ID: 1150553378

View in Genome Browser
Species Human (GRCh38)
Location 17:66231437-66231459
Sequence TAGGATGAAAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2305
Summary {0: 1, 1: 1, 2: 9, 3: 207, 4: 2087}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150553378_1150553384 11 Left 1150553378 17:66231437-66231459 CCTTCCTCCTTCTTTTCATCCTA 0: 1
1: 1
2: 9
3: 207
4: 2087
Right 1150553384 17:66231471-66231493 AAGTCACAAGGAAGGCCTCAAGG 0: 1
1: 0
2: 1
3: 19
4: 205
1150553378_1150553383 3 Left 1150553378 17:66231437-66231459 CCTTCCTCCTTCTTTTCATCCTA 0: 1
1: 1
2: 9
3: 207
4: 2087
Right 1150553383 17:66231463-66231485 CAGTCTAAAAGTCACAAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 161
1150553378_1150553382 -1 Left 1150553378 17:66231437-66231459 CCTTCCTCCTTCTTTTCATCCTA 0: 1
1: 1
2: 9
3: 207
4: 2087
Right 1150553382 17:66231459-66231481 AACTCAGTCTAAAAGTCACAAGG 0: 1
1: 0
2: 4
3: 49
4: 359
1150553378_1150553386 13 Left 1150553378 17:66231437-66231459 CCTTCCTCCTTCTTTTCATCCTA 0: 1
1: 1
2: 9
3: 207
4: 2087
Right 1150553386 17:66231473-66231495 GTCACAAGGAAGGCCTCAAGGGG 0: 1
1: 0
2: 2
3: 9
4: 172
1150553378_1150553385 12 Left 1150553378 17:66231437-66231459 CCTTCCTCCTTCTTTTCATCCTA 0: 1
1: 1
2: 9
3: 207
4: 2087
Right 1150553385 17:66231472-66231494 AGTCACAAGGAAGGCCTCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150553378 Original CRISPR TAGGATGAAAAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr