ID: 1150545507

View in Genome Browser
Species Human (GRCh38)
Location 17:66153681-66153703
Sequence GAATAGCCAAGGCAATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 2, 1: 17, 2: 68, 3: 159, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150545504_1150545507 9 Left 1150545504 17:66153649-66153671 CCTGAAATGTATATGGAAATGCA 0: 1
1: 8
2: 52
3: 260
4: 969
Right 1150545507 17:66153681-66153703 GAATAGCCAAGGCAATCTTGAGG 0: 2
1: 17
2: 68
3: 159
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150545507 Original CRISPR GAATAGCCAAGGCAATCTTG AGG Intronic
900734446 1:4287573-4287595 GAATAGCCAAGGCAATCCTAAGG - Intergenic
900949238 1:5848434-5848456 GAATAGGCAAGGCACTCTCTGGG - Intergenic
901938551 1:12644826-12644848 GAAGAGACAAGTCTATCTTGAGG - Intronic
904958815 1:34313924-34313946 GAATAGTCAACACAATATTGAGG - Intergenic
906391982 1:45425824-45425846 GAATCGCCAAAGCCATCCTGAGG + Intronic
906863087 1:49383330-49383352 GAATGGCCAAAATAATCTTGAGG + Intronic
907025097 1:51109848-51109870 GAATAGCTAAAGCAATCCTGAGG - Intronic
907795856 1:57716276-57716298 GGATAGCCAAAGCAATCTTGAGG + Intronic
908050445 1:60224083-60224105 GAAAAGCCAAGGTAAGCATGGGG + Intergenic
909041891 1:70663282-70663304 AAACAGCCAAAACAATCTTGAGG - Intergenic
909535929 1:76736074-76736096 GTATAGCCAAGACAATCCTAAGG - Intergenic
910103380 1:83602740-83602762 GAATAGTCAAAGCAATTCTGGGG + Intergenic
911313267 1:96323949-96323971 GAATAGCCAAAGGAACCTTAGGG + Intergenic
911398387 1:97340895-97340917 AAATTGCCAAGGTATTCTTGTGG - Intronic
911669063 1:100587647-100587669 TAATAGACAAGGCAACCTAGGGG - Intergenic
912090313 1:106065419-106065441 GAATAGCCAAAGCAATCTCGAGG + Intergenic
912614165 1:111080252-111080274 AAATAGCCAAAGTAATCTTGAGG - Intergenic
912898829 1:113625152-113625174 GAATAGCCAAAGCTAGCCTGAGG - Intronic
913366983 1:118049706-118049728 TAATTGCCAACACAATCTTGAGG + Intronic
915000403 1:152584440-152584462 GAATAGCCAAAGCAATCTTAAGG - Intronic
916817462 1:168367660-168367682 GAATAGCCTAAGCAATGTAGTGG - Intergenic
917370195 1:174284810-174284832 GAATATCCATAGCAATCTTGGGG - Intronic
917388453 1:174504391-174504413 GAATAGCCAAAGCAAACTTGAGG + Intronic
919569769 1:199233032-199233054 AAATAACCAAGTCAAACTTGAGG + Intergenic
921898315 1:220424089-220424111 GAAGAGCCAGGGCAGTCCTGCGG + Intergenic
922012348 1:221602689-221602711 GAATAGCCAAGACAATCTAAAGG + Intergenic
922401386 1:225260621-225260643 GAATAGCCAAAGCAATCTTGAGG - Intronic
923418994 1:233793947-233793969 AAATAGCCAAGGCAATACTAAGG + Intergenic
923827825 1:237519737-237519759 AAATAGCCAAAGCAATCCTGAGG - Intronic
924484317 1:244465686-244465708 AAATAGCCAAAGTAGTCTTGTGG - Intronic
924604568 1:245521715-245521737 CTATAGACAAGGCAATTTTGGGG + Intronic
924955383 1:248921593-248921615 ACATAGCCAAGACAATCCTGGGG - Intergenic
1063766833 10:9151376-9151398 GAAGAGCCAAGGCTGTTTTGAGG - Intergenic
1064127162 10:12672831-12672853 GAATAGCCAAAGCTATTTTAAGG - Intronic
1065551726 10:26874414-26874436 GCATAGCCAAAACAATCTTGAGG - Intergenic
1066525577 10:36275443-36275465 GTATAGCCAAGACAATCCTAAGG + Intergenic
1066565665 10:36719390-36719412 GTATAGCTAAGGCAATCTTGGGG + Intergenic
1066974240 10:42350564-42350586 GAAAAACCAAAGCAATCTAGAGG + Intergenic
1068109349 10:52660902-52660924 GAATAGTCAAAGCAATTCTGAGG - Intergenic
1068470449 10:57455460-57455482 GAATAACCAAATAAATCTTGGGG + Intergenic
1068485369 10:57651333-57651355 GAATAGCCAACGCTATCCTAAGG - Intergenic
1068643763 10:59442018-59442040 GAATAGCAAAAGTAATCCTGAGG + Intergenic
1069229493 10:65991215-65991237 AAATAGCCAAAGCAATACTGAGG - Intronic
1071340408 10:84641536-84641558 GTATAGCCAAGACAATCTTAAGG + Intergenic
1071520522 10:86329257-86329279 GCCTGGCCAAGGCAACCTTGTGG - Intronic
1072134150 10:92527398-92527420 GAATAGCTAAGATAATTTTGAGG - Intronic
1072883639 10:99253164-99253186 GAAAAGCCAAGGCAATCCTAAGG + Intergenic
1073158850 10:101372207-101372229 AGATAGCCAATGCAATCTTGGGG - Intronic
1073772908 10:106754969-106754991 CAAAAGACAATGCAATCTTGGGG - Intronic
1073835770 10:107439636-107439658 AAATAGCCAAGACAATCTTCAGG - Intergenic
1073880942 10:107979255-107979277 GAAAAGCCACGGCACTATTGTGG + Intergenic
1074204094 10:111266901-111266923 GAAAAGCTAAGGCAATTCTGGGG - Intergenic
1076377070 10:129997669-129997691 GAATAGCCAAAGCTACCCTGAGG + Intergenic
1077574282 11:3368606-3368628 GCATAGCCAAAGCAATCTATAGG + Intronic
1077636908 11:3848265-3848287 GAATATCCATAGCAATCCTGAGG - Intergenic
1078277714 11:9866259-9866281 GAATAGCCAAAGCAATCCTGAGG + Intronic
1078756061 11:14211061-14211083 GTATAGCCAAGACAATCCTAAGG - Intronic
1079365397 11:19804807-19804829 AAAAAGCCAAGGAAAACTTGGGG + Intronic
1079513908 11:21244364-21244386 GAAGAGCCCATGCATTCTTGAGG + Intronic
1080022167 11:27573730-27573752 AAATAACCAAGGCAATATTAGGG - Intergenic
1080662678 11:34310451-34310473 GGAGAGGCAAGGCAAGCTTGGGG - Intronic
1081099179 11:38980866-38980888 GAATAGCTGAAGCAATATTGAGG + Intergenic
1081143698 11:39535568-39535590 CAATAGCCAATGCAATCAAGTGG - Intergenic
1081327798 11:41767306-41767328 AAATAGCCAAGGCATTCTTGAGG + Intergenic
1081409019 11:42733736-42733758 GAATAGCCAAGACAATTTTAAGG + Intergenic
1081409299 11:42737818-42737840 GAATAGCCAAGACAATTTTAAGG - Intergenic
1082130074 11:48477663-48477685 AAGTAGCCAAAGCAATCTTGAGG - Intergenic
1082220642 11:49631628-49631650 GAATAGCCAAAGCAATTTTGAGG + Intergenic
1082247031 11:49936016-49936038 AAGTAGCCAAAGCAATCTTGAGG + Intergenic
1084026341 11:66452464-66452486 CAATGTCCCAGGCAATCTTGCGG - Intronic
1086123231 11:83322651-83322673 AAATGGCCAAAGCAATCTCGAGG - Intergenic
1086877712 11:92117022-92117044 AAATAGCCAAAGCAATCCTAAGG + Intergenic
1086917304 11:92545679-92545701 GAAAAGGCAAGGCACTCATGAGG + Intronic
1087304909 11:96477724-96477746 AAATAGCCAAAGCAATCTTGAGG + Intronic
1087605990 11:100378598-100378620 AAATAGCCAAAGCAATCTCAAGG + Intergenic
1087627200 11:100608709-100608731 GAATAGCTAAGGCTATCCTAAGG + Intergenic
1088033766 11:105286183-105286205 GAATAGCCAAAGTAATCCTGAGG + Intergenic
1088041063 11:105382707-105382729 GAATAGCCAAGACAATTCTTTGG - Intergenic
1088180862 11:107108520-107108542 GAATACCCAAAGTAATCTTAAGG + Intergenic
1088640861 11:111871473-111871495 GACTAGCCATGGCAAGCCTGGGG + Intronic
1088697667 11:112382393-112382415 GAATAGACAAAACAATTTTGAGG - Intergenic
1090212283 11:124929793-124929815 GAAAAGCCAAGGCTATCTGCAGG - Intronic
1090384795 11:126351353-126351375 TAACACCCAAGGCAATCGTGGGG + Intergenic
1090579543 11:128144732-128144754 GCATCGCCAAGGCAATCCTAAGG + Intergenic
1091848001 12:3672404-3672426 GCATAGCCAAGGGATTGTTGAGG + Intronic
1092640547 12:10503802-10503824 GAATAGCCAAAGCAATCTCCAGG - Intergenic
1092841358 12:12545036-12545058 GAATAGTCAAGGTAATATTAAGG - Intronic
1093260166 12:16926218-16926240 AAATAGCCAAATGAATCTTGAGG + Intergenic
1093534482 12:20207544-20207566 GAAGAATCAAGTCAATCTTGTGG - Intergenic
1093602191 12:21041235-21041257 GAATAGCCAAAGCTATCCTAAGG - Intronic
1094206621 12:27847046-27847068 TAATAGCCAAGACAATCCTAAGG - Intergenic
1094559736 12:31540737-31540759 GAATAGCCAAAGCTATCCTGAGG + Intronic
1094771521 12:33666911-33666933 GAATAGTCAAGAAAATCTTGAGG - Intergenic
1095660293 12:44724793-44724815 AAATAGACAAGGCAATCCTAAGG + Intronic
1095784860 12:46098907-46098929 GCATAGCCAAAGAAATCTTAAGG + Intergenic
1096577464 12:52562189-52562211 GACTGGCCAAGGCAAGCCTGGGG - Intergenic
1098786631 12:74766481-74766503 AAAGAGCTAAGGGAATCTTGAGG + Intergenic
1099220975 12:79913633-79913655 GCACAGCCAAGTCAATCTTTAGG - Intronic
1100025817 12:90126666-90126688 GAATAGCCAAGGCAATCCTAAGG + Intergenic
1101297468 12:103438940-103438962 GCATCGCCAAGGCAATCATAAGG + Intronic
1101529341 12:105559922-105559944 GAAAAGCAAAGGCAAACCTGGGG - Intergenic
1101544552 12:105699349-105699371 CAACAACCAAGGCAATCTTGAGG + Intergenic
1102196277 12:111027503-111027525 GAACAGCCGAGGCAAGTTTGAGG - Intergenic
1103425260 12:120828562-120828584 GAATAGCTAAAACAATCTTGGGG + Intronic
1104737794 12:131149257-131149279 GAATAGCCAATACAATTCTGAGG - Intergenic
1105229854 13:18482343-18482365 GAAAAACCAAAGCAATCTAGAGG + Intergenic
1105515632 13:21087916-21087938 GAATAGACAAAACAATCTTGAGG + Intergenic
1105647994 13:22341976-22341998 GAATAGTCAAGGCAATCCTAAGG + Intergenic
1105656240 13:22442210-22442232 GGATAACCAAGGCAGTTTTGAGG - Intergenic
1106202573 13:27552853-27552875 GAAAACCCAGGCCAATCTTGGGG - Intronic
1106827439 13:33539438-33539460 GAATGGCCAAAGTAATTTTGAGG + Intergenic
1106837695 13:33653209-33653231 GAATAGCCAAAACACTCTTGAGG + Intergenic
1107207892 13:37817557-37817579 GAATAACCAAGGCAATACTAAGG + Intronic
1108119955 13:47174211-47174233 AAATAGCCAAAACAATCTTGAGG - Intergenic
1108582942 13:51842257-51842279 GAAAAGGCAAGGCAATATTTGGG - Intergenic
1108958068 13:56186191-56186213 GTATAGCCAAGACAATCCTAAGG + Intergenic
1109205004 13:59473100-59473122 GAAGAGCCAAAACAATCTTGAGG + Intergenic
1110024305 13:70514994-70515016 GAATAGCCAAGGTGATATTGAGG + Intergenic
1110108988 13:71718964-71718986 TAATAGCCAAAGCAAGCTTTAGG + Intronic
1110512499 13:76367584-76367606 AAGTAGCCAAAGCAATCTTGAGG + Intergenic
1110625971 13:77656246-77656268 GAATAGCCAAAGCAATCCTGAGG - Intergenic
1110638686 13:77796105-77796127 GAATAGCCAAAGCAATTCTAAGG + Intergenic
1111010558 13:82308431-82308453 GAATAGCCAAAGCAATCTTGAGG - Intergenic
1111814421 13:93132684-93132706 GAATAGCCAAAGCAATCCTAAGG + Intergenic
1112253323 13:97804147-97804169 GAATAGCCAAAGCAATCCTAAGG + Intergenic
1112421181 13:99250527-99250549 AAATAGCCAAAGCAATCCTAAGG - Intronic
1112898501 13:104331338-104331360 GTATAGCCAAGACAATCCTAAGG - Intergenic
1113406148 13:110042469-110042491 AAACAGCCAAAACAATCTTGAGG + Intergenic
1113511801 13:110862312-110862334 GAATTGCCAGAACAATCTTGAGG - Intergenic
1114014104 14:18409179-18409201 GAAAAACCAAAGCAATCTAGAGG + Intergenic
1114326759 14:21596894-21596916 GAATAGCCAAAGTAATCCTGAGG + Intergenic
1114820651 14:26014961-26014983 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1114867319 14:26612597-26612619 GTTTTGCCAAGGCAATTTTGAGG + Intergenic
1115188895 14:30725142-30725164 AAATAGCCAGGGCAATCGTAAGG - Intronic
1115381153 14:32740821-32740843 GAATAGCTAAAGCTATCCTGAGG - Intronic
1115885338 14:37965346-37965368 AAATAGCCAAGGAAATCCTAAGG - Intronic
1116058302 14:39891230-39891252 GAGTAGCCAAAGCTATCCTGAGG + Intergenic
1116075404 14:40104389-40104411 GTATAGCCAAGACAATCGTAAGG + Intergenic
1116532012 14:45983294-45983316 GAACAGCCAAGCTAATCTTGAGG - Intergenic
1116614454 14:47116443-47116465 AAATAGCCAAATCAATCTTGAGG + Intronic
1118304401 14:64643125-64643147 GCACAGCAAAGACAATCTTGAGG + Intergenic
1118525868 14:66641926-66641948 GGATAATCAAGGCAATCTTAAGG + Intronic
1119741865 14:77018931-77018953 GACTAGCCTGGGCAGTCTTGGGG - Intergenic
1120343995 14:83260351-83260373 GAATAGCCAACACAATATTAAGG - Intergenic
1120426659 14:84356832-84356854 GAATAGCCAAAGCCATTTTGAGG + Intergenic
1120956141 14:90084130-90084152 GAATAGCCAAAACAATCTTGGGG - Intronic
1121118982 14:91364100-91364122 CAAGTGCCAAGGCAAGCTTGAGG + Intronic
1121167562 14:91821160-91821182 GAATAGCCAAAACAATCTTGGGG + Intronic
1121993193 14:98581313-98581335 TAATAAACAAGGCAATCTTGTGG - Intergenic
1123158073 14:106249724-106249746 CAATAGCCAAAGTAATTTTGGGG + Intergenic
1123172391 14:106386353-106386375 GAATATCCAAAGCAATCCTAAGG - Intergenic
1123501122 15:20881712-20881734 GAATAGCTAAAGCAATCTTGAGG - Intergenic
1123558374 15:21455417-21455439 GAATAGCTAAAGCAATCTTGAGG - Intergenic
1123594605 15:21892692-21892714 GAATAGCTAAAGCAATCTTGAGG - Intergenic
1123983963 15:25628094-25628116 GAATAGCCAAGACAATCCTAAGG - Intergenic
1124084626 15:26536096-26536118 GTATAGCCAAGACAATCTTAAGG + Intergenic
1124133686 15:27013817-27013839 AAATAGCCAAAACAATCCTGGGG - Intronic
1124156503 15:27229856-27229878 GAATAGCTGAGGCAATCCTAAGG - Intronic
1124713737 15:32037384-32037406 GAATAGCCAACACAATGTTGAGG - Intronic
1125115390 15:36085390-36085412 AAAGAGCCAAGGCAGTCCTGGGG + Intergenic
1125664819 15:41421908-41421930 GACTAGCCTAGGCAATGTAGTGG - Intronic
1126489592 15:49221862-49221884 AAATAGCCAAAGCACTCCTGAGG - Intronic
1126496592 15:49297878-49297900 AAATAGCCAAAGCAATCCTAAGG - Intronic
1127031441 15:54868729-54868751 GAATAGCCAAAGCAATCTTGAGG + Intergenic
1127406428 15:58652694-58652716 GAATAACCAATGCTATCCTGAGG - Intronic
1127763159 15:62160691-62160713 GAATAGCCAGAGCAATTTTGAGG + Intergenic
1129546050 15:76396281-76396303 GAATAGCCAAAGCTATCCTAAGG - Intronic
1130007133 15:80110564-80110586 GAATAGCCAACACAATCATGAGG + Intronic
1130998295 15:88917584-88917606 GAATAGCCAAAACAATCTTGAGG + Intergenic
1202966724 15_KI270727v1_random:182567-182589 GAATAGCTAAAGCAATCTTGAGG - Intergenic
1134896445 16:17891649-17891671 GAATAGCCAAAAAATTCTTGAGG - Intergenic
1136908238 16:34122283-34122305 GAATGGCCAAGCCAATAATGAGG + Intergenic
1137064422 16:35825188-35825210 GAATAGCCAAGACAATCTTAAGG - Intergenic
1137309209 16:47236700-47236722 GAATAACCAAGTTAATCTTTAGG + Intronic
1138472649 16:57250341-57250363 GAAAAACGAAAGCAATCTTGAGG + Intronic
1138764151 16:59580033-59580055 TAATAGCCAAAGCAATCTTGAGG + Intergenic
1139258724 16:65570530-65570552 GAATAATCAAAACAATCTTGAGG + Intergenic
1139343122 16:66284138-66284160 GAATAGCCAAAATAATCTTGGGG + Intergenic
1140162082 16:72507199-72507221 GAATAGCCAGAATAATCTTGAGG + Intergenic
1141494878 16:84401788-84401810 GAATAGCCAAAGCTATCTTAAGG - Intronic
1142646982 17:1320500-1320522 GAATAGCCAAGATAACTTTGAGG + Intergenic
1143113524 17:4567440-4567462 GTGTAGCCAAGGCAAACATGGGG + Intergenic
1144238935 17:13290361-13290383 AAGTACACAAGGCAATCTTGAGG - Intergenic
1145229120 17:21158727-21158749 GAATAACCAACTCAATATTGTGG + Intronic
1146046001 17:29507675-29507697 GAATATCCAAAACAATCTTGAGG - Intronic
1146090862 17:29876168-29876190 GAATAGCCAAAGCTATCCTAAGG + Intronic
1146156575 17:30529466-30529488 GAATAGCCAAGACAACCTTGAGG - Intergenic
1146215301 17:30974364-30974386 GAATAACAAAAACAATCTTGGGG - Intronic
1146554094 17:33808484-33808506 GAACAGCCAACACAATATTGAGG - Intronic
1147177322 17:38663996-38664018 GAATGGCCAAGGCATGCATGTGG - Intergenic
1148486242 17:47992622-47992644 GAATAGTCAAGGCAGTATAGTGG + Intergenic
1149235433 17:54584778-54584800 GAATAGCCAAGGCAATCCTAAGG + Intergenic
1150164688 17:62930639-62930661 GAATAGCAAAGGCAGACTTCAGG - Intergenic
1150545507 17:66153681-66153703 GAATAGCCAAGGCAATCTTGAGG + Intronic
1150882750 17:69048821-69048843 GAAAAACCACGCCAATCTTGTGG + Intronic
1152966805 18:123905-123927 GAATAGCCAAGCCAATTGGGAGG - Intergenic
1153857384 18:9163489-9163511 GTATAGCCAAGACAATCCTAAGG - Intronic
1154053489 18:10987242-10987264 AAATAGCTAAAGCAATCTTGAGG + Intronic
1154267112 18:12888638-12888660 GAATAGCCAAAATAATCTTAAGG + Intronic
1154511139 18:15103822-15103844 GTATAGCCAAGACAATCCTAAGG + Intergenic
1154523549 18:15257499-15257521 GAAAAACCAAAGCAATCTAGAGG - Intergenic
1154927182 18:20948152-20948174 GAATAGCCAAGCCAATTGGGAGG + Exonic
1155459783 18:26065260-26065282 GAATGGCCAGGAAAATCTTGGGG + Intronic
1155849729 18:30757088-30757110 GAATAGTCAAAGCAATACTGAGG + Intergenic
1156540822 18:37908368-37908390 AAATAGCCAATGCAATCCTAAGG + Intergenic
1156813850 18:41284900-41284922 GAATAGCCACCACAATGTTGAGG + Intergenic
1157406113 18:47423980-47424002 GAATGGTCAAGGCAATTTAGGGG - Intergenic
1157945597 18:51976361-51976383 GAATTGCCAAAGCAATCTTGAGG + Intergenic
1158484453 18:57852880-57852902 GAATAGCCAAGGTATTCTTGAGG - Intergenic
1158794798 18:60831810-60831832 GAGTAGCCTAGATAATCTTGAGG - Intergenic
1158875312 18:61728616-61728638 GAATAGACAAAGCTATCCTGAGG - Intergenic
1159843718 18:73432479-73432501 GAATAGCCAAAATAATCTTGAGG + Intergenic
1163869300 19:19805494-19805516 GACTAGCCAAAGCAATCATGAGG + Intronic
1163873683 19:19847560-19847582 GAATAGCCAAAGCAAACTTGAGG + Intergenic
1163877091 19:19880978-19881000 GAATAGCCAAAACAGTCTTGAGG - Intronic
1163880527 19:19917174-19917196 GAATAGCCAAAGCAATCTTGAGG - Intronic
1163882366 19:19936605-19936627 GAATAGCCAAAGCAATCTTGAGG + Intergenic
1163886889 19:19973472-19973494 GAATAGCCTAAGCAATCTTGAGG - Intergenic
1163910466 19:20186602-20186624 TGATAGCCAAAGCAATCTTGAGG - Intronic
1163912071 19:20204882-20204904 GAATAGCCAAAGCAATCATGAGG + Intergenic
1163917201 19:20251144-20251166 GAATAGCCAAAGCAATCTTGAGG - Intergenic
1163922013 19:20298451-20298473 GAATAGCCAAAGCAATCTTGAGG - Intergenic
1163932340 19:20408403-20408425 TGATAGCCAAAGCAATCTTGAGG + Intergenic
1163956330 19:20645133-20645155 GAATAGCCAAAGCAATCATGAGG + Intronic
1163967651 19:20762972-20762994 GAATAGCCTAAGCAATATTGAGG + Intronic
1163970950 19:20794403-20794425 GAATAGCCAAAGCAATCTTGAGG - Intronic
1163984765 19:20935567-20935589 GAATAGCCAAAGCAATCTTGAGG - Intronic
1163994903 19:21035022-21035044 AAATAGCCAAAGCAATCGTGAGG - Intronic
1164014759 19:21243967-21243989 GAATAGCCAAAGCAATCTTGAGG + Intronic
1164021322 19:21308729-21308751 GAATAGTCAAAGCAATCATGAGG + Intronic
1164028419 19:21376504-21376526 GAATAGCCAAAGCAATCTTGAGG - Intronic
1164045208 19:21532303-21532325 GACTAGCCAAAGCAATCTTGAGG + Intronic
1164058056 19:21639528-21639550 GAAAAGCCCAAGCAATCTTGAGG - Intergenic
1164068513 19:21743456-21743478 AAATAGCCAAAGCAATCTTGAGG + Intronic
1164102849 19:22074077-22074099 GAATAGCCAAAGCAATCTTCAGG - Intronic
1164113391 19:22192482-22192504 GAATAGCCAAAGCAATCTTGAGG + Intronic
1164197788 19:22986772-22986794 GAATAGCCAAGGAAATCTTGAGG + Intronic
1164224481 19:23230411-23230433 GAATAATGAAAGCAATCTTGAGG + Intronic
1164297111 19:23921356-23921378 GAATAGCCAAAGCAATCTTGAGG - Intronic
1164317598 19:24107162-24107184 GAATAGTCAAAGCAATCTTGAGG - Intronic
1165003337 19:32783422-32783444 ACATAGCCAAGACAATCTTGGGG - Intronic
1165185220 19:34014098-34014120 AAATAGACAAAGCAATCTTGAGG + Intergenic
1165309571 19:35022166-35022188 GATTAGACAAGGCAATGTTTGGG + Intronic
1165579975 19:36853850-36853872 AAATAGCCAAGACACTCTTGAGG - Intronic
1166938227 19:46347624-46347646 CAATAGAGAAGGCAATCGTGGGG + Intronic
925068139 2:945491-945513 TAAGAGCCAAAGCAATCTTGAGG - Intergenic
925518873 2:4718574-4718596 GAATAGCTAAAGCAATCCTGAGG + Intergenic
926497924 2:13614961-13614983 GAATAGTGAAAGCCATCTTGAGG - Intergenic
926503703 2:13684714-13684736 GGATAGGCAAGGACATCTTGAGG + Intergenic
926545111 2:14230277-14230299 GAATAGCTAAAGCAATCCTAAGG - Intergenic
928041431 2:27881603-27881625 GAATAGCCAAGGCAATCCTAAGG + Intronic
929284968 2:40125606-40125628 GAATATGCAAAGCAATTTTGTGG - Intronic
929371552 2:41230175-41230197 AAATAGCTAAAGCAATCTTGAGG - Intergenic
929813986 2:45216362-45216384 GAATAGCTAAAACAATCTTGAGG + Intergenic
930100542 2:47599754-47599776 GCCTAGCCAAGGCAATCCTGCGG - Intergenic
930931663 2:56891902-56891924 GAATAGCTAAAGCAAACTTAAGG + Intergenic
931003939 2:57826706-57826728 GAATAGTCAATGCAATCTTGAGG + Intergenic
931537633 2:63296973-63296995 AAATAGCCAAAGCAATCCTAAGG + Intronic
932880463 2:75496717-75496739 AAATAGCCAAAGCAATCCTAAGG + Intronic
933347799 2:81111548-81111570 AAATAGCCAAGGCAATCCTAAGG + Intergenic
933361201 2:81287208-81287230 AAAGAGCCAAAGTAATCTTGAGG - Intergenic
933418564 2:82020049-82020071 GAATAGCCAAAGCAATCCTGAGG + Intergenic
934959714 2:98660461-98660483 AAATAGCCAAGGTAATCATGAGG + Intronic
935343885 2:102085664-102085686 TAATAGCTATGGCAATCTTGAGG - Intronic
935926349 2:108073959-108073981 GTATAGCCAAGGCACTATTGTGG - Intergenic
936236227 2:110744989-110745011 GAACTGGCAAGGCAAACTTGGGG - Intronic
936775219 2:115964787-115964809 CAATAGCCAAGTCAATCAAGTGG - Intergenic
937196271 2:120159586-120159608 AAATAGCCAAGGCAATCCTAAGG + Intronic
937531507 2:122834122-122834144 GAATAGCCAAAACAATCTTTGGG + Intergenic
937540849 2:122950938-122950960 AAATAGCGAAGGCAATCCTAAGG - Intergenic
937666402 2:124492533-124492555 AAATAGCCAAAGTAATCCTGAGG - Intronic
938261586 2:129899745-129899767 GAATAGCCACAGCAATCCTGAGG + Intergenic
938506355 2:131888281-131888303 GTATAGCCAAGACAATCCTAAGG + Intergenic
938522858 2:132090375-132090397 GAAAAACCAAAGCAATCTAGAGG - Intergenic
939482382 2:142765693-142765715 AAATAGTCAAAGCAATCCTGAGG + Intergenic
939681712 2:145143601-145143623 GAATATCCAACACAATATTGAGG + Intergenic
939793525 2:146611499-146611521 AAATAGCCAAAGCAATATTGGGG - Intergenic
940540226 2:155005496-155005518 AAATAGCCATGGCTGTCTTGAGG - Intergenic
940621252 2:156116754-156116776 GAAAACTCAAGGCAAACTTGCGG - Intergenic
940750519 2:157622297-157622319 GAATAGCCAAAGCTATCCTAAGG + Intronic
941024806 2:160446823-160446845 GAAAAGTCAAGGCAAGCATGTGG - Intronic
941529862 2:166654636-166654658 GTATAGCCAAAGCAGTCCTGAGG - Intergenic
941797591 2:169617318-169617340 GTATAGCCAAGACAATCCTAAGG - Intronic
941971742 2:171358029-171358051 GAATAGCCAAAGCAATCCTGAGG + Intronic
942813907 2:180028982-180029004 GAATAGCCAAAGCTATCCTAAGG - Intergenic
943220089 2:185093007-185093029 GAATAGTCAAAACAATTTTGAGG + Intergenic
944604394 2:201337874-201337896 GAATAGCCAAAGCAATCCTGTGG - Intronic
944678939 2:202058848-202058870 GAATAGCCAAAGCAATTCTGAGG + Intergenic
944919718 2:204399433-204399455 GAATGGCCAAGACAATCTTGAGG + Intergenic
945004769 2:205392812-205392834 GCATAGCCAAGGCAGTGTGGGGG + Intronic
945511077 2:210703453-210703475 AAATAAGCCAGGCAATCTTGAGG + Intergenic
948043569 2:234925156-234925178 GAATAGCCAAGGCAATCCTAAGG - Intergenic
948394971 2:237638717-237638739 AAATAGCCATGGAAGTCTTGGGG + Intronic
948678706 2:239615662-239615684 GAATAGGCAAGGTAATCTAGAGG - Intergenic
1169504866 20:6198648-6198670 GAACACACAAAGCAATCTTGAGG - Intergenic
1169625196 20:7559290-7559312 GAATAGCCAAAGCAATCCTGAGG - Intergenic
1169933172 20:10855791-10855813 AAACAGCCAAGGCAATCTTGAGG + Intergenic
1171772814 20:29338553-29338575 GAATGGCAAAGCCAATCATGAGG - Intergenic
1171814647 20:29774479-29774501 GAATGGCCAAAGCTATCATGAGG - Intergenic
1171814768 20:29775877-29775899 GAATGGCCAAGCCAATCATGAGG - Intergenic
1171903667 20:30880849-30880871 GAATGGCCAAGCCAATCATGAGG + Intergenic
1172346215 20:34202779-34202801 GAATAGCCAAGGCAATCTTGGGG - Intronic
1172355197 20:34275048-34275070 GATTGGACAAGGCAGTCTTGGGG + Intergenic
1172822889 20:37754051-37754073 GAAGAGTCAATGCAAGCTTGAGG - Intronic
1173099439 20:40071291-40071313 GAATAGACAAAGCTATCTTAAGG + Intergenic
1173778628 20:45734859-45734881 AAATAGCCAAGGCAATCATGAGG + Intergenic
1173935634 20:46859950-46859972 GAATAACTAAGACAATCTGGAGG - Intergenic
1176773842 21:13110692-13110714 GAAAAACCAAAGCAATCTAGAGG + Intergenic
1177985887 21:27974097-27974119 GTATAGCCAAGACAATCCTAAGG - Intergenic
1179324520 21:40328176-40328198 GAATAGCCAAAACAATCTTGAGG + Intronic
1180241857 21:46513524-46513546 GAAGAGTCAAGGCAATCTTGAGG - Intronic
1180318095 22:11295033-11295055 GAATGGCCAAAGCAATCGTGAGG - Intergenic
1180318209 22:11296428-11296450 GAATGACCAAGCCAATCATGAGG - Intergenic
1180337064 22:11586808-11586830 GAATGGCCAAGCCAATCATGAGG + Intergenic
1180438603 22:15339985-15340007 GAAAAACCAAAGCAATCTAGAGG + Intergenic
1180521464 22:16210427-16210449 GAAAAACCAAAGCAATCTAGAGG + Intergenic
1182154597 22:28058046-28058068 GAATATCCAAAGCAATCTGGGGG - Intronic
1182156777 22:28081403-28081425 ACATAGCTAAGGCAATCTTAAGG - Intronic
1182164383 22:28158442-28158464 GAATAGCCAAAGCTATCCTAAGG + Intronic
1183446174 22:37856914-37856936 GAATAGTCAAAACAATCTTGGGG - Intronic
1184752331 22:46494284-46494306 GAATAGCCAAGGCCACTTTGAGG - Intronic
1184904771 22:47473797-47473819 GAATAGCCAAATCAATTGTGGGG + Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950176928 3:10881552-10881574 CAAGAGACAAGGCAATTTTGGGG - Intronic
950222035 3:11203802-11203824 GAATAACCAACACAATATTGAGG - Intronic
951515432 3:23554069-23554091 AAATAGCCAGAGCAATCCTGAGG + Intronic
952132258 3:30378354-30378376 GAATAGCCAAAGCTATCCTGAGG - Intergenic
952345390 3:32479272-32479294 GGATTGCCAAAGCAATCTTGAGG - Intronic
952543414 3:34392768-34392790 AAAAAACCAAAGCAATCTTGAGG - Intergenic
952580144 3:34823884-34823906 GTATGGCCAAGGCACTCTTATGG + Intergenic
953099975 3:39814729-39814751 GAATAGCCAAGACAGTTTTAAGG - Intronic
953268053 3:41412467-41412489 GAATAGCCAAAGCAAATCTGAGG + Intronic
953329528 3:42041062-42041084 GAATAGCCAAAATAATCTTGGGG - Intronic
953446003 3:42967291-42967313 GAATATCTAAGATAATCTTGAGG - Intronic
953696925 3:45166940-45166962 GAACAACCATGACAATCTTGAGG - Intergenic
953934461 3:47028216-47028238 GAAAAGCCAAGGTAATCATAGGG - Intronic
954102798 3:48390171-48390193 AAATAGCCAAAGCAATCTGGAGG - Intronic
954973758 3:54674008-54674030 GAATAGCCTAGGAAATCTCCAGG + Intronic
955118288 3:56028257-56028279 GAATAACTAAAACAATCTTGGGG - Intronic
955140576 3:56265137-56265159 AAATAGGCAAAGCAATCCTGAGG + Intronic
955930654 3:64053602-64053624 CAATAGCCAAAGGAAGCTTGCGG + Intergenic
956650687 3:71501862-71501884 GAAAAGACAAGGCCATCTTGAGG - Intronic
956840026 3:73130488-73130510 GCATAGCTAAAGCAATGTTGAGG - Intergenic
957289714 3:78263609-78263631 GAATAGTCAAAGGAATCCTGAGG - Intergenic
957561503 3:81827752-81827774 AAATAGCTAAAGCAATCCTGAGG - Intergenic
957688973 3:83542783-83542805 GAATTGCCAAAGTAATCTTGAGG - Intergenic
957751041 3:84416186-84416208 AAATAGCCTAAGCAATCCTGAGG + Intergenic
957916196 3:86691392-86691414 TAATACCCAAAGCAATCTTTGGG + Intergenic
958608043 3:96385467-96385489 GAATAGCCAAAGCAATTCTAAGG - Intergenic
958849775 3:99310645-99310667 AAATACCCAAGGCAATCCTAAGG + Intergenic
959407928 3:105984010-105984032 AAATAGCCAAAGCAATATTGAGG - Intergenic
960662462 3:120075908-120075930 GAACAGCCAAGGCAATTCTGAGG + Intronic
961911495 3:130321603-130321625 TAAGAGTCAAAGCAATCTTGAGG + Intergenic
961982835 3:131099425-131099447 GAATAGCCAAAGCAATCCTAAGG - Intronic
962335221 3:134523847-134523869 GAATAGCTAAGGCAATCCCAAGG - Intronic
962628727 3:137253996-137254018 AAATAGCCAAAGCAATCTTAAGG + Intergenic
962700501 3:137994186-137994208 AAAGAGCCAAAGCAATCTTGAGG - Intergenic
962944888 3:140158716-140158738 GAATAACCAAAGCAATCCTAAGG + Intronic
963237282 3:142968082-142968104 GAAAAGCTAAGGGAAACTTGAGG + Intronic
963272263 3:143297493-143297515 GAATAGCCAAAGCTATCTGGAGG - Intronic
963891796 3:150644321-150644343 GAATATCTAAAGCAAACTTGAGG + Intergenic
964488301 3:157208565-157208587 CAAAAGCCAAGGCATTCTTGGGG - Intergenic
964611069 3:158615752-158615774 GAACAGCCAAAGCAATTCTGAGG - Intergenic
965649862 3:170922643-170922665 GGATAGCCAAGGTAATCCTATGG + Intergenic
967628105 3:191709457-191709479 GAATAGTCAAAGCAATCCTGAGG + Intergenic
968535137 4:1121657-1121679 CAATAGCCAACACAATATTGAGG + Intergenic
969956859 4:10899414-10899436 AATTAGCCAAGGCAGTTTTGAGG - Intergenic
970164786 4:13225036-13225058 AAATAGCCAAAGCAATCTTGAGG + Intergenic
970248238 4:14086478-14086500 AAATAGCCAAGGCAATCCTAAGG - Intergenic
970395881 4:15665326-15665348 TCTTAGCCAAGGCAAACTTGAGG + Intronic
970693648 4:18648654-18648676 GAATGGCCAAAGCTATCCTGAGG + Intergenic
970792065 4:19869096-19869118 GAATAGCCAAAACAATCTTGAGG - Intergenic
970969718 4:21967866-21967888 CAATTGCCAAGGCAATCCTTAGG + Intergenic
973326887 4:48871406-48871428 GAATAGCCAAAGCTATCCTAAGG - Intergenic
973814520 4:54606966-54606988 GAATGTCAAAGGCAAGCTTGAGG - Intergenic
974234623 4:59165454-59165476 GAATACCCAAAGCATTCCTGAGG + Intergenic
974267649 4:59605463-59605485 GAATAGCCAAGGCCATGCTGAGG + Intergenic
974349683 4:60728697-60728719 AAATAGCCAAAGCAACCTTGAGG - Intergenic
974898007 4:67962582-67962604 TAATAGCCAAGACAGCCTTGTGG - Intronic
975953731 4:79809182-79809204 ATATAGCCAAGGCAATCCTAAGG - Intergenic
976818489 4:89177515-89177537 GACCAGCCATGGCAATCTAGGGG - Intergenic
976999318 4:91476582-91476604 AAATAGCCAAAGCAATTTTGAGG + Intronic
977493326 4:97740896-97740918 GCATCGCCAAGTCAATCTTAAGG + Intronic
977762592 4:100757710-100757732 GAATATCCAACACAATATTGAGG + Intronic
977872650 4:102111334-102111356 GAATAGCCAAAGCAATCCTGAGG + Intergenic
978435071 4:108675164-108675186 AAATAGCCAAGGGAATTCTGGGG + Intergenic
978601265 4:110430947-110430969 CAATACCCAAGGCAATCAAGTGG - Intronic
978893706 4:113859467-113859489 AAATAGCCAAGGCAATTTTGAGG - Intergenic
978990264 4:115072394-115072416 AAATAACCAAAGCAATCTTGAGG + Intronic
979086422 4:116416230-116416252 CAGTAGCCAAGGCAATCCTAAGG - Intergenic
979158876 4:117432585-117432607 GGATAGACAAGTTAATCTTGAGG - Intergenic
979762651 4:124426021-124426043 GCAAAGCCAAGGCTATATTGGGG - Intergenic
979781850 4:124661470-124661492 AAAAAGCCAAGGCAATCTTGAGG + Intergenic
979907336 4:126311957-126311979 AAATAGCCAAAGCAATCCTAAGG + Intergenic
980005501 4:127537801-127537823 GAATAGCCAACACAATCCTGAGG + Intergenic
980333182 4:131435987-131436009 AAATAGCCAAGACAATCCTAAGG - Intergenic
980415981 4:132489347-132489369 AAACAGCCAGAGCAATCTTGAGG + Intergenic
980919185 4:139065278-139065300 GAATAGCCTAGGCAACATAGGGG + Intronic
981150381 4:141373443-141373465 AAATAGCCAAAGCAATCCTAAGG - Intergenic
981263090 4:142746554-142746576 GCATAGCCAAGACAATCTTCAGG + Intronic
981298971 4:143165777-143165799 GACTAGCCAGGGCAATAGTGAGG - Intergenic
981441684 4:144790832-144790854 AAATAGCCAAGGCAATCCTAAGG - Intergenic
982323084 4:154100640-154100662 AAATATCCAAAGCAATCCTGAGG - Intergenic
983778021 4:171632903-171632925 TGATAGCCAAGGAAATGTTGAGG - Intergenic
983899422 4:173117896-173117918 GAAAAACCAAGGCAATCCTAAGG + Intergenic
984005838 4:174307144-174307166 AAATAGCCAAGGCAATCCTAAGG + Intronic
984076352 4:175185733-175185755 GAATAGCCAAAGCAATCCTAAGG - Intergenic
985359735 4:189160121-189160143 GAAGAGCCAATGCAATCTTGAGG - Intergenic
986131214 5:4933270-4933292 AAATAGCCAAGACAATTTTGAGG - Intergenic
986202778 5:5593042-5593064 GAATAGCTAAAGCAATCTTGAGG - Intergenic
987148540 5:15016226-15016248 GAGTAGCTAAGGGAATCTTTGGG + Intergenic
987530224 5:19108991-19109013 GAATAGCCAAAGCAATACTGAGG - Intergenic
987779924 5:22420630-22420652 GTATAGCCGAGACAATCTTAAGG - Intronic
987974517 5:24995751-24995773 AAATAGCCAAAGCAATCCTAAGG + Intergenic
988097894 5:26641151-26641173 GAATAGCCAAGGCAATCCTAAGG + Intergenic
988103224 5:26708782-26708804 GAATAGCCACAACAGTCTTGAGG + Intergenic
988221458 5:28351585-28351607 AAATAGCCAAAGTAATCTTGAGG + Intergenic
988626251 5:32878115-32878137 TAATAGCCAAAGCAATCCTAAGG - Intergenic
991008090 5:61851329-61851351 GAACAGCCAACACAATATTGAGG + Intergenic
991102485 5:62808260-62808282 GCATAGCCAAGGCAATCCAAAGG - Intergenic
991142780 5:63264833-63264855 GAATAGCCCAGACTATCTGGGGG - Intergenic
991504786 5:67313267-67313289 AAATAGCCAAAGCAATCCTAAGG + Intergenic
992020239 5:72616078-72616100 GAGTAGACAACACAATCTTGAGG + Intergenic
992312660 5:75517102-75517124 GAATAGCCAAAGCAGTCCTAGGG - Intronic
992525308 5:77604033-77604055 GAATAGCCAAAGCGATCTTGAGG - Intronic
993019063 5:82568990-82569012 GAATAGCTAAGGCAATCCTAAGG + Intergenic
993114783 5:83707266-83707288 AAATAGCCAAGGCAGTCCTAAGG + Intronic
993286143 5:85999905-85999927 GAATAGCCAAAGAAATCCTAAGG + Intergenic
993292381 5:86091266-86091288 GAATTGCCAAGGAGATCATGAGG - Intergenic
993375534 5:87145632-87145654 AAATAGCCAAGACAATCCTATGG - Intergenic
994125579 5:96166683-96166705 GCATAGCCTTGGCAATCATGAGG + Intergenic
994228510 5:97284069-97284091 GAATAGCCAAGGCAATCCTAAGG - Intergenic
994338210 5:98594580-98594602 AAATAGCTAAGACAATTTTGAGG - Intergenic
994807276 5:104465628-104465650 GAATATCCCAGCCAATCATGTGG - Intergenic
995354231 5:111219691-111219713 AAATAGACAAAGCAATCCTGAGG - Intergenic
995558009 5:113350225-113350247 GAACAGCCAAAGCTATCCTGAGG + Intronic
996055458 5:118977865-118977887 AAATAGCCAAGACAATCCTAAGG + Intronic
996305354 5:122040049-122040071 GAATAGCTAAGGAAATTTGGGGG - Intronic
997605404 5:135172403-135172425 GAATAACCAAAGCAATCCTGAGG - Intronic
997712256 5:136015602-136015624 GAAAAGTCAAGGCAATGTTGTGG + Intergenic
997774369 5:136587138-136587160 GAATAGCCAAAGCAATCCTAAGG + Intergenic
998178829 5:139921284-139921306 GAATAGCCAACTCAATATTGAGG + Intronic
1000015888 5:157275605-157275627 GGATAATCAAGACAATCTTGGGG - Intronic
1000819258 5:165963380-165963402 TAATAGCCAAGACAGCCTTGAGG - Intergenic
1001184256 5:169552797-169552819 GCATAGCCAAGACAATCCTAAGG + Intergenic
1001272174 5:170321512-170321534 GAGTAGCCAAAACAATTTTGGGG + Intergenic
1001442670 5:171756630-171756652 GAATAGTAAAGGCAAGCCTGTGG + Intergenic
1001736879 5:174012539-174012561 GAATAGCCAAAACAATTTTGGGG - Intergenic
1001793228 5:174479405-174479427 CCATATCCAAAGCAATCTTGAGG + Intergenic
1001820417 5:174705771-174705793 GAATCACCATGGCAGTCTTGTGG + Intergenic
1002047349 5:176549478-176549500 CTAGAGCCAAGGCAAGCTTGGGG + Intronic
1003249178 6:4410419-4410441 GTATAGCCAAGACAATCCTAAGG + Intergenic
1003263154 6:4542007-4542029 GAATAGCCAAAACAATCTTGAGG + Intergenic
1003316667 6:5019310-5019332 CAATAGCCAAATCAATCATGTGG - Intergenic
1004363067 6:14987997-14988019 GAACAGCCAGGGCATTGTTGTGG - Intergenic
1005383890 6:25266499-25266521 AGATAGCCAAGGGAATCATGGGG + Intergenic
1006460164 6:34153418-34153440 GACAAGCCAAGGCAGTCTTGGGG - Intronic
1007734900 6:43975544-43975566 GAATAGCTAAAACAATTTTGGGG - Intergenic
1008208516 6:48692067-48692089 GAATAACCAAGGCAATCTATAGG + Intergenic
1008237421 6:49067036-49067058 GAATAGCCAATGCCATCCTGAGG + Intergenic
1008343810 6:50401416-50401438 AAATACCCAAAGCAATCTTTAGG - Intergenic
1008715163 6:54280230-54280252 GAATAACCAAAACAATCTTGAGG + Intergenic
1009278259 6:61713597-61713619 GAAAAGCCAAAGCAATCCTAAGG - Intronic
1009342100 6:62568718-62568740 GAATAGACAACACAATATTGTGG + Intergenic
1010501221 6:76602736-76602758 GAATAGCCAAGACAATCCTAAGG + Intergenic
1010691156 6:78912067-78912089 GAATTGCCAAGTCAATTTTCTGG - Intronic
1011628675 6:89303622-89303644 AAATAGCCAAAGCAATCTTAAGG + Intronic
1011708772 6:90029797-90029819 GGATAGGCAAGGCGACCTTGAGG - Intronic
1011804492 6:91056218-91056240 AATTAGCTAAAGCAATCTTGGGG - Intergenic
1011921749 6:92586349-92586371 GAATAGCCAAGGTGGTCTGGAGG - Intergenic
1012005840 6:93712069-93712091 AAATTGCCAAAGCAATCCTGAGG - Intergenic
1012225321 6:96696958-96696980 GAATAGCCAAAGCTATCCTAAGG + Intergenic
1012505120 6:99936647-99936669 GAATAGCTAAAGAAATCCTGAGG - Intronic
1012578667 6:100835709-100835731 GGATAGCCAAAGTAATCTTGAGG - Intronic
1012875098 6:104717105-104717127 GAATATTCAAAGCAATATTGGGG + Intergenic
1013312138 6:108905456-108905478 AAATAGCAAAGGCAATCTTTGGG - Intronic
1014690693 6:124559897-124559919 GAATAGTCTAGGTTATCTTGTGG - Intronic
1016111898 6:140234774-140234796 GCAGAGCCAAGACAATCTTGGGG + Intergenic
1016127327 6:140420927-140420949 GAATAGAAAAGGCAATTTTGAGG - Intergenic
1016623339 6:146137616-146137638 GAATAGCCAAAGCTATCCTGAGG - Intronic
1016666025 6:146641431-146641453 GAATAGCCAAGGCAATCCCACGG + Intronic
1017110290 6:150925694-150925716 GAATAGCCAAGAGAAACATGTGG + Intronic
1018052197 6:160020478-160020500 TAATAGCCAAACCAATCTTAAGG + Intronic
1018086856 6:160308783-160308805 AAATAGCCAAAGTAATATTGAGG - Intergenic
1018405300 6:163475086-163475108 GAATAGCTAAGCCACTCTTGAGG + Intronic
1018550728 6:164995512-164995534 GAATAGCCAAAGCAATCCTGAGG + Intergenic
1020595298 7:10200231-10200253 GAACAGCCAAGATAATTTTGTGG - Intergenic
1021508167 7:21407766-21407788 GAATATCAAGGGCAATCTTGGGG + Intergenic
1023123934 7:36936342-36936364 GAAGAGCCCAGGGAATCATGGGG + Intronic
1023962280 7:44937025-44937047 GAATAGCCAAGGAAACTTTGTGG + Intergenic
1024351136 7:48366029-48366051 GAATAACCAAAGCTATCTTGAGG + Intronic
1024614442 7:51098291-51098313 AAATAACCAAAGCAATCTTGAGG + Intronic
1025164357 7:56698201-56698223 GAATAACCAAAGCAATCTTGAGG + Intergenic
1025705915 7:63863840-63863862 GAATAACCAAAGCAATCTTGAGG - Intergenic
1025717691 7:63977612-63977634 GAATAGCCAAGGCAGTTTTGAGG + Intergenic
1025755836 7:64339743-64339765 GAATATCCAAAGCAGTTTTGAGG - Intronic
1025774088 7:64543180-64543202 GAATAGTCAAAGCAATCTGGAGG + Intronic
1025804362 7:64816158-64816180 GAATAGCCAAAGCAATCTTGAGG - Intronic
1025816613 7:64919124-64919146 GAATAGCCAAAGCAATCTTGAGG - Intronic
1025870490 7:65427895-65427917 GAATAGTCAAGACAATCCTAAGG + Intergenic
1026429693 7:70332495-70332517 GTATAGCCAAGACAATCATAAGG + Intronic
1027453318 7:78358315-78358337 CAGTGGCCAAGGCCATCTTGTGG + Intronic
1027960590 7:84940649-84940671 AAATAGCCAAATCAATTTTGAGG + Intergenic
1028787404 7:94811339-94811361 GAATATCCAAAGCAATCCTGGGG + Intergenic
1030126696 7:106159828-106159850 AAATAGCCAAAGCAATCCTGAGG - Intergenic
1030429285 7:109421511-109421533 GAATAGCCAAAATAATCCTGTGG - Intergenic
1030793237 7:113755736-113755758 AAAAAGTCAAGGCAATTTTGCGG + Intergenic
1030850313 7:114476578-114476600 GAATAGCCAAAGTAATCCTAAGG - Intronic
1031289251 7:119911398-119911420 AATCAGCCAAAGCAATCTTGAGG - Intergenic
1031568963 7:123334649-123334671 AAATAGCCAAAGAAATCCTGAGG + Intergenic
1031892660 7:127312974-127312996 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1032309099 7:130765902-130765924 ACATAGCCAAGACAATATTGGGG - Intergenic
1032335354 7:131019863-131019885 GGATAGCCCCGGCAGTCTTGAGG + Intergenic
1033885625 7:145941492-145941514 AAATAGCCTAAGCAATCATGAGG + Intergenic
1034138474 7:148794522-148794544 GAATAGCCAATATAATCTTGGGG - Intronic
1035136840 7:156711535-156711557 GAATAGCCAAAGCAATCCTAAGG + Intronic
1035292066 7:157845584-157845606 GAACAGCCCAGGCAATGTTAAGG + Intronic
1036532705 8:9609603-9609625 GAAGAGCAAAGGAAATCTAGAGG - Intronic
1037462342 8:19124305-19124327 GAATAGCCAACTCAGTATTGAGG - Intergenic
1038755069 8:30332949-30332971 GAATAACAAAGGCAATTTTTTGG - Intergenic
1039631033 8:39111321-39111343 GAATAGCCAACTCATTATTGGGG - Intronic
1039670641 8:39593428-39593450 GAGTAGCCAAAGCAATACTGAGG + Intronic
1039736800 8:40341309-40341331 GAATAGCCAAAGAAGTCTTCTGG - Intergenic
1040374616 8:46812267-46812289 AAATAGCCAAAGTAAGCTTGCGG + Intergenic
1040921159 8:52619193-52619215 TAATAGCCAAAACAATCTTGGGG + Intergenic
1041563174 8:59244025-59244047 GAATTGTCAAAGCAATTTTGAGG + Intergenic
1042371585 8:67997571-67997593 GAATGGGCAAAACAATCTTGGGG - Intronic
1042592396 8:70409241-70409263 GAATAGCCAAGACAAACTTGAGG + Intergenic
1042726267 8:71880774-71880796 AAAGAGCCAAGGCAATCCTAAGG - Intronic
1043231509 8:77807995-77808017 GAATAGCCAAAGCAATACTGAGG + Intergenic
1044139171 8:88627800-88627822 AAATAGCCAAAGCAATCCTGAGG - Intergenic
1044228177 8:89743247-89743269 GAATAGACAAAGCAATCTTGAGG + Intergenic
1044620933 8:94190294-94190316 AAACAGCCAAGGCAACCTGGAGG + Intronic
1045053454 8:98347947-98347969 GAATAGCCAACACAATATTGAGG + Intergenic
1045612509 8:103862430-103862452 GAATAGCCAAAGCAATCCAAGGG - Intronic
1046281049 8:112032369-112032391 GAATAGCCAAAAAATTCTTGAGG + Intergenic
1046840995 8:118857026-118857048 GTATAGCCAAGACAATCCTAAGG + Intergenic
1047130384 8:122013273-122013295 AAATAGCCAAGGAAATCCTAAGG - Intergenic
1047256898 8:123220728-123220750 CTATAACCAAAGCAATCTTGGGG + Intronic
1048238540 8:132716956-132716978 AAATAGCTAAAACAATCTTGAGG + Intronic
1048827101 8:138438902-138438924 AAATTGCCATGGCAACCTTGTGG + Intronic
1048939708 8:139388258-139388280 GAATAGCTCAGACAATTTTGAGG + Intergenic
1049371326 8:142269068-142269090 AAACAACCAAGGCAAACTTGAGG - Intronic
1049484232 8:142844014-142844036 GAATAACCAAAGCAGTCTTGGGG + Intronic
1050784379 9:9381831-9381853 AAATAGCCAAAGCAATCTTGGGG - Intronic
1051703038 9:19844972-19844994 GAATAGCCAAGGCAATCCTCAGG - Intergenic
1051748137 9:20315290-20315312 GAATAACAAAATCAATCTTGTGG + Intergenic
1052154169 9:25163172-25163194 GAATGGTCAAGGAAAACTTGTGG - Intergenic
1052259531 9:26497677-26497699 AAATTGCCAAGGCAATCCTGAGG + Intergenic
1052262416 9:26532606-26532628 GGATAGCCAATGCAATCTTAAGG + Intergenic
1052778536 9:32756961-32756983 GACTAGCCAAGACACTCTTAAGG + Intergenic
1053663365 9:40300093-40300115 TAATAGCCAAGACAATTGTGGGG + Intronic
1053664833 9:40310192-40310214 TAATAGCCAAGACAATTGTGGGG + Intronic
1053701536 9:40697495-40697517 GAAAAACCAAAGCAATCTAGAGG - Intergenic
1053913876 9:42930634-42930656 TAATAGCCAAGACAATTGTGGGG + Intergenic
1054375488 9:64446327-64446349 TAATAGCCAAGACAATTGTGGGG + Intergenic
1054411601 9:64820950-64820972 GAAAAACCAAAGCAATCTAGAGG - Intergenic
1054519782 9:66066092-66066114 TAATAGCCAAGACAATTGTGGGG - Intergenic
1054521250 9:66076192-66076214 TAATAGCCAAGACAATTGTGGGG - Intergenic
1054837524 9:69693622-69693644 GAATAGCCAAAGCAATTCTGAGG - Intergenic
1055245983 9:74243099-74243121 AAATAGCCAAAGCAATTCTGAGG - Intergenic
1055460398 9:76514079-76514101 GAATAGCCAAATTAATCCTGAGG - Intergenic
1055908782 9:81323726-81323748 AGATAGCCAAAGCAATCCTGAGG - Intergenic
1056968542 9:91184154-91184176 GACAAGCCAAGGCCATCTGGAGG + Intergenic
1057039216 9:91835279-91835301 GAGGAGCCAAGGCTATTTTGGGG - Intronic
1057860484 9:98636955-98636977 GTAGAGCCAAGGAATTCTTGAGG + Intronic
1058256558 9:102773149-102773171 GAATAGCCAATATATTCTTGAGG - Intergenic
1062603583 9:137332269-137332291 GAATAGCCAAAGCAGTCCTAAGG + Intronic
1203366437 Un_KI270442v1:262190-262212 GAATGACCAAGCCAATCATGAGG - Intergenic
1186810699 X:13185666-13185688 GTATAGCCAAGACAATCCTAAGG + Intergenic
1187834888 X:23422160-23422182 AAATAGCCAAAGCAATCCTAAGG - Intergenic
1188265005 X:28062456-28062478 GGATAGCCAAAGGAATCCTGGGG - Intergenic
1188265626 X:28069857-28069879 GAATAGCCAAAGCTATCCTGAGG - Intergenic
1188531793 X:31149403-31149425 GAATAGTCAAGACAATTTTGAGG - Intronic
1188608014 X:32057772-32057794 AAATAGCCAAAACAGTCTTGAGG + Intronic
1188657981 X:32722110-32722132 AAATAGCCAGAACAATCTTGAGG - Intronic
1189021290 X:37343793-37343815 AAATAGCCAAGGCAATCCATTGG - Intergenic
1189024159 X:37373252-37373274 CAATAGCCAAAGCAGCCTTGAGG - Intronic
1189059868 X:37741790-37741812 GAATAGCCAAAGCTATCCTAAGG + Intronic
1189869509 X:45367657-45367679 AAATAGCCAAAATAATCTTGAGG + Intergenic
1190583598 X:51914120-51914142 GAATAGCCAAAGGAATTCTGAGG - Intergenic
1190807037 X:53848078-53848100 GAACAGCCAAAGCCATCCTGAGG - Intergenic
1190966280 X:55304491-55304513 GAATAGCCAAATCAATCAAGTGG - Intergenic
1191042730 X:56102409-56102431 CAATAGCCAAAGCAATCCTAAGG - Intergenic
1191232020 X:58103474-58103496 GAATAGCCCAGGCATTCTAATGG + Intergenic
1191708666 X:64122539-64122561 GAATAGCCAAATCTATCCTGAGG - Intergenic
1191730290 X:64326726-64326748 GAATAGCTGAGGCAAACTTGTGG + Intronic
1191757929 X:64614502-64614524 AAATACTCAAAGCAATCTTGAGG - Intergenic
1191980371 X:66918205-66918227 CAATAGCCAAGGTATTTTTGTGG - Intergenic
1192045443 X:67667519-67667541 GGATAGGCAAAGCTATCTTGAGG - Intronic
1192258233 X:69484282-69484304 GCATAGCCAAGGCAATCCTAAGG - Intergenic
1192284143 X:69716529-69716551 AAGTAGCCAAGGCAATCCTAAGG - Intronic
1192696865 X:73425949-73425971 AAATACCCAAGGCAATCCTAAGG + Intergenic
1192702792 X:73493494-73493516 GTATAGCCAAGACAATCCTAAGG - Intergenic
1192845171 X:74899764-74899786 GAATAGCCAGAGTAATCTTGGGG + Intronic
1192929881 X:75794909-75794931 GTATAGCCAAGACAATCCTAAGG - Intergenic
1193163010 X:78249556-78249578 AAATAGCCAAAGCAATCCTAAGG - Intergenic
1193190303 X:78563265-78563287 GAAGAGTCCAGGCAATCTGGAGG - Intergenic
1193305106 X:79940384-79940406 GAATAGCCAAAGCAATTATGAGG - Intergenic
1193381734 X:80823677-80823699 GTAAAGCCAAGGCAATCCTAAGG - Intergenic
1193502892 X:82302037-82302059 AAATAGCCAAAGCAATCGTATGG + Intergenic
1193516299 X:82469103-82469125 AAACAGCCAAAGCAATTTTGAGG - Intergenic
1193973436 X:88086935-88086957 AAATAGCCAAGACAATCCTAAGG - Intergenic
1194040425 X:88935200-88935222 GAATAGCCAAAGCAACCCTAAGG - Intergenic
1194223880 X:91230525-91230547 AAAGTTCCAAGGCAATCTTGAGG + Intergenic
1194490514 X:94541205-94541227 AAATAGCTAAAGCAATCTTGAGG + Intergenic
1194576201 X:95617689-95617711 GAATAGCCAAATCAATCAAGTGG - Intergenic
1194824892 X:98549808-98549830 AAATAGCCAAGGGAGTCCTGAGG - Intergenic
1194831981 X:98634307-98634329 GTATAGCCAAAGCTATCTTGAGG + Intergenic
1194872583 X:99151569-99151591 GAATAATCAATGCAATCCTGAGG + Intergenic
1195179969 X:102348659-102348681 GAATAGCCAAGGCAATCCTCAGG - Intergenic
1195241226 X:102954223-102954245 AAATAGCCAAGGCAATTCTGAGG - Intergenic
1195528785 X:105926939-105926961 GAATAGCCAAAGCAATCCTGAGG - Intronic
1195582441 X:106522839-106522861 GAATAGCCAAAACAATCTTGAGG - Intergenic
1195833876 X:109090354-109090376 GAACACCCAAGGCAATCCTAAGG - Intergenic
1195873928 X:109518079-109518101 GAATAGCCAAAGCTATCATAAGG + Intergenic
1196205845 X:112938316-112938338 GAATAGCCAAAGCTATCCTAAGG + Intergenic
1196517885 X:116634563-116634585 GAATAGTCAAGGCTATCCTGAGG + Intergenic
1197028192 X:121781363-121781385 GAATAGCCAAAGCTATCTTAGGG - Intergenic
1197089246 X:122517262-122517284 GAATAGCCAAAGCAATCCTAAGG + Intergenic
1197115218 X:122824118-122824140 GAATAGACATAGCATTCTTGGGG - Intergenic
1197374717 X:125668245-125668267 GAATAACCAAAGCAATCCTGTGG + Intergenic
1197473686 X:126893826-126893848 GAATAACCAAAGCCATCTTGAGG - Intergenic
1198577939 X:138031100-138031122 GCATAGCCAGGGCAATCCTAAGG + Intergenic
1198714884 X:139546996-139547018 GGATAGCCAAGACAGTTTTGAGG + Intronic
1198885394 X:141330154-141330176 GAATAGCCAAGATAATCTTGAGG + Intergenic
1198930163 X:141848810-141848832 GAATAGCCAAAGCAATACTAAGG + Intronic
1198976763 X:142344275-142344297 GAGTAGCCAAAGCAGTCTTAAGG + Intergenic
1199182064 X:144869330-144869352 GAAACGCCAAGGCAATCCTAAGG - Intergenic
1199224146 X:145353131-145353153 GAATAGCCAAGACAATCCTAAGG + Intergenic
1199239360 X:145528260-145528282 AAATAGCCAAGACAATCCTGAGG - Intergenic
1199488699 X:148375406-148375428 GAATAGCCAAGGCACTGCTAAGG + Intergenic
1199706705 X:150432873-150432895 AAATAGTCAAGGCAATCCTAAGG - Intronic
1199926134 X:152466203-152466225 GAATAGCCAAAGCAATCTTGAGG + Intergenic
1200362054 X:155617474-155617496 AAAGAGCTAAGGCAGTCTTGGGG - Intronic
1200673216 Y:6120081-6120103 AAATAGCCAAGGCAATCCAAAGG - Intergenic
1201072245 Y:10158041-10158063 GAATGGCCAAACCAATCATGCGG + Intergenic
1201072361 Y:10159437-10159459 GAATGGCCAAAGCAATCATGAGG + Intergenic
1201625363 Y:16008840-16008862 GCATTGCCAAGGCAATCCTAAGG - Intergenic