33637876 CAGTCACATTCTGAGATGCTAGG + Intronic
1081554549 11:44146269-44146291 CAGTTACATTTTGAGATGCTAGG + Intronic
1083129607 11:60612690-60612712 GAGTAATATTTGAATATACTGGG + Intergenic
1084654739 11:70508500-70508522 AGGTCATATTTTGAGATACTAGG - Intronic
1085661651 11:78373203-78373225 GAGTCATATCTAAAGCTACTAGG + Intronic
1086076610 11:82860929-82860951 GAGTTATATTTAAAGAAGATAGG + Intronic
1087897133 11:103599189-103599211 GAGACATATTTTGAGATTCTGGG + Intergenic
1090156039 11:124439754-124439776 GAATCAGATTTTAACATCCTAGG + Intergenic
1090705322 11:129330985-129331007 GAGTCACATTCTGAGATACTGGG - Intergenic
1091308563 11:134556886-134556908 GAGTCATATTTTAGGTTGTATGG + Intergenic
1092842950 12:12561408-12561430 GGGAAATATTTTCAGATGCTGGG - Intronic
1093052487 12:14519215-14519237 TAGTCATATTTTCAGGTACTAGG - Intronic
1093642069 12:21539534-21539556 GAGTAATACTATAAAATGCTGGG + Intronic
1093777917 12:23099100-23099122 GAGTAATTTTTTAAAATTCTAGG - Intergenic
1095092712 12:38121762-38121784 GAGGCAGCTTTTAGGATGCTGGG + Intergenic
1095344218 12:41130439-41130461 GAGCCATATTTCAATATGCCTGG + Intergenic
1095441680 12:42244318-42244340 CAGTCACATTCTAAGATACTGGG + Intronic
1095925456 12:47575094-47575116 CAGTCATATTTTGAAGTGCTTGG + Intergenic
1096144708 12:49270274-49270296 GAGTCATTTTTTAAAAATCTGGG + Intronic
1097970067 12:65623954-65623976 CGGTCATATTTTGAGATGGTTGG + Intergenic
1098583859 12:72133491-72133513 AAGTCCTATTATAAGATGCCTGG + Intronic
1098669038 12:73201305-73201327 GAGTCATATTTTATTACACTTGG + Intergenic
1100917690 12:99444946-99444968 GAGTTATATTTTTATATGGTAGG - Intronic
1103679888 12:122685026-122685048 CAGTCACATTCTGAGATGCTGGG + Intergenic
1104337862 12:127917466-127917488 AAGACATATTTAAAGTTGCTTGG - Intergenic
1106329976 13:28731002-28731024 AGGTCATATTCTAAGATACTGGG + Intergenic
1107651120 13:42546281-42546303 TAGTCATATCTTTAGGTGCTAGG - Intergenic
1109466381 13:62738218-62738240 GAGTCATATTTTGAGGAGTTAGG + Intergenic
1109803909 13:67412488-67412510 GAGTCAGAGTTTAAGATTTTCGG + Intergenic
1110779165 13:79444317-79444339 CAGTCACATTCTAAGATACTGGG + Intergenic
1110899127 13:80798583-80798605 AAGACAGATTTTAAGATGGTTGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112123268 13:96436523-96436545 CAGTCATATTTTGAGGTACTGGG - Intronic
1113014233 13:105809223-105809245 GAGTCATATTTTAAGAAGACTGG - Intergenic
1115266563 14:31506754-31506776 CAGTCATATTCTGAGATACTGGG + Intronic
1115848294 14:37562394-37562416 AAGTCATATTTTAAGATATTTGG + Intergenic
1116232621 14:42236172-42236194 CAGTCACATTGTAAGATACTGGG + Intergenic
1116538131 14:46062041-46062063 CAGTCACATTTTAAGGTACTTGG + Intergenic
1116836581 14:49774294-49774316 AAGTCATATTTTATTATTCTAGG - Intronic
1118556429 14:67028043-67028065 GAGTGATATTATCAGAGGCTGGG - Intronic
1119636128 14:76274889-76274911 GAGTCTTGTCTTAAGCTGCTGGG + Intergenic
1120837992 14:89058151-89058173 GGGTCACATTCTAAGATTCTGGG + Intergenic
1121660139 14:95628887-95628909 GTGTGATGTTTTAAGCTGCTAGG - Intergenic
1124015955 15:25875902-25875924 AAGTCACATTCTAAGATACTTGG + Intergenic
1124062924 15:26311926-26311948 GAGTTCTATTTTAAGATACTTGG - Intergenic
1126163976 15:45638268-45638290 CAGTCACATTCTAAGATCCTGGG - Intronic
1128400528 15:67275284-67275306 GAGAAATATTTTCACATGCTTGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131698036 15:94901479-94901501 ATGTCATAGTTTAAGATGCTTGG - Intergenic
1135872255 16:26161816-26161838 CAGTCACATTTTGAGGTGCTGGG - Intergenic
1137804287 16:51288727-51288749 GAGTGATATTTTAAAATGTTGGG + Intergenic
1138173120 16:54871553-54871575 CAGTCACATTTTTAGGTGCTGGG - Intergenic
1139896766 16:70294013-70294035 TAGCAATATTTTAAGATCCTAGG - Intronic
1140298090 16:73728059-73728081 CAGTCACATTTTTAGATGCTGGG - Intergenic
1144295799 17:13873788-13873810 CAGTCATATTCTGAGATACTGGG - Intergenic
1144805154 17:17960665-17960687 CAGTCATATTTTAAAAGACTAGG - Intronic
1146860792 17:36296441-36296463 GACTGATACTTTAGGATGCTTGG - Intronic
1147091121 17:38100536-38100558 GACTGATACTTTAGGATGCTTGG - Intergenic
1147106091 17:38219967-38219989 GACTGATACTTTAGGATGCTTGG + Intergenic
1148423416 17:47568549-47568571 GACTGATACTTTAGGATGCTTGG - Intronic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1151080418 17:71323135-71323157 CAGTCATATTTTGACATACTAGG - Intergenic
1152146802 17:78573260-78573282 TAGTCACATTCTAAGGTGCTGGG - Intronic
1155970787 18:32081632-32081654 GAGTCACATTCTAAGGTACTGGG + Intergenic
1156392446 18:36663564-36663586 CAGTCATATTTTAGGAAGCTGGG + Intronic
1156447606 18:37248979-37249001 CAGTGATATTTTAAGATCCCAGG - Intronic
1156626269 18:38913299-38913321 AAGCCATGTTTTAAGATTCTAGG + Intergenic
1157018932 18:43755744-43755766 CAGTCATATTTTAAAATACTAGG - Intergenic
1157434458 18:47656727-47656749 AAGTCACATATTAAGAAGCTGGG + Intergenic
1158120320 18:54041678-54041700 TATTAACATTTTAAGATGCTTGG + Intergenic
1158219137 18:55131969-55131991 AAGTCTTCTTTTAAAATGCTTGG + Intergenic
1158544857 18:58387562-58387584 AAGTAATATTTTAATATTCTTGG + Intronic
1158881729 18:61785350-61785372 GAATCATAATTTCAGAGGCTGGG - Intergenic
1159230644 18:65604299-65604321 GAGTCGTATTTTGATATGCTAGG - Intergenic
1159537267 18:69729951-69729973 GAAACATATGTTAAGATGATGGG + Intronic
1164088059 19:21921977-21921999 GAGTCATATCACAAGGTGCTGGG - Intergenic
925121946 2:1426056-1426078 AAGTCATTTTTCTAGATGCTGGG + Intronic
925710858 2:6738952-6738974 CAGTCACATTTTGAGGTGCTAGG - Intergenic
925860380 2:8169643-8169665 TAGTCATATTATTAGATGCCAGG + Intergenic
926071548 2:9897736-9897758 GAGTCAGGTTTGAAGATTCTGGG - Intronic
926249306 2:11144740-11144762 GAGACTGATTTGAAGATGCTAGG - Exonic
926781746 2:16479007-16479029 GAGTCATAGTCTAAGGTGTTGGG - Intergenic
927529069 2:23776946-23776968 CAGTCATATTTTAAGGTACTGGG - Intronic
928395854 2:30942864-30942886 CAGTCACATTCTAAGATACTGGG - Intronic
930041980 2:47132281-47132303 GAGTTATATTATAAAATCCTAGG + Intronic
930173423 2:48275610-48275632 AAGTCATATTTTGAGGTACTTGG - Intergenic
930891718 2:56396898-56396920 GAGTCACAGTTTAGCATGCTGGG - Intergenic
931701834 2:64915419-64915441 GTTTGATATTTTAAGCTGCTGGG + Intergenic
931714424 2:65017863-65017885 CAGTCATATTTTAAGTATCTTGG + Intronic
932308607 2:70721924-70721946 GGGTCATATTTTAAGATTTGTGG - Intronic
936051114 2:109224259-109224281 AAGTCTTATTTTACTATGCTTGG - Intronic
936818486 2:116489240-116489262 GAGTCACATTATGAGGTGCTGGG - Intergenic
938628374 2:133137288-133137310 GAATCAGATTTTGAGATGCAAGG + Intronic
939040336 2:137181567-137181589 GAGGCATATTTACAGAGGCTGGG + Intronic
940329718 2:152461293-152461315 GAATGATATTTTAATATACTGGG - Intronic
940939936 2:159548548-159548570 CACTGATTTTTTAAGATGCTAGG - Intronic
941565967 2:167108399-167108421 TGGTCCTATTTTAAGATCCTAGG - Intronic
941886668 2:170535203-170535225 GAGACAAATTTAAAGGTGCTCGG + Intronic
943426521 2:187743791-187743813 CAGTCATATTTTAATATACTGGG + Intergenic
944622876 2:201536034-201536056 GAGTCTGCTTTTAAAATGCTTGG + Exonic
944732288 2:202528893-202528915 AAGTTATATCTGAAGATGCTGGG - Intronic
944847970 2:203687956-203687978 AAGTAATATTTTGAGATACTTGG - Intergenic
945792289 2:214319952-214319974 GAGTAACATTTTAAGATGTGAGG - Intronic
946804235 2:223454104-223454126 CAGTCATATTTTAAAGTACTGGG - Intergenic
947106134 2:226669767-226669789 GGGTATTATTTTAAGAAGCTCGG - Intergenic
1169045229 20:2529826-2529848 AAGTCATATTGTAAAATGCTGGG + Intergenic
1171009706 20:21502404-21502426 TGGTCACATTTTAAGATACTGGG + Intergenic
1174116217 20:48228225-48228247 GAGTTATATTTTGCTATGCTTGG - Intergenic
1175784093 20:61701291-61701313 AAGTCACATTATGAGATGCTGGG + Intronic
1176872512 21:14095172-14095194 GAGGCAGCTTTTAGGATGCTGGG - Intergenic
1177148687 21:17432979-17433001 CAGTCACATTTTAAGGTACTTGG - Intergenic
1178135794 21:29625955-29625977 TAGTCACATTCTAAGCTGCTGGG - Intronic
1178704594 21:34862756-34862778 AAGCCATATTTTAAGGTTCTAGG + Intronic
1178773047 21:35523464-35523486 CATTCATATTGTAAGATGCTAGG + Intronic
1179178773 21:39027881-39027903 CAGTGGTAGTTTAAGATGCTAGG - Intergenic
1181389026 22:22565778-22565800 GGGTGTTATTTTAAGGTGCTAGG - Exonic
1182026980 22:27127868-27127890 AAGTCATGTTTTCAGAAGCTGGG - Intergenic
1182510269 22:30814754-30814776 GAGTCACATTCTGAGATCCTGGG + Intronic
1184020889 22:41820725-41820747 GACTCATTTTTTCAAATGCTTGG + Intronic
1184133038 22:42529161-42529183 GAGTCATATTTTAGGTTGTATGG - Intergenic
949299327 3:2565247-2565269 TATTCATATTTTCAGATGCTTGG + Intronic
949345124 3:3069246-3069268 GACTCATATATGAAGATGTTAGG + Intronic
950851015 3:16062391-16062413 GAGTTATATTTTAATGAGCTTGG - Intergenic
954346099 3:50000722-50000744 GAGCCTTCTTTTAAGATTCTGGG - Intronic
955402285 3:58600967-58600989 GAGTCTTAGGTTAAGAGGCTTGG - Intronic
955971149 3:64439818-64439840 GAGTTACATTTTTAGATGGTTGG - Intronic
956577649 3:70771470-70771492 CAGTCATATTCTAAGTTACTGGG - Intergenic
957164825 3:76658817-76658839 GAGTCATATCTTTTCATGCTAGG + Intronic
959502963 3:107127632-107127654 GACTAATATTTCAAGAAGCTTGG + Intergenic
959861267 3:111217500-111217522 GATTTATATTTTTAAATGCTTGG - Intronic
961100786 3:124197220-124197242 GAGACAAAGTTTAACATGCTAGG - Intronic
963731479 3:148977922-148977944 GAGGCATCTGTTAAGATGTTTGG + Intergenic
963830724 3:150006137-150006159 GAGCAATATAATAAGATGCTTGG + Intronic
964606009 3:158561066-158561088 GGGTCATATTTTAAAATTCCAGG - Intergenic
965191813 3:165540297-165540319 GAGTGTTTTTTTAAGCTGCTAGG + Intergenic
967154800 3:186682559-186682581 GAGTCATATTTTAGGTTTCATGG + Intergenic
967224847 3:187281498-187281520 CAGTGATATTTTAAGTTTCTTGG + Intronic
967467962 3:189829233-189829255 GAATCCTCTTTTAAGATGGTTGG - Intronic
967521242 3:190435441-190435463 TAGTCATATTCTGAGATACTGGG + Intronic
967616384 3:191573200-191573222 CAGTCATATTTTGAGATACTGGG - Intergenic
968401453 4:301971-301993 GTGTCAGATTTGAAGATGCCAGG + Intronic
971368189 4:25994245-25994267 GAGTCTTATTTTGAGGTTCTGGG - Intergenic
971588733 4:28439391-28439413 ATGTCATATTTTAAGTTGGTTGG - Intergenic
972019315 4:34290039-34290061 GCATAAAATTTTAAGATGCTAGG - Intergenic
972359743 4:38315886-38315908 AAGTCACATTCTGAGATGCTGGG - Intergenic
975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG + Intronic
976323709 4:83747375-83747397 CAGTCACATTTTGAGATGCTGGG - Intergenic
976445447 4:85125916-85125938 CAGTCACATTGTTAGATGCTGGG + Intergenic
976832507 4:89331164-89331186 TAGTCACATTTTGAGATCCTGGG + Intergenic
976917705 4:90398283-90398305 CAGTCATATTCTAAGGTACTGGG + Intronic
977655107 4:99512537-99512559 GATATACATTTTAAGATGCTGGG + Intronic
979039977 4:115777329-115777351 GAGTCATATATTACTTTGCTTGG - Intergenic
980640200 4:135566957-135566979 AAGTGATATATTAATATGCTGGG + Intergenic
981271471 4:142850981-142851003 CAGTCATATTCTGAGATACTGGG + Intergenic
981508961 4:145533930-145533952 CAGTCATATTCTATGGTGCTTGG - Intronic
981913850 4:150012697-150012719 GAGTCAGATTTTAAAATGGATGG - Intergenic
982262604 4:153508090-153508112 GAATCATATTTAATGATGTTAGG + Intronic
983327985 4:166284912-166284934 TGGGCTTATTTTAAGATGCTTGG + Intergenic
983833092 4:172355910-172355932 TAGGTAGATTTTAAGATGCTTGG - Intronic
983847150 4:172534348-172534370 CAATCATATTTTAAGATTCCAGG + Intronic
984349852 4:178576646-178576668 TAGCCATATTTTAAGAGGCTGGG + Intergenic
984407668 4:179354558-179354580 GTGGGATATTTTATGATGCTTGG - Intergenic
985008854 4:185561950-185561972 GAGTCATATTTTGATATCTTCGG + Intergenic
986095792 5:4553061-4553083 GAGTTAAATTTTGAGTTGCTTGG + Intergenic
986614425 5:9601947-9601969 GAGTCACATTTTGAGATACTAGG - Intergenic
986720558 5:10558148-10558170 GAGGCATCCTTTTAGATGCTGGG + Intergenic
987014850 5:13807821-13807843 GAATCACATTTTAAGGTACTAGG - Intronic
991450828 5:66748931-66748953 TAGTTAGATTTTAAGATGCTAGG + Intronic
994349829 5:98732167-98732189 GAATCATATTTTAAAAATCTGGG - Intergenic
995477792 5:112564995-112565017 GAATGAGATTTTCAGATGCTGGG + Intergenic
995784185 5:115811037-115811059 GAGTCATGATTTAAAATACTTGG - Intronic
995791995 5:115898809-115898831 GATTCATATTTTAGGATTTTAGG - Intronic
996263798 5:121509188-121509210 CAGTCACATTTTAAGATACTAGG + Intergenic
1000359648 5:160435079-160435101 CAGTCATATTCTGAGGTGCTGGG + Intergenic
1000613952 5:163407454-163407476 GAGTCATTTTTTAATATTTTTGG - Intergenic
1002919060 6:1553207-1553229 GTGTCTTATTTTAAAATGTTAGG + Intergenic
1003249877 6:4417090-4417112 TAGTCATATTCTGAGATGTTGGG + Intergenic
1003585036 6:7381164-7381186 GAGTCATGTTTTAAGGTACTAGG - Intronic
1003675605 6:8201807-8201829 GAATGATATTTTAAGCAGCTTGG - Intergenic
1003856909 6:10285833-10285855 CAGTCACATTTTGAGATACTGGG - Intergenic
1004581087 6:16953558-16953580 GGATTATGTTTTAAGATGCTGGG + Intergenic
1004729636 6:18345254-18345276 CAGTCACATTTTGAGGTGCTAGG + Intergenic
1005027480 6:21477281-21477303 AGGTCATATTCTAAGATACTGGG + Intergenic
1005167686 6:22943882-22943904 GAGTCATATCATTAGATGCCTGG + Intergenic
1010589219 6:77693328-77693350 TAGTCATAGTTTAAGATTCCTGG - Intronic
1010636301 6:78262742-78262764 CAGTCAGATTTTACGATGCTGGG - Intergenic
1010840429 6:80643479-80643501 AAGTCATTTTTTAACATCCTTGG - Intergenic
1012007899 6:93738423-93738445 GAAAAATATTTTTAGATGCTGGG - Intergenic
1012027688 6:94018519-94018541 AAGTCATATTCTGAGATTCTGGG + Intergenic
1012895760 6:104945859-104945881 GAGTAATAATTTAAGATGACTGG - Intergenic
1013732455 6:113184749-113184771 TAGTCATATTCTAAGGTACTGGG + Intergenic
1013786681 6:113789193-113789215 AAGTCACATTTTAAGGTACTAGG + Intergenic
1016742781 6:147546173-147546195 AGGTCATGTTTTAAGATGATAGG - Intronic
1017340467 6:153315664-153315686 GAATCATTTTTTGAGATGATCGG - Intergenic
1018355003 6:163004371-163004393 GACTCATAGTTCAACATGCTGGG + Intronic
1018799221 6:167209879-167209901 TAGTCATATTTTGAGATACCTGG + Intergenic
1020205379 7:6110423-6110445 GAGTCCTATTTTAAAATATTAGG - Intronic
1021551143 7:21872208-21872230 CAGTCACATTATGAGATGCTGGG + Intronic
1023884403 7:44342521-44342543 CAGTCACATTCTAAGGTGCTGGG - Intergenic
1024436642 7:49364368-49364390 GAGTCATGTATTAATTTGCTAGG + Intergenic
1024699196 7:51888695-51888717 GAATTTTATTTTAAAATGCTGGG - Intergenic
1024827124 7:53403864-53403886 CAGTCATATTATAAGGTACTGGG - Intergenic
1027289310 7:76685998-76686020 CAGTCATATTCTAAGGTACTTGG + Intergenic
1027771320 7:82410110-82410132 GTGTAATAGTTTAAGATGCACGG - Intronic
1027778647 7:82496914-82496936 TAGTCATATTTTGAGGTACTGGG + Intergenic
1027979129 7:85194975-85194997 CAGTCACATTTTGAGGTGCTAGG + Intergenic
1028083180 7:86602006-86602028 AAATCATATTTTAGGATGTTAGG + Intergenic
1030226040 7:107152171-107152193 GAGTCATCTTTTAAAATCCCTGG + Intronic
1030591069 7:111482546-111482568 GAGTCAAATTTATAGCTGCTAGG - Intronic
1030649996 7:112107258-112107280 CAGTCATATTCTAAGATACCAGG - Intronic
1031313345 7:120227317-120227339 TGGTCATATTTTAAGGTACTGGG + Intergenic
1031346446 7:120672737-120672759 CAGTCATATTTTAAAATACTGGG - Intronic
1033469231 7:141629415-141629437 CAGTCAAATTTTGAGATGGTTGG - Intronic
1036637126 8:10558948-10558970 GAGTCATATTTTAGTGTGCGTGG + Intergenic
1037026311 8:14042632-14042654 AAGTCATATTTTGAGATTCTGGG - Intergenic
1037156995 8:15713793-15713815 GAGTCATATTCTGAGGTACTGGG + Intronic
1038109319 8:24478054-24478076 GAGTATTGTTCTAAGATGCTAGG - Intronic
1040693563 8:49969186-49969208 GAATAATTTTTTAAGAGGCTTGG + Intronic
1040819293 8:51537343-51537365 AAGTCATGTTTTAAGAGGATAGG - Intronic
1041353764 8:56977576-56977598 AAGTCAGATTTCAAGGTGCTGGG - Intronic
1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG + Intergenic
1041663031 8:60417238-60417260 GATAAATATCTTAAGATGCTTGG - Intergenic
1041758559 8:61339346-61339368 GAGTCAGGTTTTAATACGCTTGG + Intronic
1041857438 8:62474088-62474110 CAGTCAGATTTTAAGCTCCTTGG + Intronic
1042476287 8:69251835-69251857 GAGCCATATTTTATAATGATTGG - Intergenic
1043206226 8:77445232-77445254 GAGCCATAGGTTCAGATGCTGGG - Intergenic
1043788647 8:84434296-84434318 GAGTCATATTTTGAGATATCGGG + Intronic
1043849650 8:85201327-85201349 GAGCCACATTTTAAGATCCATGG - Intronic
1044107580 8:88230352-88230374 GAGTTATCTTTTAAAATGTTAGG - Intronic
1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG + Intronic
1045521544 8:102907261-102907283 GCCTCATACTTTATGATGCTTGG + Intronic
1045611100 8:103843092-103843114 TAGTCACATTCTGAGATGCTGGG + Intronic
1045655297 8:104380961-104380983 GAGTCATTCTTTAAGATGTTAGG - Intronic
1046951551 8:120024434-120024456 GAGTCAGATTTTGAGGTACTCGG - Intronic
1048200938 8:132373408-132373430 GAATCATATAATAAGATGCTGGG + Intronic
1048909644 8:139122829-139122851 TAGGCATATTTCATGATGCTTGG + Intergenic
1050623475 9:7478677-7478699 AAGTCTTATTTTAATATGCCAGG + Intergenic
1051318603 9:15873356-15873378 AAGTTATATTTGAAGTTGCTTGG + Intronic
1051379984 9:16447413-16447435 GATTCATATGTTCAGATTCTAGG - Intronic
1052674676 9:31605082-31605104 CAGTCATGTTTTGAGGTGCTAGG - Intergenic
1055151586 9:73006926-73006948 GAGGCATAATTTAATATACTGGG - Intronic
1055156058 9:73064805-73064827 GAGTCATTTTTTTTTATGCTTGG - Intronic
1057045435 9:91882642-91882664 CAGTCATATTTTGAGGTCCTGGG - Intronic
1057908820 9:99002633-99002655 GAGTCTCATTTTAACATCCTGGG + Intronic
1057975404 9:99600838-99600860 GAGTCATATTCTGAGGTGCCAGG - Intergenic
1058423522 9:104856204-104856226 GAGTCACATTTCAAAATGTTTGG + Intronic
1058491977 9:105512004-105512026 GAGTTATATTTTAAGATAAAAGG + Intronic
1058543462 9:106036164-106036186 CAGTCCTTTTTAAAGATGCTTGG - Intergenic
1060380707 9:123168370-123168392 GAGTCATATTTTAAAATCAAAGG - Intronic
1060429152 9:123533898-123533920 AAGTCATATTTCAAGATCCTTGG + Intronic
1186596033 X:10982548-10982570 CAGTCATATTCTAAGATACTGGG - Intergenic
1187053162 X:15714308-15714330 CAGTCACATTTTAAGGTACTGGG + Intronic
1188001103 X:24982845-24982867 GAGCCATATTTTAAAATTCAGGG + Intronic
1188848485 X:35103306-35103328 GCTTCAGAATTTAAGATGCTTGG - Intergenic
1192451364 X:71247153-71247175 GAGTCTTATTTAAAGCTTCTTGG - Intronic
1193758109 X:85433661-85433683 CAGTCACATTTTGAGATGCTAGG - Intergenic
1193999871 X:88414501-88414523 CAGTCATATTCTGAGATTCTAGG + Intergenic
1194299880 X:92172816-92172838 GAGTCTTATTTTTACATGCATGG + Intronic
1194599186 X:95899567-95899589 CAGTCATATTTTTAGGTACTGGG + Intergenic
1194687771 X:96945289-96945311 GAAATATATTTTTAGATGCTTGG + Intronic
1197170391 X:123427387-123427409 GAGTTTTTTTTTAAGATCCTAGG + Intronic
1198364842 X:135929897-135929919 GCATCATATTTTAAGATGAAAGG + Intergenic
1198615502 X:138454017-138454039 AAGTCACATTTTAAAATGCCAGG - Intergenic
1198635633 X:138696697-138696719 CAGTCATATGTTAACATTCTTGG - Intronic
1198657903 X:138934770-138934792 GAGTCAAATGTCAAAATGCTGGG - Intronic
1198843478 X:140883701-140883723 AGGTCATATTTTAAGGTACTGGG + Intergenic
1199038770 X:143085206-143085228 GAGTCATATTTGAAAATAATAGG - Intergenic
1199419821 X:147631954-147631976 CAGTCATATTCTGAGTTGCTGGG + Intergenic
1200617551 Y:5398113-5398135 GAGTCTTATTTTTACATGCATGG + Intronic
1200890735 Y:8321192-8321214 GAGTCATACACTCAGATGCTGGG - Intergenic
1201242716 Y:11974173-11974195 CAGTCATATTTTGAGTTCCTGGG + Intergenic
1201678063 Y:16610264-16610286 TGGTCATATTCTAAGATACTGGG - Intergenic
1202265449 Y:23013138-23013160 GAGTCACATTTTTAGATCATGGG - Intergenic
1202418442 Y:24646880-24646902 GAGTCACATTTTTAGATCATGGG - Intergenic
1202452344 Y:25023206-25023228 GAGTCACATTTTTAGATCATGGG + Intergenic