ID: 1150537109

View in Genome Browser
Species Human (GRCh38)
Location 17:66054563-66054585
Sequence GATGTCCATTGAAGCTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150537109_1150537114 17 Left 1150537109 17:66054563-66054585 CCAGACAAGCTTCAATGGACATC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1150537114 17:66054603-66054625 AATCTGTGCTCCCAGCCCTGTGG 0: 1
1: 0
2: 2
3: 41
4: 684
1150537109_1150537115 18 Left 1150537109 17:66054563-66054585 CCAGACAAGCTTCAATGGACATC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1150537115 17:66054604-66054626 ATCTGTGCTCCCAGCCCTGTGGG 0: 1
1: 0
2: 5
3: 318
4: 9686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150537109 Original CRISPR GATGTCCATTGAAGCTTGTC TGG (reversed) Intronic
902264136 1:15248970-15248992 GATGTCCTTGGAAGATTGTCTGG + Intronic
906011381 1:42530080-42530102 GATGTCCATGGTTGCATGTCAGG - Intronic
912922524 1:113883117-113883139 GATGTCCTTTTCAGCTTGTTTGG - Intronic
914746935 1:150508123-150508145 GCCGGCCACTGAAGCTTGTCTGG - Exonic
923120428 1:230985014-230985036 GAGGTCAATTGGAGTTTGTCCGG + Intronic
923270347 1:232349672-232349694 GCAGTCCATAGAAGATTGTCTGG + Intergenic
1064759915 10:18608013-18608035 GATGGCCATTGAAACTTATAAGG - Intronic
1065439577 10:25737345-25737367 CCTGTCCTTTGAAGCTTTTCTGG - Intergenic
1068281216 10:54872609-54872631 GATGACCATTAAAGGTTTTCAGG - Intronic
1068558582 10:58485839-58485861 GAAGTCCATTAAAGATTGTAAGG + Intergenic
1071320578 10:84452233-84452255 CATGTCCATTGCAGCTGCTCTGG + Intronic
1080208445 11:29757000-29757022 GATGGCAATGGCAGCTTGTCTGG - Intergenic
1088432860 11:109777716-109777738 TATGTCCAATGTGGCTTGTCAGG - Intergenic
1089226753 11:116930593-116930615 AATGTACGTTGAACCTTGTCAGG + Intronic
1091475435 12:767708-767730 GAAGTACATTGAAGTTTATCAGG + Intronic
1094716500 12:33019408-33019430 CATGTCCAGTGAAGGGTGTCAGG + Intergenic
1097366719 12:58722939-58722961 GATGAGCATTTTAGCTTGTCTGG - Intronic
1099607069 12:84817305-84817327 GATGTCAATTGAACATTTTCAGG - Intergenic
1104071158 12:125346729-125346751 GATGTCCATACAGGCTTGGCAGG - Intronic
1107692813 13:42968987-42969009 AATGTCCATTGTAGTTTGTTTGG - Intronic
1116626449 14:47270950-47270972 GATGTCCCTAGAAGCTTTCCAGG + Intronic
1117826434 14:59709145-59709167 GATGTACACTGAAGCTTGTAGGG + Intronic
1120053070 14:79891165-79891187 GACTTCCATTGCATCTTGTCAGG - Intergenic
1121007204 14:90498075-90498097 GATGCCCCTTGCAGCTGGTCGGG - Intergenic
1123905266 15:24914587-24914609 AGTGTCCACTGAAGCTTGTAAGG - Intronic
1129773802 15:78220489-78220511 GATGTCCCTTGAAGCACATCAGG - Intronic
1130784145 15:87077192-87077214 GATCTCTATTGATGCTTCTCTGG + Intergenic
1137024591 16:35459927-35459949 CATGTCCACTGAAGCCTGACTGG + Intergenic
1147506904 17:41027122-41027144 GATATCCACAGAAGCTGGTCTGG + Exonic
1147507581 17:41034788-41034810 GATATCCACAGAAGCTGGTCTGG + Exonic
1150537109 17:66054563-66054585 GATGTCCATTGAAGCTTGTCTGG - Intronic
1156035068 18:32756755-32756777 AATGCCAATTGAAGTTTGTCAGG + Intronic
1156777053 18:40803828-40803850 AATGTGCATTGAAGCCTATCTGG + Intergenic
1157496126 18:48158759-48158781 GATGGCAAGTGAAGCGTGTCAGG + Intronic
1160326636 18:77955928-77955950 CAAGTACATTGAAGCTTTTCTGG - Intergenic
1161587798 19:5114844-5114866 GGTGTCCTTTGCAGCTTGTATGG - Intronic
929582815 2:43094042-43094064 CATGTCCCGTGAATCTTGTCTGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
937015370 2:118600618-118600640 GGTTTCCATTCAACCTTGTCAGG + Intergenic
937109935 2:119357486-119357508 AGTCTCCATTGAAGTTTGTCAGG - Intronic
937207876 2:120248239-120248261 GATGCCCACAGAAGCTTGCCGGG + Intronic
938045827 2:128119112-128119134 AATGTTCATTGAAGCATTTCAGG - Intronic
940847449 2:158656990-158657012 CATGTCCATGGGAGCGTGTCAGG - Intronic
941410592 2:165152138-165152160 GAATTCAATTGAAGATTGTCAGG + Intronic
944405936 2:199383697-199383719 GTTGTGCGTTGAAGCTTGTAGGG - Intronic
948819342 2:240530712-240530734 GATCGCCATTGAAGGGTGTCAGG + Intronic
949171821 3:1008945-1008967 GATGGCCATTGAAGCCTCTAAGG + Intergenic
970219671 4:13797828-13797850 CATGTCCATAGAAGATTGTATGG - Intergenic
974057139 4:56995482-56995504 TTTGTCCATAGAAGCTTTTCTGG + Intronic
978342450 4:107733140-107733162 TATGTCCTTTACAGCTTGTCTGG - Intergenic
980591905 4:134901459-134901481 GATGTCCATTGATGATAGACTGG - Intergenic
980838404 4:138226573-138226595 GAGGTACAGTGAAGCTTCTCCGG + Intronic
982397208 4:154925564-154925586 GCTGTCCATAGAACCTTGGCTGG + Intergenic
983089346 4:163485824-163485846 GATGTCCCTGGAAGCTTGGGAGG + Intergenic
983987743 4:174080764-174080786 GATATCCAGGGAAGCTTGTTGGG - Intergenic
984085392 4:175303767-175303789 GATGTCTATTGAAGATTTTGTGG + Intergenic
987225375 5:15834621-15834643 GATGTGCATTTAAGATTGTCTGG - Intronic
997424598 5:133794641-133794663 GATGCCCTCTGCAGCTTGTCAGG - Intergenic
1013641792 6:112090625-112090647 CATGTCCATTGAGGGGTGTCTGG + Intronic
1016935015 6:149443261-149443283 GATGCCCATTGTAGGTTGGCTGG - Intergenic
1019765409 7:2846168-2846190 TATGTGCATTCAAGGTTGTCAGG - Intergenic
1020129602 7:5552260-5552282 GATGACCTTTGAAGGATGTCTGG - Intronic
1027256075 7:76431515-76431537 GAAGTCCATGGAAGCAGGTCTGG - Intronic
1034320647 7:150178242-150178264 GGTGTCCATGGAAGATTTTCAGG + Intergenic
1034327825 7:150253365-150253387 GATGTCCACTGAAGCTGTTTGGG + Intronic
1034765383 7:153716068-153716090 GATGTCCACTGAAGCTGTTTGGG - Intergenic
1034772091 7:153788998-153789020 GGTGTCCATGGAAGATTTTCAGG - Intergenic
1037060591 8:14504683-14504705 GATATCTATTGAAGAATGTCAGG - Intronic
1038651680 8:29409641-29409663 GATGTCCATCAAAGGTTGGCGGG + Intergenic
1042614773 8:70635993-70636015 AATGTCCATTGAAGGATGACTGG - Intronic
1046580173 8:116082668-116082690 GATGTCTAGTGAAGATTATCCGG - Intergenic
1050609784 9:7339757-7339779 GATGCCCATTGAAGAATGGCAGG + Intergenic
1057422152 9:94921223-94921245 GTTTTCCAGTGAGGCTTGTCAGG + Intronic
1060594450 9:124839974-124839996 AATGGCCATTGAAGCATTTCAGG + Intergenic
1185668551 X:1787699-1787721 GACGGCCATTGCAGGTTGTCTGG + Intergenic
1188771892 X:34163095-34163117 TATGTCCACTGATGCTGGTCTGG + Intergenic
1191604228 X:63043939-63043961 GAAGTCCATTGAATAGTGTCGGG + Intergenic
1192845438 X:74902554-74902576 GAGGTCCATTGTAGCTCTTCTGG + Intronic
1199079013 X:143555778-143555800 GAGGTCCAGGGAAGATTGTCTGG - Intergenic
1199213925 X:145245729-145245751 GAGGTCCAGGGAAGATTGTCTGG + Intergenic