ID: 1150561119

View in Genome Browser
Species Human (GRCh38)
Location 17:66295737-66295759
Sequence TCCTGAAGTCCCCTTATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150561119_1150561122 -4 Left 1150561119 17:66295737-66295759 CCAGCCATAAGGGGACTTCAGGA No data
Right 1150561122 17:66295756-66295778 AGGAAGCCTGCTGAGAATGTGGG No data
1150561119_1150561125 19 Left 1150561119 17:66295737-66295759 CCAGCCATAAGGGGACTTCAGGA No data
Right 1150561125 17:66295779-66295801 AGATGAGAGTGAATGTTAGGAGG No data
1150561119_1150561124 16 Left 1150561119 17:66295737-66295759 CCAGCCATAAGGGGACTTCAGGA No data
Right 1150561124 17:66295776-66295798 GGGAGATGAGAGTGAATGTTAGG No data
1150561119_1150561121 -5 Left 1150561119 17:66295737-66295759 CCAGCCATAAGGGGACTTCAGGA No data
Right 1150561121 17:66295755-66295777 CAGGAAGCCTGCTGAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150561119 Original CRISPR TCCTGAAGTCCCCTTATGGC TGG (reversed) Intergenic
No off target data available for this crispr