ID: 1150531199

View in Genome Browser
Species Human (GRCh38)
Location 17:65983643-65983665
Sequence ACTCATGGTTAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150531199_1150531204 -8 Left 1150531199 17:65983643-65983665 CCCTCCACCTTCTAACCATGAGT 0: 1
1: 0
2: 0
3: 7
4: 216
Right 1150531204 17:65983658-65983680 CCATGAGTAAAAGCTTCCTGAGG 0: 174
1: 530
2: 1074
3: 3218
4: 10932
1150531199_1150531206 14 Left 1150531199 17:65983643-65983665 CCCTCCACCTTCTAACCATGAGT 0: 1
1: 0
2: 0
3: 7
4: 216
Right 1150531206 17:65983680-65983702 GTCCTACAAGAAGCAGATGTTGG 0: 1
1: 0
2: 4
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150531199 Original CRISPR ACTCATGGTTAGAAGGTGGA GGG (reversed) Intronic
900465341 1:2822537-2822559 AACCATGGTTGGAAGCTGGATGG - Intergenic
900709525 1:4104816-4104838 ACTCATGGGTGGAAGTTGAACGG + Intergenic
902278008 1:15353285-15353307 ACTCATGGCTGGGAAGTGGAGGG + Intronic
904468157 1:30719966-30719988 ACTCCTGGTTAGAAGCCAGAAGG + Intronic
904936820 1:34136762-34136784 ACCCATGGTTGGTAGATGGAAGG - Intronic
905245093 1:36607250-36607272 GCTCATGCCTTGAAGGTGGAGGG - Intergenic
905928881 1:41772250-41772272 CCACATGATTAGAAGATGGAAGG - Intronic
907359743 1:53904881-53904903 TCTCAAGGTTGGGAGGTGGAAGG + Intronic
907740669 1:57162741-57162763 ACTCTTGTTTAGAAGGCAGATGG - Intronic
908200596 1:61791031-61791053 ACTTGTGGTTTGAAGATGGAGGG - Intronic
910889561 1:92003024-92003046 TCTAAAGGTGAGAAGGTGGAAGG + Intronic
912207224 1:107521909-107521931 AGTCATGATAAGAAGGTGAAAGG - Intergenic
914247372 1:145896252-145896274 TCTCAGGGTGAGAAGCTGGAGGG - Exonic
914807131 1:150999823-150999845 TCTCATGGATAGTATGTGGAGGG - Intronic
915607160 1:156959816-156959838 ACTCATGATTAGAAGGAGAAGGG + Intronic
917312277 1:173690255-173690277 AGTCAGGGTTATAAGGAGGAGGG + Intergenic
918688657 1:187451617-187451639 ACTCAAAGATAAAAGGTGGAAGG + Intergenic
920131535 1:203735858-203735880 CCTGATGGTTTGATGGTGGAAGG + Intronic
921669041 1:217906332-217906354 ACTGATGGCTTGAAGATGGAGGG + Intergenic
922564237 1:226590805-226590827 ACTCATGGAGGGAAGGAGGAGGG - Intronic
923034715 1:230277632-230277654 ACTCCAGGTGAGCAGGTGGACGG + Intronic
1065504336 10:26414368-26414390 ACTAAAGGTTAGAGGGTAGAAGG + Intergenic
1065869233 10:29941829-29941851 ACTCAAGCTTAAAAGGTGAAAGG - Intergenic
1068200382 10:53776214-53776236 ACTTGTGGTCAGAAGGTGAAAGG + Intergenic
1068209361 10:53900358-53900380 ACTGATAGTTTGAAGGGGGAGGG + Intronic
1068627066 10:59260935-59260957 GCCCATGGTTAGAAAGTGGCTGG + Intronic
1070123435 10:73600579-73600601 ACTTGAGGATAGAAGGTGGAAGG + Intronic
1070223595 10:74476800-74476822 TCCCATGGTTGGCAGGTGGAAGG - Intronic
1070523289 10:77273729-77273751 AATCATGGATAGAATTTGGAGGG + Intronic
1071901612 10:90126539-90126561 AATTATGGTTTGGAGGTGGATGG + Intergenic
1074077576 10:110142833-110142855 ACTCCTGGTAAGAGGGTGGCGGG - Intergenic
1074865776 10:117543613-117543635 AGCCAGGGGTAGAAGGTGGACGG - Exonic
1075984603 10:126773634-126773656 ACTCATGGTTATAAGGAGAGAGG - Intergenic
1076129550 10:128003714-128003736 ACTCATTATTAGAAGTTGCACGG - Intronic
1076275531 10:129195603-129195625 ACCCATGGTTGGCAGCTGGAAGG - Intergenic
1077395404 11:2318065-2318087 ATTGCTGGTTTGAAGGTGGAGGG - Exonic
1077743911 11:4879715-4879737 ACTTATGCGTAGAAGGTAGATGG + Intronic
1080123229 11:28701554-28701576 AATCATGGATGGAATGTGGATGG - Intergenic
1083838825 11:65291279-65291301 TCTCATGGCTAAAAGGCGGAAGG - Intronic
1085721481 11:78915841-78915863 ACTGATGGCTACAAAGTGGAGGG - Intronic
1086630217 11:89008825-89008847 AATCATGTTTAGAAGATAGAAGG + Intronic
1088844280 11:113651799-113651821 ACTCAAGGCTGGAAGGAGGAAGG - Intergenic
1089023102 11:115238675-115238697 AGTGATTGTGAGAAGGTGGACGG + Intronic
1089152593 11:116375395-116375417 TCTAATGGTTATAAGATGGAAGG - Intergenic
1090022100 11:123137390-123137412 ACTCGCGTTTAGAAGGAGGAAGG + Intronic
1091230964 11:133987848-133987870 GCTCATGCTTAGAAACTGGAAGG - Intergenic
1092254090 12:6916828-6916850 AATCATGGTTACAAGGGGGAAGG + Intronic
1093756905 12:22862900-22862922 ACGTAGGGGTAGAAGGTGGAGGG + Intergenic
1096000338 12:48124564-48124586 GCTCAGGATCAGAAGGTGGAAGG - Intronic
1098427996 12:70388006-70388028 ACTCATGGATAGAGAGTAGAAGG - Intronic
1099444346 12:82734461-82734483 ACTGCTAGTTTGAAGGTGGAGGG - Intronic
1101801036 12:108022122-108022144 ACTGATGGGTAGATAGTGGATGG - Intergenic
1103905216 12:124324092-124324114 ACTCATGGTGAGAGGGTGTCAGG - Intergenic
1104472092 12:129037338-129037360 AATCATGGTGTGAAGCTGGAAGG + Intergenic
1107293091 13:38879465-38879487 ACTCAGGGATCAAAGGTGGAGGG + Intronic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1110458281 13:75714797-75714819 AGTAATGTTTAGAAGATGGAGGG + Intronic
1111520513 13:89396432-89396454 ACTCATGGATATAAAGTAGAAGG - Intergenic
1111608972 13:90578732-90578754 AATAATGGGTAGAAGCTGGAAGG - Intergenic
1112390770 13:98981973-98981995 ACTCAAGGTTAGTAGATGGTAGG - Intronic
1112581941 13:100683902-100683924 ACTAGTGGGTAGAAGTTGGAAGG + Intergenic
1113524871 13:110966926-110966948 AGTCAGGGTTATAAGGAGGAGGG - Intergenic
1114490470 14:23097916-23097938 ACTCAAAGATAGAAGGTGGTCGG - Exonic
1118151975 14:63199516-63199538 AGCCATGGACAGAAGGTGGATGG - Intergenic
1120178165 14:81317127-81317149 ACTCAGGGTGGGAAGGTGAAGGG + Intronic
1124020024 15:25912081-25912103 ACTAATGGTTAGATGGTGCTGGG - Intergenic
1124351400 15:28958171-28958193 ACTTGTGGGTAGAAGCTGGAAGG + Intronic
1126584349 15:50268200-50268222 ATTCATGGTTAGAAGTGGGTAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131312642 15:91304696-91304718 ACTCATGGTTGGAAGGTCCTGGG + Intergenic
1137310016 16:47245884-47245906 ACTCACGGTCACAAGGTGAATGG + Intronic
1138889418 16:61123987-61124009 AATCCTTGCTAGAAGGTGGAAGG - Intergenic
1138923976 16:61568031-61568053 AATAATGGTTAGAAAGTTGATGG - Intergenic
1140786874 16:78350897-78350919 ACTGCTGGTTAGAATGTAGATGG - Intronic
1141010365 16:80391357-80391379 TGTCATGGTTAGAAGAGGGAGGG - Intergenic
1141163117 16:81642360-81642382 ACTCATGTTTTCAAGGTGGGTGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1144212641 17:13028051-13028073 ACTCATGGATTGAAGATGGCAGG + Intergenic
1146812339 17:35914041-35914063 GCACATGGTCTGAAGGTGGAAGG + Intergenic
1147320532 17:39643203-39643225 GCTCATGGTTTGGATGTGGAAGG + Intronic
1147506392 17:41021694-41021716 ACTGCTGGTTTGAAGATGGAGGG + Intergenic
1148710267 17:49675494-49675516 ACTCATGGATAAAAAGAGGATGG + Intronic
1149125842 17:53231046-53231068 ACTCATGTTTGGAAGCTAGATGG + Intergenic
1149641799 17:58207638-58207660 ACTCAGGGTGAGAAGCTGTATGG - Intronic
1149909893 17:60557571-60557593 ACTGATAGGTAGAAGGTGGTGGG - Intergenic
1150531199 17:65983643-65983665 ACTCATGGTTAGAAGGTGGAGGG - Intronic
1153447177 18:5187482-5187504 TCCCATGGTGGGAAGGTGGAAGG + Intronic
1153826707 18:8881866-8881888 AGTCAGGGTTATAAGGAGGAGGG + Intergenic
1159291018 18:66420178-66420200 AGTCATGGTTAAAAAGTGGTGGG + Intergenic
1159408925 18:68043851-68043873 ACTGCTGGCTTGAAGGTGGAGGG + Intergenic
1160960283 19:1717886-1717908 ATTCATGGGTAGATGGAGGACGG + Intergenic
1160960326 19:1718084-1718106 ATTCATGGGTAGATGGAGGATGG + Intergenic
1162268501 19:9595418-9595440 AGTCAGGGTTATAAGGAGGAGGG + Intergenic
1163573627 19:18098000-18098022 TCTCATGGTGGGAAGGGGGAAGG + Intronic
1164144853 19:22505680-22505702 ACCCAGGGTTAGAAGCTGGCAGG - Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1166210401 19:41303208-41303230 GCTCATGGTCAGATGGGGGAAGG - Intronic
1166713028 19:44949123-44949145 ACAGATGGTTAGAGGGAGGAGGG - Intronic
1167623229 19:50569975-50569997 AGTCAGGGTTGGAAGCTGGAAGG + Intergenic
1167655070 19:50758495-50758517 AGCCATGGTTAGAGGGCGGAGGG - Intergenic
1168263400 19:55208575-55208597 ACTCTTGGTTTGAGGGAGGAAGG + Intronic
1168263505 19:55208868-55208890 ACTCTTGGTTTGAGGGAGGAAGG + Intronic
1168263560 19:55209013-55209035 ACTCTTGGTTTGAGGGAGGAGGG + Intronic
1168283799 19:55320700-55320722 ACTCCTGGTCTGAGGGTGGAGGG - Intronic
1168327695 19:55546571-55546593 ACTCCTGGTGTGAAGGAGGAGGG - Intergenic
926547762 2:14263005-14263027 AGCCAGGGTTTGAAGGTGGATGG - Intergenic
927562286 2:24082699-24082721 AATCATGGTTAGCAGATAGAGGG - Intronic
929143123 2:38683941-38683963 ACTTCAGGTTTGAAGGTGGATGG + Intronic
929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG + Intergenic
929749811 2:44698661-44698683 ACTGATGGTTAGCAGGGTGATGG + Intronic
930055148 2:47246129-47246151 TCTCATGGCTGGAAGGAGGATGG + Intergenic
932208244 2:69903175-69903197 CTTCAGGGTAAGAAGGTGGATGG + Exonic
932697800 2:73971110-73971132 ACTTCTGCTCAGAAGGTGGAGGG + Intergenic
933390105 2:81657031-81657053 AGTCAGGGTTATAAGGAGGAGGG + Intergenic
934109382 2:88727551-88727573 ACTGAAGGATAGAGGGTGGAGGG - Intronic
934676448 2:96253067-96253089 ACTCATATTTAAAAGGTGAAGGG + Exonic
936573949 2:113638010-113638032 TCTCAAGGTTTCAAGGTGGAGGG - Intronic
936921794 2:117696461-117696483 CCTCATGGTTATAAGATGGCTGG - Intergenic
937720812 2:125093381-125093403 ATTCTTGGTTAAAGGGTGGAAGG - Intergenic
937913522 2:127087803-127087825 CCTCCTGGTTGGAAGGTGGTGGG - Intronic
938939735 2:136159383-136159405 ACTCATGGATAGAGCGTAGAAGG + Intergenic
939674326 2:145053260-145053282 ATTCATGGCCAGAAGATGGAAGG - Intergenic
941238636 2:163009606-163009628 ACCAGTGGTTAGAAGCTGGAAGG - Intergenic
943005325 2:182382310-182382332 ACAAATGGTTTGAAGATGGAAGG + Intronic
944315052 2:198275771-198275793 TCCCATGGTGGGAAGGTGGAAGG + Intronic
946595544 2:221302049-221302071 ACTCATTTCTTGAAGGTGGAGGG - Intergenic
1168823533 20:793359-793381 AGTCAGGGTTATAAGGAGGAGGG - Intergenic
1169505327 20:6204556-6204578 ACTCAAAGTTAGCAGATGGAAGG - Intergenic
1170375123 20:15691878-15691900 AATCATGATTAGAAGGTGTTTGG - Intronic
1170567393 20:17614880-17614902 CCTGATGGTCAGAAGGTTGACGG + Exonic
1175024882 20:55891331-55891353 AATCCTGGTTTGAAGGTGGAGGG - Intergenic
1175779238 20:61671835-61671857 ATGCATGGGTGGAAGGTGGATGG + Intronic
1177267523 21:18803930-18803952 ACTCATGGTTAGCAAGGGAAGGG + Intergenic
1179436438 21:41365375-41365397 ACTCAAGGGTAGAGGGTGGGAGG - Intronic
1183451090 22:37895451-37895473 AGTCATGGTTGGGAAGTGGAAGG + Intergenic
1183590175 22:38775450-38775472 AGTCAGTGTGAGAAGGTGGAGGG - Intronic
1184255226 22:43282630-43282652 ACTGATGGAGAGAAGGTGGGTGG - Intronic
1185426227 22:50772883-50772905 TCTCAAGGTTTCAAGGTGGAGGG + Intronic
955750383 3:62180472-62180494 AGACATGGGGAGAAGGTGGAAGG + Intronic
957592315 3:82215493-82215515 ACAAAAGGTGAGAAGGTGGAAGG - Intergenic
958778295 3:98511404-98511426 ACTCTTGGTTAGAACTAGGAAGG - Intronic
959651866 3:108758042-108758064 CCTCATGGTCACAAGGTAGAAGG + Intergenic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
962020311 3:131493069-131493091 ATTTATGGTTAGAAAGTTGAGGG - Intronic
964230696 3:154463789-154463811 ACTTATGATGGGAAGGTGGAAGG - Intergenic
965389210 3:168084138-168084160 ACTGATGGTTTAAAGGTGTATGG + Intronic
965799311 3:172475507-172475529 ACTCAAGGGTAGAGGGTGGGAGG - Intergenic
966299293 3:178461029-178461051 AATCAAGGTTAGGAGGTGAAAGG - Intronic
966769179 3:183488850-183488872 ACACCTGGTTAGAAGGTCTAGGG - Exonic
967386113 3:188912691-188912713 AGTCATGGTAGGAAGGTGAAGGG + Intergenic
968328315 3:197841356-197841378 ATTCCTGGTTTGAAGATGGAGGG - Intronic
968613627 4:1567811-1567833 ACACATGGGTGGAAGGTGCAAGG + Intergenic
969707300 4:8818949-8818971 CCTCTTGGTAAGAAGGTAGAGGG + Intergenic
970081847 4:12296254-12296276 ACTCAAGGATACAAGGTGCAAGG - Intergenic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
973959157 4:56092232-56092254 ACTCAAGGAAAGAAGGTGCATGG + Intergenic
979189011 4:117834248-117834270 ACTCAGGGATAAGAGGTGGAAGG - Intergenic
980955755 4:139427690-139427712 AATCATGGCCAGAAGGTGAAGGG + Intergenic
981541526 4:145851408-145851430 CCTCATTGTTAGAAGCTGGGAGG + Intronic
982364576 4:154561216-154561238 TCCCATGGTCAGAAGGAGGATGG - Intergenic
983179455 4:164630739-164630761 GCTCAAGGTTGGTAGGTGGAGGG + Intergenic
984429797 4:179634201-179634223 ACTCATGGTGAGAAGTGGAAGGG - Intergenic
988044345 5:25930692-25930714 ACTCAGGGTTAGAATTTGCAAGG - Intergenic
989615691 5:43334984-43335006 AGTCAGGGTTATAAGGAGGAGGG + Intergenic
991484845 5:67124189-67124211 ACCCAAGGGTAGAAGGTGGAGGG - Intronic
992553495 5:77881393-77881415 ACTCTTGGTCACAAGGAGGAAGG + Intergenic
993505665 5:88705957-88705979 AGACAGGATTAGAAGGTGGAGGG - Intergenic
993972326 5:94434692-94434714 TCTCATGGTGAAAGGGTGGAAGG + Intronic
994168124 5:96629243-96629265 TCTCATGGCTAAAAGGTGGAAGG - Intronic
994299390 5:98128684-98128706 ACTAATGGTGAAAGGGTGGAAGG - Intergenic
995189973 5:109309788-109309810 ACTCTTGGTCAGAGGGGGGATGG + Intergenic
996914630 5:128697513-128697535 CCTCATGGTTTGAAAGTGAATGG + Intronic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998593852 5:143506997-143507019 ACTCATGGCTAGAATGTAGATGG - Intergenic
998609467 5:143672242-143672264 ACTCATGGAGAGAAGGTTTAGGG - Intergenic
998988530 5:147789309-147789331 TCTCATGGTTAGAAGGTAACAGG - Intergenic
1003229794 6:4241698-4241720 ACACATGGATACACGGTGGAGGG - Intergenic
1007486722 6:42185579-42185601 CCCCAGGGTTGGAAGGTGGAGGG + Intronic
1009990131 6:70832678-70832700 TCCCATGGTTGGAAGCTGGAAGG + Intronic
1010951992 6:82048246-82048268 AGTGAGGGTTAGAAGGGGGAAGG - Intergenic
1011925930 6:92644787-92644809 AGACATGGACAGAAGGTGGATGG - Intergenic
1013727702 6:113120052-113120074 TCTCATAGCTAGAAGGTAGAAGG - Intergenic
1015575345 6:134665421-134665443 AATAATTGTTAGAAGGGGGAGGG + Intergenic
1020373021 7:7455217-7455239 TCTCCTGGTTAGAAAGTGGCAGG - Intronic
1023798777 7:43815059-43815081 AGTCAGGGTTATAAGGAGGAGGG - Intergenic
1024192408 7:47026138-47026160 AGTCATGGTAAGAATGTAGATGG - Intergenic
1024481064 7:49863780-49863802 ACCCAAGGTTAGCAGGAGGAAGG - Intronic
1024661815 7:51502736-51502758 ACAAATGGATAGAGGGTGGAGGG - Intergenic
1029309596 7:99650319-99650341 ACTACTGGTTGGGAGGTGGAGGG - Intronic
1030164192 7:106536446-106536468 ACTGATGGTGTGAAGATGGAGGG + Intergenic
1033028500 7:137801488-137801510 TCACATGGTTAGAAACTGGAGGG - Intronic
1034019332 7:147625066-147625088 ACTCATGGACATAGGGTGGAAGG + Intronic
1034220644 7:149442945-149442967 TCTCATGCTTAGAAGGGTGAAGG + Intronic
1034565084 7:151907413-151907435 ACACATGGACACAAGGTGGAGGG + Intergenic
1035452802 7:158989336-158989358 AGTCATGGATAGGAGGTGGTGGG - Intergenic
1035647857 8:1242353-1242375 GCTCATGGCTAGAAAGTGCATGG + Intergenic
1040055484 8:43053879-43053901 ACTCATGGGGGGAAAGTGGAAGG + Intronic
1041495584 8:58482109-58482131 AATCATGGTTACTAGGTGGTGGG - Intergenic
1042088242 8:65131784-65131806 AGTCAGGGTTATAAGGAGGAGGG + Intergenic
1047718890 8:127620386-127620408 ACTAATGGGGAGAAGATGGAGGG + Intergenic
1048176050 8:132153804-132153826 ACTCAGAGATAGAAGGAGGAAGG + Intronic
1050122479 9:2321579-2321601 ACAGAAGATTAGAAGGTGGAAGG + Intergenic
1050163244 9:2739546-2739568 ACAGATGGTGAGAAGGTGAAGGG + Intronic
1050273917 9:3976516-3976538 ACTCATACTTAGAAAGGGGAAGG - Intronic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1052325722 9:27215066-27215088 ACCCTGGGTGAGAAGGTGGAGGG + Intronic
1052422917 9:28267000-28267022 ACTCATGGTTCCAGGGTGCAGGG + Intronic
1056605025 9:88078432-88078454 ACACATGGCGAGAAGGAGGAAGG + Intergenic
1058270790 9:102968800-102968822 ACTCAAAGTTCGAAGATGGAAGG - Intergenic
1060738630 9:126082785-126082807 CGTCCTGGTTAGAATGTGGAAGG + Intergenic
1185957915 X:4512460-4512482 ACTCAGGGATAGAGGGAGGAAGG + Intergenic
1186622799 X:11259169-11259191 ACTCATGGATAGAGAGTAGAAGG - Intronic
1186890484 X:13954658-13954680 ACTCATGATTAGATGAAGGAGGG - Intergenic
1187047829 X:15665322-15665344 ACTTAAGGTTAGAGGGTGGGAGG + Intergenic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1187492994 X:19770194-19770216 ACTTAAGGGTAGAGGGTGGAAGG - Intronic
1193061462 X:77212565-77212587 ACCCATGTATAGAAGGTGGCTGG + Intergenic
1193140946 X:78026209-78026231 ACTCATAGGTTGAAGGTGAAGGG + Intronic
1195247951 X:103013457-103013479 ACTGCTGGTTTGAAGATGGAGGG - Intergenic
1197977129 X:132177906-132177928 GCGCCTGGTCAGAAGGTGGAGGG + Intergenic
1198580131 X:138054650-138054672 ACTTGTGGGTGGAAGGTGGAAGG + Intergenic
1199637430 X:149826735-149826757 AGTCAGGGTTATAAGGAGGAGGG - Intergenic
1200781547 Y:7220770-7220792 AATCATGGATAGAGGATGGATGG + Intergenic
1202019312 Y:20448647-20448669 ACTCAGGGATAAAAGGTGGAAGG + Intergenic