ID: 1150541391

View in Genome Browser
Species Human (GRCh38)
Location 17:66103824-66103846
Sequence AGGAAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 2, 1: 34, 2: 71, 3: 176, 4: 437}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150541383_1150541391 26 Left 1150541383 17:66103775-66103797 CCCCAGCAGTGGCTACATGGCAT 0: 1
1: 5
2: 17
3: 63
4: 220
Right 1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG 0: 2
1: 34
2: 71
3: 176
4: 437
1150541384_1150541391 25 Left 1150541384 17:66103776-66103798 CCCAGCAGTGGCTACATGGCATG 0: 1
1: 4
2: 18
3: 54
4: 199
Right 1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG 0: 2
1: 34
2: 71
3: 176
4: 437
1150541382_1150541391 27 Left 1150541382 17:66103774-66103796 CCCCCAGCAGTGGCTACATGGCA 0: 2
1: 12
2: 19
3: 68
4: 268
Right 1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG 0: 2
1: 34
2: 71
3: 176
4: 437
1150541385_1150541391 24 Left 1150541385 17:66103777-66103799 CCAGCAGTGGCTACATGGCATGA 0: 1
1: 2
2: 7
3: 32
4: 287
Right 1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG 0: 2
1: 34
2: 71
3: 176
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150541391 Original CRISPR AGGAAGAGCACAGTGATTGT GGG Intronic