ID: 1150524419

View in Genome Browser
Species Human (GRCh38)
Location 17:65907374-65907396
Sequence TGTTAGTTTGATATTTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150524419 Original CRISPR TGTTAGTTTGATATTTTGCC AGG Intronic
900170403 1:1265353-1265375 TGGTATTTTGGTATTTTGGCAGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905074869 1:35261539-35261561 GGTGAGTTAGATATTTTGCATGG - Intergenic
905416368 1:37807519-37807541 TGTTTGTTTGCTTTTTTCCCGGG + Intronic
905954524 1:41981250-41981272 TGTTATTTCGATGTTTTACCAGG - Intronic
906015814 1:42578823-42578845 TATTTTTTTGATCTTTTGCCAGG - Intronic
906336118 1:44932812-44932834 TATTTGTTTCATATTTTGGCTGG - Intronic
907196914 1:52694497-52694519 TGTTACATGGATATATTGCCTGG - Intronic
908691235 1:66782260-66782282 TGTTAGCTGGTTATTTTGCTTGG - Intergenic
908937471 1:69393484-69393506 TGTTAGCTGGTTATTTTGCTTGG + Intergenic
909068242 1:70962252-70962274 TTTTAATTTGTTATTTTTCCTGG + Intronic
909897089 1:81085092-81085114 TGGTAGTTTGATATTTTCAGAGG + Intergenic
912892237 1:113546631-113546653 TGTAAGTGTGATATTTTGGCTGG - Intronic
913457179 1:119045133-119045155 TGTGAGTTTGAACTGTTGCCTGG + Intronic
916722085 1:167492145-167492167 TGTTTGTTTGTTTTTTTGCCTGG - Intronic
917050469 1:170916691-170916713 TATTAGTTTATTAGTTTGCCAGG - Intergenic
917855510 1:179096024-179096046 TGTTTGTTTGAAATTTTGCTAGG - Intronic
917947795 1:179994095-179994117 TGTAAATTTGAAATTTTTCCTGG - Intronic
919171953 1:193965734-193965756 TGTTAGTTTGGCATTGAGCCTGG - Intergenic
919253584 1:195093302-195093324 TTTTTGTTCTATATTTTGCCAGG - Intergenic
920696036 1:208181872-208181894 TCTTATTTTGAAATTTTGCTAGG + Intronic
923804338 1:237242209-237242231 TGTTTGTTTGTTTGTTTGCCAGG + Intronic
923906661 1:238392549-238392571 TTTTAGTTTGATTATTTGTCAGG - Intergenic
1063265063 10:4439172-4439194 TTTTAGTTTAATATTTTACCTGG - Intergenic
1063894847 10:10668950-10668972 TGTTTGTTTGTTTTTTTGTCAGG - Intergenic
1064526190 10:16259402-16259424 TGTTTGTTTGTTTTTTTGACAGG + Intergenic
1064582992 10:16812615-16812637 TATTTGTTTATTATTTTGCCTGG + Intronic
1066458350 10:35591419-35591441 TGATAGTTTGAGCTTTTACCTGG + Intergenic
1067320993 10:45220740-45220762 TATTTGTTTATTATTTTGCCTGG + Intergenic
1068482722 10:57614123-57614145 TTTTAGTTTGATATAATCCCAGG - Intergenic
1069338629 10:67384568-67384590 TGTTTGTTTGATAAATTCCCAGG + Intronic
1071202654 10:83237790-83237812 TGTTACTTTGAAATGTAGCCTGG + Intergenic
1072116184 10:92372460-92372482 TTTTAATTGGATATTTTGTCTGG - Intergenic
1072649102 10:97279784-97279806 TATTAGTTTGAAATTTGGGCTGG - Intronic
1073979702 10:109141055-109141077 TGTTAATTTAATATTTTTTCGGG + Intergenic
1076453846 10:130575768-130575790 TGTTTGTTTGTTACTTTGCTTGG - Intergenic
1081746482 11:45476348-45476370 TTGAAGTTTGATCTTTTGCCAGG + Intergenic
1081883455 11:46474207-46474229 AGTCAGTTTGATATTTTTCCTGG + Intronic
1086119689 11:83293248-83293270 TGTTAATTTCACATTTTGCATGG + Intergenic
1086555684 11:88108689-88108711 TGCTAGCTGGTTATTTTGCCTGG + Intergenic
1087379378 11:97385228-97385250 TGCAAGTTTGATCATTTGCCTGG - Intergenic
1089476015 11:118762632-118762654 TTTAAGATTGATATTTTTCCTGG - Intronic
1091359631 11:134966529-134966551 TGTTAATTTGATATATTTCAGGG - Intergenic
1091859475 12:3767054-3767076 GGTTAATTTGATATGTTGACGGG - Intergenic
1092728302 12:11505633-11505655 TGTTTGTTTGATCTTGTGCATGG + Intergenic
1095287333 12:40429902-40429924 TGTTAGGTTGTTTTTTTGCAAGG - Intronic
1095387687 12:41670352-41670374 TGTTAGCTGGTTATTTTGCTCGG + Intergenic
1095446233 12:42285673-42285695 TAATAGTTTGACATTTTTCCAGG + Intronic
1097344406 12:58475452-58475474 TGTTAGCTGGTTATTTTGCTCGG + Intergenic
1097533246 12:60832753-60832775 AGTTAGTATTATATTTTGCCTGG + Intergenic
1098497146 12:71149816-71149838 TGTTATTTTGTTCTTTTGCAAGG - Intronic
1098993701 12:77094493-77094515 TGTTAGCTGATTATTTTGCCTGG + Intergenic
1099020852 12:77402364-77402386 AGTTAGTTTACTATTTTGCAAGG + Intergenic
1102586360 12:113925849-113925871 TGTTAGTTTTATTTTTTTTCTGG - Intronic
1103357033 12:120329273-120329295 TGTTATGTAGATATTTGGCCGGG - Intergenic
1103891677 12:124243617-124243639 TGTTTGTTTGTAATTTTGTCAGG + Intronic
1106099837 13:26684612-26684634 TGTGATTTTGATATTTTGGGTGG + Intronic
1106702621 13:32246272-32246294 TGTTATTATTATTTTTTGCCTGG - Intronic
1106928262 13:34635611-34635633 TGTCAGCTTCATATTCTGCCAGG - Intergenic
1107364708 13:39657635-39657657 TGTTATTTTGAAATATTGGCTGG - Intronic
1108957130 13:56173396-56173418 TGTTTGTTTGTTTTTTGGCCAGG + Intergenic
1109212053 13:59546560-59546582 TGTTTGTTTGATAATATGGCTGG - Intergenic
1109690544 13:65882205-65882227 AGTTAGTTTGATATATGCCCAGG + Intergenic
1111577446 13:90174825-90174847 TGTTATTTTTATGTTTTACCTGG + Intergenic
1112021241 13:95373107-95373129 TGTTTGTTTGTTTGTTTGCCGGG + Intergenic
1112246483 13:97739309-97739331 TGTTAGTTTGGTATCTTCCATGG + Intergenic
1119196642 14:72722183-72722205 TGTTTGTTTGATTTTTTTTCTGG - Intronic
1121747268 14:96307403-96307425 TGTTTGTTTGTTTTTTTGACAGG - Intronic
1125268483 15:37912106-37912128 TCTTAATTTGATATTTTGGCAGG + Intergenic
1128507289 15:68283091-68283113 GGTCAGTTTAATATTTTTCCTGG - Intronic
1129083500 15:73063644-73063666 TGTTTGTTTGTTTTTTGGCCAGG + Intronic
1131168504 15:90160008-90160030 TGTTTGTTTGTTTTTTTGCGGGG + Intergenic
1131315928 15:91337460-91337482 TGTAAGGTTAATAATTTGCCTGG - Intergenic
1131775873 15:95798050-95798072 TTTTTTTTTGCTATTTTGCCAGG + Intergenic
1134270961 16:12732784-12732806 TGATAGTTTGATAGTTTGGCTGG - Intronic
1135179345 16:20259415-20259437 TGTTTGTTTGTTTGTTTGCCAGG + Intergenic
1136189974 16:28609753-28609775 TGTTTGTTTGTTTTTTTCCCCGG - Intronic
1139042950 16:63020741-63020763 TAGTAGTTTAATATTTTGCAGGG + Intergenic
1144253824 17:13445840-13445862 TGTTTGTTTGTTTTTTTGACAGG + Intergenic
1147486085 17:40815996-40816018 TGATGGCTTGATATTTTGCTTGG - Intergenic
1150524419 17:65907374-65907396 TGTTAGTTTGATATTTTGCCAGG + Intronic
1154288378 18:13082668-13082690 TGTTAGCTGGTTATTTTGCCTGG + Intronic
1155230472 18:23769088-23769110 TGTTAGCTGGATATATTGCATGG - Intronic
1155881221 18:31150742-31150764 TGTCATTTTGATATTTTAGCTGG + Intronic
1157056721 18:44238057-44238079 TTCTAGTTTGATAATCTGCCAGG - Intergenic
1158450738 18:57562072-57562094 TGTTAGTAGGGTTTTTTGCCGGG + Intronic
1159000681 18:62972136-62972158 TTTTAGTTTTCTATTTTGGCTGG + Intronic
1159222817 18:65487335-65487357 CGTAAGTTAGATATTTTGCATGG - Intergenic
1160288634 18:77570120-77570142 TGATATTTTGGTATTTTGGCAGG - Intergenic
1160341754 18:78095240-78095262 GGTTAGTTTGATTTTTAACCAGG - Intergenic
1160654440 19:256270-256292 TGTAAGGTTAATATTTTTCCTGG - Intergenic
1162611659 19:11759891-11759913 TGTGGCTTTGATCTTTTGCCTGG - Intergenic
1163778139 19:19229971-19229993 TGTTAGTTTGATTTCATGCAGGG - Intronic
1164204990 19:23050874-23050896 TGTAACTTTCATCTTTTGCCTGG - Intergenic
1164738176 19:30557681-30557703 TGCTAGTTTAATATTGTGTCAGG + Exonic
1166211714 19:41310618-41310640 TGTTAATTTGAGAGTTAGCCTGG - Intronic
925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG + Intronic
925422262 2:3722381-3722403 TGTTACCTAGATATTTTGCCTGG + Intronic
925998460 2:9311088-9311110 TGTTATTTTGAAAGATTGCCTGG + Intronic
926560359 2:14410024-14410046 TTTTATTTTGATATGTTTCCAGG - Intergenic
927358055 2:22196712-22196734 TTTTTCTTTGATATTTTTCCAGG - Intergenic
929482221 2:42320914-42320936 AGTAAGTTTGCTTTTTTGCCAGG + Intronic
930363243 2:50408290-50408312 TATTAGTGTGATCTTGTGCCAGG - Intronic
932061133 2:68499147-68499169 TTTTAGTTTCATTTTTTGCAGGG + Intronic
934868634 2:97838759-97838781 TGTTTGTTTGTTTTTTTGGCAGG + Intronic
934999034 2:98993235-98993257 TGTTTGCTTGATATTTTGATTGG - Intergenic
939789316 2:146552014-146552036 TGTTTGTTTGGTTTTTTTCCAGG - Intergenic
939916781 2:148054943-148054965 TTTTAGATTTAAATTTTGCCAGG + Intronic
940472757 2:154120074-154120096 TGTTTGTTTGTTTTTTTGTCAGG + Intronic
941560064 2:167033772-167033794 TGTTTGAATGATATTTTCCCAGG - Intronic
942499184 2:176570357-176570379 TGTGAGAATGAAATTTTGCCTGG + Intergenic
942548364 2:177088840-177088862 TATTACTTTGGTATTTTTCCTGG - Intergenic
943460113 2:188162517-188162539 TTTTTGTTTGTTATTTTGCTGGG - Intergenic
943477142 2:188370887-188370909 TGTTGGTTTGATTTTTGGCAGGG + Intronic
943986219 2:194622561-194622583 TGTCAATTAGATATTTTGGCTGG + Intergenic
945581544 2:211601699-211601721 TACTTGTTTGATAGTTTGCCTGG - Intronic
947395839 2:229686133-229686155 TATTATTTTCATACTTTGCCAGG + Intronic
1170107293 20:12765319-12765341 TGTTAGATTCATATTCTGCGTGG - Intergenic
1171454815 20:25262572-25262594 TGTTAGCTGGTTATTCTGCCCGG - Intronic
1173520691 20:43698034-43698056 TGTTAATTTGTTATTTGGCTTGG + Intronic
1174249026 20:49204466-49204488 TGTTATTTTTATATTTACCCAGG + Intergenic
1175850139 20:62086034-62086056 TGATATTTTGATGTTTTACCAGG + Intergenic
1178236039 21:30842176-30842198 TGTTCGTTTGTTTTTTGGCCGGG - Intergenic
1178831050 21:36056851-36056873 GGTTAGGTTAACATTTTGCCAGG - Intronic
1178902737 21:36610475-36610497 TGTTAGTTTGACATTTGGTTTGG - Intergenic
1183065626 22:35360809-35360831 TGTTACATGGATATATTGCCTGG + Intergenic
1183767306 22:39890661-39890683 TATTATTTTGATATTTTTCTGGG - Intronic
1184813001 22:46849897-46849919 TGTTAGTTATGTATTTAGCCAGG + Intronic
949155571 3:823005-823027 TGTCAGTTCAATATTTTGCCAGG + Intergenic
949342728 3:3046723-3046745 TGTTAGCTGGTTATTTTGCTCGG - Intronic
949643280 3:6064639-6064661 TTTTTGTGTGAGATTTTGCCAGG + Intergenic
951668700 3:25156016-25156038 TGTGTGCTTGATTTTTTGCCTGG + Intergenic
951810667 3:26695513-26695535 TGTTTGTTTGAGATGTTGTCTGG - Intronic
951857957 3:27218703-27218725 TGTTAATATGATGTTTTACCTGG - Intronic
952651497 3:35732681-35732703 TGTTATTTTGATATTTTTCTTGG + Intronic
956646370 3:71461301-71461323 TGTTAGTTTGACTTTTTACACGG - Intronic
956857755 3:73292619-73292641 TGATATTTTGATATTTTGTCTGG + Intergenic
957966932 3:87333998-87334020 TGTGAGTTTGTATTTTTGCCTGG - Intergenic
958780465 3:98535227-98535249 TGTTAGTTTGAAAATTTGTAAGG - Intronic
959114741 3:102163343-102163365 TGTTTGTGTGATACTTTGGCAGG + Intronic
965209254 3:165763841-165763863 TGTTTGTTTGTTGTTTTGTCTGG + Intergenic
966708653 3:182947682-182947704 TGTTTGTTTGTTATTTTTGCAGG - Intronic
967615113 3:191555785-191555807 TGTTTGTTTGTTTTCTTGCCTGG + Intergenic
967694778 3:192517078-192517100 TGTTCATTTGCTATTTTTCCAGG - Intronic
971135353 4:23862745-23862767 TTTGAGTTTGATAATTCGCCAGG - Intronic
971429841 4:26554555-26554577 TGCTAGCTGGTTATTTTGCCTGG + Intergenic
974142230 4:57901968-57901990 TGTATGTTTTATATTTTGGCAGG + Intergenic
974751482 4:66146950-66146972 TCTGAGTTTTATATTTTGTCTGG + Intergenic
974756231 4:66211209-66211231 TGTTTGTTTTGTTTTTTGCCGGG - Intergenic
974781107 4:66554319-66554341 TGTTAGTTTGTTAGCTTTCCTGG - Intergenic
975075306 4:70199716-70199738 TGTGAGTTTGATTCTTAGCCAGG + Intronic
975807869 4:78132135-78132157 TTTTATTTTTATTTTTTGCCAGG + Intronic
976788587 4:88851301-88851323 TTTTAGCTTGATATTTTTCTGGG - Intronic
977345744 4:95814008-95814030 TGTTAGTTTGCTCTTTTAGCTGG + Intergenic
977523705 4:98119285-98119307 GGTTTGTTTAATATTTTGGCAGG - Intronic
977561118 4:98535078-98535100 TGCTAGCTGGTTATTTTGCCTGG + Intronic
977796698 4:101174099-101174121 TGTTAGTTTGTTTTTCTGGCGGG - Intronic
979398105 4:120213880-120213902 TGTTTATTTGATATTTTGAAAGG + Intergenic
979961595 4:127027095-127027117 TTTTAATTTAATATTTTGGCTGG - Intergenic
981789427 4:148519952-148519974 TGCTAGCTGGTTATTTTGCCTGG + Intergenic
983304753 4:165972017-165972039 TTTTAAGTTGATATCTTGCCTGG + Intronic
984159357 4:176232420-176232442 TGTTGGTTTAATATTTTACAGGG - Intronic
984282554 4:177689462-177689484 TGTTTGTTTCATATTTTTCCTGG + Intergenic
985468201 5:18134-18156 TGTAAGGTTAATATTTTTCCTGG - Intergenic
987413732 5:17640960-17640982 TGTTATTTAGGTCTTTTGCCAGG + Intergenic
987537848 5:19209984-19210006 TGTTTGATGGATATTTTGACTGG - Intergenic
988091757 5:26550965-26550987 TGTTTATTTGATATTTTTTCAGG - Intergenic
988165786 5:27588144-27588166 TTTTATTTTGATATTTATCCAGG + Intergenic
989792695 5:45425154-45425176 TGTTGATTTTATATTATGCCCGG - Intronic
990220004 5:53577624-53577646 TTATAGTTTGATATTTTCCCAGG + Intronic
991059033 5:62351856-62351878 TGTAAAATTTATATTTTGCCGGG + Intronic
991222477 5:64232869-64232891 TGGAAGTTAGATATTTTGTCTGG + Intronic
991320922 5:65372201-65372223 TGTTAGCTGGTTATTTTGCTCGG - Intronic
991607444 5:68417572-68417594 TCCTAGTTTGTTGTTTTGCCTGG + Intergenic
992060541 5:73041071-73041093 TGTTTGTTTTTTATTTTGTCAGG + Intronic
992109113 5:73475998-73476020 TCTTAGTTTCAGATTTTGGCTGG - Intergenic
993546810 5:89222003-89222025 TGTTAGCTGGTTATTTTGCTCGG - Intergenic
994151295 5:96450538-96450560 TGTTACATAGATATATTGCCTGG - Intergenic
994641463 5:102414988-102415010 TGTTAGTTTAATATATTCCTAGG - Intronic
994696399 5:103077880-103077902 TGCTATTTTGCTATTTTGCTTGG + Intergenic
996718650 5:126608999-126609021 TGTTTGTTTGTTTTTTTGTCAGG - Intronic
996755221 5:126927917-126927939 TATTATTTAGTTATTTTGCCTGG - Intronic
996973367 5:129399658-129399680 TGTTAGATGGATATTTTGGGTGG + Intergenic
997717958 5:136056204-136056226 TGTGAGTTTGTTTTCTTGCCCGG + Intronic
997768379 5:136527889-136527911 TGTCAGTTGGATATTTCACCTGG + Intergenic
1000667994 5:164022733-164022755 TGTTAATTTATGATTTTGCCTGG + Intergenic
1001958321 5:175863674-175863696 TTTTATTTTGTTTTTTTGCCAGG + Intronic
1002375465 5:178785714-178785736 TGTTTGTTTGATTTTTTGAGAGG - Intergenic
1003206007 6:4012486-4012508 AGTTGGTTTTATATTTTGTCTGG - Intergenic
1004653115 6:17631398-17631420 TGTTACATGGATATGTTGCCTGG + Intronic
1005731752 6:28704214-28704236 TGTTTGTTTGTTTTTTTGACTGG + Intergenic
1008099907 6:47379287-47379309 TGTTAGTTTGAATTTGTTCCTGG - Intergenic
1008463526 6:51804101-51804123 TTTTACTTTGAAATGTTGCCTGG - Intronic
1009638088 6:66292784-66292806 TATTAGTTTGCTAGTTTGCTAGG - Intergenic
1010483377 6:76380852-76380874 TGTTTGTTGGATATTTTCACTGG + Intergenic
1012118401 6:95333796-95333818 TGATAGTTTGCTACTTTTCCAGG + Intergenic
1012715483 6:102662982-102663004 TGTTTGTATGATATTTTCCCTGG - Intergenic
1013143345 6:107362525-107362547 TGTTAGTTTTATTACTTGCCTGG - Intronic
1013773367 6:113651501-113651523 TTTTAATTTGGTATTTTGGCCGG + Intergenic
1015013675 6:128382908-128382930 TGTTAGTTTCTTATTTTCGCAGG - Intronic
1015428046 6:133095318-133095340 TGTGAATTTGAAAGTTTGCCTGG - Intergenic
1017212227 6:151869537-151869559 TGTTGGTTTGATCCTTTGCCAGG + Intronic
1019834361 7:3367169-3367191 TTTTATTTTTATTTTTTGCCAGG + Intronic
1019836958 7:3397085-3397107 TGTATGTTTGAAATTATGCCAGG - Intronic
1020361923 7:7335982-7336004 TGTGAGGTTGAGATTTTGCCAGG - Intergenic
1020527659 7:9283484-9283506 TGTTAGTTTAAAATTAGGCCTGG + Intergenic
1020545849 7:9529139-9529161 TTTAATTTTGATATTTTTCCCGG - Intergenic
1021476573 7:21068325-21068347 TGGTAGTTTGATATTTGAACGGG - Intergenic
1021803760 7:24334573-24334595 TGTTATTTTGTTTTTTTGCAAGG - Intergenic
1022757413 7:33308127-33308149 TGTTAGTTTGATATTCTCAGAGG + Intronic
1024309392 7:47955211-47955233 TGTCATTTTGATGTTATGCCAGG - Intronic
1024433959 7:49326972-49326994 TGTCAATTAGATATTTTGGCTGG - Intergenic
1024458990 7:49640260-49640282 TTTTAGTTTGTTATTTTTCCTGG + Intergenic
1027122651 7:75532992-75533014 TATTAGTTTGATATTGGGCATGG - Intergenic
1027518067 7:79167421-79167443 TTTTATTTTGATGTTTTGCCTGG - Intronic
1027919121 7:84369150-84369172 AGTTGGTTTGAAGTTTTGCCTGG - Intronic
1028067336 7:86403313-86403335 CTTTTGCTTGATATTTTGCCAGG - Intergenic
1028124726 7:87099672-87099694 TGATATTTTGATATTTTGTTTGG + Intergenic
1028443994 7:90897846-90897868 TCTTTGTCTGACATTTTGCCTGG + Intronic
1028491758 7:91420377-91420399 TGCTAATATGATATATTGCCTGG - Intergenic
1031841511 7:126746125-126746147 TTTTATTTTGATATTTTCCCTGG - Intronic
1032990047 7:137383779-137383801 TGTTAGTTTCAAATTCTGCAGGG - Intronic
1033099532 7:138458939-138458961 TGTTTGTTTGTTTTTTTGCATGG - Intergenic
1033485317 7:141783497-141783519 TGTTTGTATAATAATTTGCCTGG + Intronic
1034927078 7:155131064-155131086 TTTAAGTTTGATAATTTGCTAGG + Intergenic
1035288704 7:157823267-157823289 TAATAATTTGTTATTTTGCCAGG - Intronic
1035514121 8:217700-217722 TGTAAGGTTAATATTTTTCCTGG - Intergenic
1036719321 8:11158266-11158288 TGTTACTTTTAAATTTTTCCTGG - Intronic
1037180283 8:15996634-15996656 TGTTAGTGTGTTATTTGGCAGGG + Intergenic
1038371571 8:26998207-26998229 TCTTATTTTGATATTTTGGCTGG + Intergenic
1040876432 8:52157220-52157242 TCTTTGTTTGATATGTTGCTTGG + Intronic
1040878855 8:52182045-52182067 TCTTAGTTTTATATTTTGCAAGG - Intronic
1042649073 8:71019946-71019968 TGTTATTTTGATCTTTAGGCAGG + Intergenic
1043047106 8:75340001-75340023 TGTTAAATTAATTTTTTGCCTGG - Intergenic
1043827482 8:84947053-84947075 TGGTAGTTTGTGATTTTGACAGG - Intergenic
1045620952 8:103977755-103977777 CCTTAGTTTGATAGTTTGCTTGG + Intronic
1046113262 8:109752313-109752335 TGGTAATTTGATATCTTGTCAGG + Intergenic
1046458820 8:114505979-114506001 TGTTAGCTGGTTATTTTGCTCGG - Intergenic
1046644698 8:116773513-116773535 AGTAAGTTTAATATTTTGACAGG + Exonic
1047946228 8:129883592-129883614 TGTTTGTTTGGTTTTTGGCCAGG - Intronic
1049961989 9:745730-745752 TGTAAGTTTTATACTTTGTCTGG - Exonic
1055239448 9:74165728-74165750 TGTTAGCTGGTTATTTTGCCTGG - Intergenic
1056333999 9:85548021-85548043 TGTTTATTTGATATTTTGTGTGG - Intronic
1056379157 9:86041648-86041670 CCTCAGTTTGATAATTTGCCAGG - Intronic
1057387323 9:94615512-94615534 TGTGGATTTGATATTTTGCAAGG + Intronic
1186259839 X:7765592-7765614 TGTTTGTTTGTTTGTTTGCCTGG + Intergenic
1187647458 X:21363932-21363954 TGGGACTTTGATTTTTTGCCAGG - Intergenic
1188093811 X:25997271-25997293 TGTTAGTTTGCTATCTTGTCAGG + Intergenic
1188393863 X:29656057-29656079 TGATAGATTGATATATTGCATGG + Intronic
1189427666 X:40915911-40915933 TGTTTGTTTGTTTTTTTGCCAGG + Intergenic
1189712962 X:43833686-43833708 AGTTAGTTTTAAATTTTGCTGGG - Intronic
1193785842 X:85759040-85759062 GGTTATTTTGATATGTTTCCAGG + Intergenic
1194468113 X:94257438-94257460 TTTTACTTTTATATTTTGCCTGG - Intergenic
1195658196 X:107353231-107353253 TGATAGCTTGAATTTTTGCCAGG + Intergenic
1196415396 X:115465650-115465672 TGTTTGTTTGTTTTTTTGACAGG - Intergenic
1196989174 X:121308951-121308973 TGTTAGTTGGACATCTTGCCAGG + Intergenic
1197132206 X:123018773-123018795 TGTTTGTTTGTTTTTTTACCAGG + Intergenic
1197496671 X:127192180-127192202 TGTTTGTTTTTTTTTTTGCCGGG - Intergenic
1199172518 X:144747491-144747513 TGTTTGTTTGTTTTTTTGGCTGG + Intergenic
1199757548 X:150879473-150879495 TGTTAGATTTATCTGTTGCCAGG - Intronic
1200396805 X:155995237-155995259 TGTTTGTTTGTTATTTTAGCAGG + Intergenic
1201509623 Y:14744589-14744611 TGTTTGTTCAACATTTTGCCTGG + Intronic
1201713257 Y:17015142-17015164 TGTTACGTTGATATATTGCCTGG + Intergenic