ID: 1150548562

View in Genome Browser
Species Human (GRCh38)
Location 17:66188355-66188377
Sequence CATTGTGGCAAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150548562_1150548567 -8 Left 1150548562 17:66188355-66188377 CCCACTTCCCTCTTGCCACAATG 0: 1
1: 0
2: 2
3: 23
4: 258
Right 1150548567 17:66188370-66188392 CCACAATGAACTCCTCACCATGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150548562 Original CRISPR CATTGTGGCAAGAGGGAAGT GGG (reversed) Intronic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
907408203 1:54266954-54266976 CATTGTGGCAAGAATGAAACTGG - Intronic
911118542 1:94271902-94271924 CTTTGTGTCCAGAGGCAAGTAGG + Intronic
914354771 1:146875097-146875119 CATTGCTGCAAGAGCAAAGTGGG + Intergenic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
918482157 1:184990548-184990570 CATGGTGGAAAGAGGGAAAAAGG - Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
920188351 1:204176491-204176513 CATTATGGAAAGTGGGAAGAAGG + Intergenic
920554642 1:206895738-206895760 CATGGTGGGAAGGGGGGAGTGGG + Intergenic
920868629 1:209774460-209774482 CATTGTGGGATGGGGGTAGTTGG + Intronic
921345395 1:214178672-214178694 AATTGTGGCAGGGGGGAAATGGG + Intergenic
924204546 1:241698393-241698415 TATTGAGGCAAGAGGGCAGTTGG - Intronic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1063467785 10:6258905-6258927 CTTTGTGGTAACAGGAAAGTTGG - Intergenic
1064590435 10:16884628-16884650 CTTTGTGGTAAGCGGAAAGTAGG + Intronic
1064948236 10:20816903-20816925 GATTGTGGGAAGTGGAAAGTGGG + Intronic
1065357973 10:24861091-24861113 TATAGTGGTAAGTGGGAAGTAGG + Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066156889 10:32687703-32687725 CACTGTGGAAATAGGGACGTTGG + Intronic
1067808167 10:49407535-49407557 AATCGTGGGAAAAGGGAAGTGGG + Intergenic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1068102570 10:52573961-52573983 CATTGTGGCAAGAGCCATGCAGG + Intergenic
1068461177 10:57331015-57331037 AATTGTGGCAAGTGGAAAGATGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070793123 10:79201498-79201520 TGTTGTGGCCAGAGGGCAGTTGG + Intronic
1072671051 10:97429435-97429457 TATTGTGGCAAGAGTTATGTTGG - Intronic
1074107382 10:110398672-110398694 CATCCAGGCAAGAGGGAAATGGG - Intergenic
1074622088 10:115136343-115136365 CATTGGGGCAGGAGGTAAATGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075206184 10:120451044-120451066 CATTGTGGGATGGGGGGAGTGGG + Intergenic
1076146265 10:128125151-128125173 CCTTGTGGCAATAGGAAAATGGG - Intronic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1077358919 11:2131150-2131172 CATGGTGGAAAGATGGAATTAGG + Intronic
1078166259 11:8888371-8888393 CATTGTTGCAAGAATGAACTTGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078453407 11:11456936-11456958 CATGGAGACAAGTGGGAAGTGGG + Intronic
1078877831 11:15415779-15415801 AATTGTGGCAAGAGGGCAGGGGG - Intergenic
1080115528 11:28617577-28617599 CATTGTAGGAAGAGAGAAGCAGG - Intergenic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1080771309 11:35344702-35344724 CATTGTCTGAAGAGGGAGGTTGG - Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1092859364 12:12706878-12706900 CAAAGAGGCAAGAGAGAAGTAGG - Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094166577 12:27449723-27449745 CAATGTACCAAGAGGGGAGTGGG - Intergenic
1094461390 12:30699982-30700004 GGTGGTGGCAAGGGGGAAGTGGG + Intergenic
1095413044 12:41945471-41945493 CATGGTGGCAGGAGGGATGGGGG + Intergenic
1096069229 12:48765684-48765706 AATTGTGGCAAGAGTGCAGAGGG + Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098519588 12:71420611-71420633 CAATATGGCAAGAGGCATGTGGG + Intronic
1099071607 12:78051172-78051194 CATTGTGTGAAGAGGGGAGGTGG + Intronic
1099560345 12:84165234-84165256 CATTATGGCTAGAGTGAAGGAGG + Intergenic
1101407676 12:104443065-104443087 CATTCTTGTAAGAGGGAAGCAGG + Intergenic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1103398898 12:120629006-120629028 CCATCTGGCAGGAGGGAAGTGGG + Intergenic
1104094617 12:125545687-125545709 CATGGTGGCAAGATGGCAGCTGG - Intronic
1104230139 12:126876736-126876758 CTCTGTAGCAAGAGGGAAGCAGG + Intergenic
1104647584 12:130508377-130508399 CATAGTGGCAACAGGGTAGCAGG - Intronic
1105671945 13:22628977-22628999 CATTGTGGGAAAAGGGGAGGTGG - Intergenic
1105683256 13:22751877-22751899 GACGGTGGCAAGAGGGAGGTGGG - Intergenic
1106910335 13:34456390-34456412 CATAGTGGCAGGAGAGAAGGGGG - Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107549552 13:41462102-41462124 CCCTGTGGCAAAAGGGAGGTAGG + Intronic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1110362575 13:74643939-74643961 TTTGGTGGTAAGAGGGAAGTTGG - Intergenic
1110835568 13:80078301-80078323 GATTGTGGTAAGATGGCAGTGGG + Intergenic
1110939067 13:81326850-81326872 CATGGAGGCAAGAGGTGAGTGGG - Intergenic
1111922932 13:94431317-94431339 CCTTGTGAGAAGAGGAAAGTTGG + Intergenic
1112528763 13:100180442-100180464 CATTGTGGGAAGAGGAATCTTGG - Intronic
1112610393 13:100949448-100949470 CATTTTGGCAAGAGGAAGGTGGG + Intergenic
1114408453 14:22478053-22478075 CATTGTGGAAAGAGGAACGTTGG + Intergenic
1114536478 14:23426080-23426102 CCCTGTGGCAAGAAGGAAGTAGG + Exonic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115904296 14:38189800-38189822 GATTGGGGCAAGGGAGAAGTTGG - Intergenic
1116619264 14:47177645-47177667 TGTTGTGGCATGAGGGCAGTGGG + Intronic
1117224564 14:53641335-53641357 CATTGTGGCAAAACAGAAGGAGG - Intergenic
1119768372 14:77205114-77205136 CCCTGTGGCAGGAGGGAAGGTGG + Intronic
1120734370 14:88036788-88036810 CATTGTGACAAAAGAGAATTTGG + Intergenic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1124684673 15:31771925-31771947 CATTGTGGAAAGTGAGAAGGAGG - Intronic
1129102126 15:73275180-73275202 CTTTGTGGGAAGAGGAAAATAGG - Intronic
1129234229 15:74214158-74214180 CATTGTGGGAAGCAGGAAGGGGG + Intergenic
1130805343 15:87314964-87314986 CATTGTGTTAGGAGGCAAGTAGG - Intergenic
1131366917 15:91849483-91849505 CATTTTGGTAGGAGAGAAGTGGG - Intergenic
1133431473 16:5740720-5740742 CATGGTGGCAAAAGGGCTGTGGG + Intergenic
1133877983 16:9752694-9752716 CCTTATGGCAAGAGGGAAAAGGG - Intergenic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1138448038 16:57077085-57077107 AATTGTAGCAAGAGGGATTTAGG + Intronic
1139979249 16:70840435-70840457 CATTGCTGCAAGAGCAAAGTGGG - Intronic
1140110069 16:71996583-71996605 CATGGGGGCAGGAAGGAAGTAGG - Intronic
1140792944 16:78409843-78409865 GATTGTGGCTAGAGGGAAATGGG - Intronic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142271518 16:89092184-89092206 CATAGTGGCAGGTGGGAAGCAGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142793421 17:2287886-2287908 GGTTGTGGGAAGAGAGAAGTGGG + Intronic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144422632 17:15112011-15112033 CACTGTAGCAGGAGGGGAGTGGG + Intergenic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150889800 17:69134771-69134793 CATTATGGGACGAGGGCAGTTGG + Intronic
1151137158 17:71957732-71957754 CATGGTGGCAGGAGAGAAGCTGG - Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1155309997 18:24514114-24514136 CATTATGGCATGAGGAAAATGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156011722 18:32504369-32504391 CATTGTGTCAGTAGGGCAGTAGG - Intergenic
1156527134 18:37777972-37777994 CATTGTGGGAAGAGGGGAAGAGG + Intergenic
1157534475 18:48448240-48448262 CAGATTGGCAAGGGGGAAGTCGG - Intergenic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1158746394 18:60204557-60204579 TATGTTGGCAAGAGGGAAGGAGG - Intergenic
1158940129 18:62400040-62400062 CAAGGTGGCAAGGGTGAAGTAGG - Intergenic
1159088077 18:63817240-63817262 CATTGCTGAAAGAGGGAAGAGGG - Intergenic
1161393093 19:4031500-4031522 CTTTGAGGGAAGAGGGAGGTGGG - Intronic
1161805804 19:6442247-6442269 CATTGCAGCAGGAGGGAAGGAGG + Intronic
1163098428 19:15078263-15078285 CATTGAGGGAAGAGGTATGTGGG - Intergenic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
927463266 2:23317909-23317931 CATTGCGGGAAGAGCGAAGTTGG - Intergenic
927756025 2:25708533-25708555 CCTTGGGGGAAGAGGGTAGTAGG + Intergenic
927770093 2:25853081-25853103 CATGGTGGAAAGGGGGAAGATGG - Intronic
928876045 2:36041474-36041496 AAGTGTGGCAAGAGGGCAGCTGG - Intergenic
931863422 2:66381840-66381862 CTTTGTGGAAAGAGGTTAGTAGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
933497943 2:83074947-83074969 GATGGTGGCAAGAGTGAGGTGGG - Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
939859942 2:147407122-147407144 AGTGGGGGCAAGAGGGAAGTGGG + Intergenic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
942349212 2:175035522-175035544 CCTTGTTGCAAGATGGAATTGGG - Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
943219162 2:185082562-185082584 CATGGTGGCAGGAGAGAAGGCGG - Intergenic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
947117762 2:226790667-226790689 CAGTGATGCAAGAGGGATGTTGG + Intronic
947861838 2:233366048-233366070 CCCTGTGGCAAGAGGGAGCTTGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
1169776599 20:9262071-9262093 CATTCTGGAAAGTGGGAATTTGG + Intronic
1170845540 20:19958955-19958977 CATGGTGGCATGAGTGAAGTGGG + Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172906277 20:38372169-38372191 CTTTCTGGAAAGAGGGAAGGAGG + Intronic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173495661 20:43515412-43515434 CATGGTAGGAAGAGGGCAGTGGG + Exonic
1173718126 20:45229464-45229486 CACAGTGGGAAGAGGGAAATTGG + Intergenic
1174145226 20:48448544-48448566 CATGGTGGGAAGAGGGCAGCAGG + Intergenic
1174619498 20:51863274-51863296 TTTTCTGGCAAGACGGAAGTAGG + Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1178112710 21:29385091-29385113 CATTGTGCCAGGAGGAAAGAAGG - Intronic
1178220191 21:30647788-30647810 CAATGTGGCATGGTGGAAGTAGG - Intergenic
1178359205 21:31933873-31933895 CATGGAGGGGAGAGGGAAGTGGG - Intronic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179374822 21:40841235-40841257 CAAGGTGGCAGGAGGGAAGCAGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1181096660 22:20509604-20509626 CATTGTGGAAGGAAGGAAGCCGG + Intronic
1182642607 22:31780543-31780565 CATGGTGGCAAGAGAGAAGGTGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184880090 22:47299200-47299222 CCTTGGGGCAAGCGGGATGTTGG + Intergenic
950196268 3:11011261-11011283 CATAGGGGCAAGGGGGAAGCAGG - Intronic
952849677 3:37717565-37717587 CATGGTGGCAGGAGAGAAGGGGG + Intronic
953042344 3:39266643-39266665 CAAGATGGCAAGTGGGAAGTTGG - Intronic
953114327 3:39976891-39976913 CGTTGTGGGAGGAGGGGAGTGGG + Intronic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953249086 3:41226944-41226966 CACTGTGGGAAGAAGGAAATTGG + Intronic
953420206 3:42748378-42748400 CATTGTGGCCACAGGAACGTTGG + Intronic
954979643 3:54733309-54733331 CCTTGTGCCAAGAGGGCAGCTGG + Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958858479 3:99416454-99416476 GAATGGGGTAAGAGGGAAGTGGG + Intergenic
959922801 3:111887405-111887427 CATTGTGGTAAAAGGGATGACGG + Intronic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
963045907 3:141102579-141102601 CCCTGTGGCAAGAGGGAGGCTGG + Intronic
963429100 3:145174199-145174221 AATTGTGGAAAGAGGAAAATAGG - Intergenic
963765682 3:149333753-149333775 CCTTGTGTTAAGAAGGAAGTTGG + Exonic
964019750 3:151995223-151995245 CATTGTGGCAAGGAGAGAGTTGG + Intergenic
964387225 3:156160886-156160908 CATTGTGGCATGAAGGAAGGAGG + Intronic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
965969724 3:174539946-174539968 CATTTTGCCAAGAGAGAATTAGG + Intronic
967750952 3:193115821-193115843 CATTGGGGAAAGATGGAGGTGGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969701583 4:8770605-8770627 CTTTGTGGCCAGAGGGCTGTGGG + Intergenic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
971851863 4:31994530-31994552 CATGATGGCAAGTGGGGAGTAGG - Intergenic
972579684 4:40384247-40384269 GATAGAGGGAAGAGGGAAGTGGG + Intergenic
973188624 4:47361374-47361396 CTTTGTGGCAAGAGGAACATGGG + Intronic
973818078 4:54637066-54637088 CATTGTGGCAAGTGGCAAAGAGG - Intergenic
977382366 4:96292033-96292055 CATTGTGGAGAATGGGAAGTAGG - Intergenic
979566613 4:122161229-122161251 CATTGTTGCATGAGGGATTTGGG + Intronic
980342333 4:131566780-131566802 CATTCTGACAATAGGAAAGTTGG + Intergenic
982362014 4:154529034-154529056 CATAGTAGCTACAGGGAAGTAGG - Intergenic
982484888 4:155954410-155954432 GATTGTGGCAAGAAGGAAAAAGG - Intergenic
982673384 4:158348632-158348654 CCTTGGGGCAAGTGAGAAGTGGG - Intronic
985915376 5:2914368-2914390 GCTTTTGGCAAGTGGGAAGTTGG - Intergenic
986278585 5:6304140-6304162 CACTGTGGTAAAAAGGAAGTAGG + Intergenic
987033837 5:14000183-14000205 CCTTCTGAAAAGAGGGAAGTTGG + Intergenic
988137170 5:27188827-27188849 CAGTGGGGCAAGAGAGATGTGGG + Intergenic
990621298 5:57562212-57562234 CATTGTAGTAAGAGGCAAGTTGG - Intergenic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
997677795 5:135726457-135726479 AATGGAGGCAAGAGGGAGGTAGG - Intergenic
997750090 5:136336007-136336029 AGATGTGGCAGGAGGGAAGTTGG - Intronic
998536427 5:142935740-142935762 CATTGTTGTATGAGGGAAGGAGG + Intronic
998761120 5:145433431-145433453 CATTGTGTCAATAGGGAAACTGG + Intergenic
999231178 5:150062938-150062960 CATCATGGCTTGAGGGAAGTGGG + Intronic
999246511 5:150157841-150157863 CTTTGTGGCAACAGGGAAATAGG + Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000672404 5:164078742-164078764 CACTGTGGCAGGAGAGAAGCAGG - Intergenic
1001679511 5:173545911-173545933 CCTTGTGGGAAGAGGGGAGGGGG - Intergenic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1004239602 6:13908012-13908034 CATTGTTGCAGGAGGAAGGTAGG - Intergenic
1005143482 6:22661404-22661426 CATTGTGGCAGGAAGGAAAAGGG + Intergenic
1008379854 6:50828832-50828854 CATGTTGGGAAGATGGAAGTTGG + Intronic
1008578561 6:52884485-52884507 CATGATGGGAAGTGGGAAGTTGG - Intronic
1010506090 6:76661411-76661433 CACTGTGGCAACTGAGAAGTGGG + Intergenic
1010568316 6:77445832-77445854 CTTTGTGGGAAGGGGGAAGGAGG + Intergenic
1010701683 6:79056575-79056597 AATTGTGACAAGGGGGTAGTGGG + Intronic
1010833342 6:80557008-80557030 CAATGTGGCAAGAGGGTGGTGGG - Intergenic
1014747247 6:125214406-125214428 GATTGTGGGAAGAGGAAAGGAGG - Intronic
1016944272 6:149514192-149514214 CATAGTGAAAAGAGGGAAGTTGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017685151 6:156906068-156906090 CACTGTGGAAAGGGGGAGGTGGG + Intronic
1017834491 6:158164915-158164937 CATTCTAGCAAGAGGGAGGAGGG - Intronic
1017965323 6:159259370-159259392 CATTGTGTCAACAGGGAAGGTGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1019321084 7:415524-415546 AATTGTGGGAGGAGGGGAGTGGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020989742 7:15182190-15182212 GTTTGGGGGAAGAGGGAAGTGGG + Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022337129 7:29432431-29432453 AATTATGGGGAGAGGGAAGTGGG - Intronic
1023201146 7:37698312-37698334 CATGGTGGTAGGAGGGAAGAAGG - Intronic
1025718054 7:63982309-63982331 CATGGCTGCAGGAGGGAAGTGGG + Intergenic
1026782429 7:73277899-73277921 CCTAGAGGAAAGAGGGAAGTGGG + Intergenic
1026870292 7:73846926-73846948 CAATGTGGCAAGTGAGAGGTTGG - Intergenic
1027023191 7:74830720-74830742 CCTAGAGGAAAGAGGGAAGTGGG + Intronic
1027064739 7:75114576-75114598 CCTAGAGGAAAGAGGGAAGTGGG - Intronic
1027211186 7:76150198-76150220 CATTTGGGCAAGACGGAGGTTGG - Intergenic
1027744617 7:82057639-82057661 CATAATGGTAAGAGGGAACTTGG + Intronic
1028175854 7:87657580-87657602 CATTGTGGGAAGGGGGGTGTTGG - Intronic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1032110213 7:129069460-129069482 CATTGGAGGAAGAGGGAAATTGG - Intergenic
1032986161 7:137339720-137339742 CATCATAGCAAGAGGGAATTGGG + Intronic
1033048730 7:137985147-137985169 CATTATGGAAAGGGGGAAGGGGG + Intronic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1035270531 7:157717266-157717288 CATGGAGGCAAGAGGCATGTCGG + Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1038869911 8:31482425-31482447 AATTGCAGCAAGAGGGAAGGTGG - Intergenic
1039223895 8:35366312-35366334 CCATGTGGCAAGAGAGAAATGGG - Intronic
1040563234 8:48543129-48543151 CATTTTGGCAAGACAGCAGTTGG + Intergenic
1040732039 8:50459673-50459695 CACTGAGGCAGGAGGGAAGGAGG - Intronic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1041814901 8:61959329-61959351 AATAGTGGTAAGAGGGAGGTGGG - Intergenic
1042355372 8:67822233-67822255 CATTGAGGAAAGGAGGAAGTAGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042932008 8:74023150-74023172 CATGGTGCCAGCAGGGAAGTGGG - Intronic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048128537 8:131665012-131665034 CATGGTGGCAAAAAGGCAGTAGG + Intergenic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1051361273 9:16283663-16283685 GAGTGTGGCAAGAGGGAATCAGG - Intergenic
1055459433 9:76503924-76503946 CATTGTGGAAAGAGGGGACCAGG + Exonic
1055982819 9:82022273-82022295 AATTTTGGCAAGAGGGAATTTGG - Intergenic
1057674407 9:97127339-97127361 CCTGGGGGCAGGAGGGAAGTGGG + Intergenic
1058595672 9:106612982-106613004 CACTGTGGCAACAGAGAAGGAGG - Intergenic
1058645663 9:107129549-107129571 CATTGTGTGAACAAGGAAGTTGG - Intergenic
1061954301 9:133953631-133953653 CATGGTGGTCAGAGGGAACTGGG - Intronic
1062514946 9:136928378-136928400 CATTTTGGAAGGTGGGAAGTGGG + Intronic
1185952174 X:4449477-4449499 CATTAAAGGAAGAGGGAAGTTGG + Intergenic
1187300418 X:18043796-18043818 CACTGTGGAAAGAAGGGAGTAGG + Intergenic
1189453142 X:41158398-41158420 CATTGAGGCCAGAAGGCAGTAGG + Intronic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1194968810 X:100320082-100320104 CGTTGTGGCAAGAGGAATGAGGG - Intronic
1195474147 X:105264837-105264859 CATTGTCTCTAGAGGGATGTTGG + Intronic
1195613743 X:106896458-106896480 CCATTTGGCAAAAGGGAAGTGGG + Intronic
1197912032 X:131493082-131493104 CGCTGTGGCAACAGGCAAGTGGG - Intergenic
1198329270 X:135606624-135606646 CATTATGCCAAGAGGTAAGAAGG + Intergenic
1199743806 X:150759300-150759322 TATTTTGGCAACAGGGAAGATGG + Intronic
1200861836 Y:8000892-8000914 CATTTGGGCAAGAAGGGAGTAGG + Intergenic