ID: 1150562853

View in Genome Browser
Species Human (GRCh38)
Location 17:66309809-66309831
Sequence CAGAGAAAGGAGAAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1366
Summary {0: 1, 1: 0, 2: 10, 3: 138, 4: 1217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150562846_1150562853 -2 Left 1150562846 17:66309788-66309810 CCCACTTTTTTTTTCCCCCGTCA 0: 1
1: 0
2: 3
3: 40
4: 377
Right 1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG 0: 1
1: 0
2: 10
3: 138
4: 1217
1150562845_1150562853 3 Left 1150562845 17:66309783-66309805 CCTTGCCCACTTTTTTTTTCCCC 0: 1
1: 0
2: 7
3: 104
4: 885
Right 1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG 0: 1
1: 0
2: 10
3: 138
4: 1217
1150562847_1150562853 -3 Left 1150562847 17:66309789-66309811 CCACTTTTTTTTTCCCCCGTCAG 0: 1
1: 0
2: 6
3: 36
4: 334
Right 1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG 0: 1
1: 0
2: 10
3: 138
4: 1217
1150562844_1150562853 27 Left 1150562844 17:66309759-66309781 CCATAAAACTAGCAGAGATCTAG 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG 0: 1
1: 0
2: 10
3: 138
4: 1217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150562853 Original CRISPR CAGAGAAAGGAGAAGAAGAC AGG Intronic
900519287 1:3097940-3097962 CAGGGACAGGACAAGAAGAGGGG - Intronic
901663079 1:10811012-10811034 CACAGAAAGGAGGAGAAATCTGG + Intergenic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
902367086 1:15983052-15983074 CAGAGAAAGCAGAATCAGCCTGG - Intergenic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902572629 1:17356470-17356492 CACAGACAGGAGAACAAGGCAGG - Intronic
903156420 1:21446603-21446625 GAGAGAAAGGAAAAGAAGAAAGG - Intronic
903165136 1:21514946-21514968 CAGGGAAGGGAGGAGAGGACAGG + Intronic
903932085 1:26868312-26868334 AAGAGAAAAGAAAAGAAGAAAGG - Intergenic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904389402 1:30171916-30171938 AAGGGAAAGGGGAAGAAGGCTGG + Intergenic
904484069 1:30813476-30813498 CAGAGAAAGGAAAACAAGGTGGG - Intergenic
904797833 1:33070672-33070694 AGGAGAAAGAAGAAGAAGAGAGG + Intronic
904919717 1:33997526-33997548 CTGAGAGAGGGGAGGAAGACAGG - Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905403811 1:37720258-37720280 CAGGGAAAGGAGTAGAAGTGGGG + Intronic
905741045 1:40372201-40372223 CAGAGTGAGGAGATGAAGATGGG + Intronic
905790259 1:40785704-40785726 CAGAGACAGGTGGAAAAGACAGG - Intronic
905850974 1:41274685-41274707 CAAAGACAGGAGAGAAAGACAGG + Intergenic
906247099 1:44283993-44284015 CAGAGAAAGGAGAACACACCGGG - Intronic
906289799 1:44612236-44612258 AAGAGAAAGGGGGAGAAGAAAGG - Intronic
907526568 1:55057284-55057306 CAGAGAAAGGAGCCCAAGAGAGG - Intronic
907774505 1:57500207-57500229 CAGAGAAATGAGAAAAAAAGAGG + Intronic
907819530 1:57953622-57953644 CAGAGCAAGGTGGAGAAGAATGG - Intronic
907885505 1:58589087-58589109 TAGAGACCGGAGAAGAAGAGAGG + Intergenic
908018071 1:59867450-59867472 TAGAGGAAAAAGAAGAAGACTGG - Intronic
908600355 1:65732163-65732185 CAGAGAAAGGAGGAGCAAAAGGG - Intergenic
908933805 1:69348878-69348900 CAGTGAAAGGAGAGGAAAAATGG + Intergenic
908957907 1:69657669-69657691 CAGAGAAAGCATAGGAAGAAAGG + Intronic
908991260 1:70093083-70093105 AAGAGAAAGCAGTAGAACACTGG + Intronic
909091911 1:71236586-71236608 AAGAGAAAGGAAAGGGAGACAGG - Intergenic
909178975 1:72396409-72396431 CAGAGAAGGGAGAAAAAGCAGGG + Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909919767 1:81366860-81366882 AAGAGACAGGAGAAGAGGAGAGG - Intronic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910437716 1:87221970-87221992 AAGAGGGAGTAGAAGAAGACAGG + Intergenic
910806187 1:91191658-91191680 CTGGGAAAGGAGAAGATGAGGGG - Intergenic
911010816 1:93279164-93279186 CAGAGAAAGGAAAAGAGGCGAGG + Intergenic
911196549 1:95000837-95000859 CAGAAAGAGAAGAAGAAGAGAGG + Intronic
911281901 1:95940230-95940252 CAGAGAAGGGAGCAGAAAAAGGG - Intergenic
911322002 1:96425881-96425903 CAGGGAAAGAAGGAAAAGACTGG - Intergenic
911663252 1:100527184-100527206 AAAAGAAAAGAGAAGAAGAAGGG - Intergenic
911690437 1:100827086-100827108 GAGAGAAAGAACAAGAAGACGGG - Intergenic
912014379 1:105014360-105014382 CAGAGAAGGTAGAAAAAGAAGGG - Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912245440 1:107957298-107957320 CAGAGAAAGGAGGTGAATAGAGG - Intronic
912692547 1:111815277-111815299 GAGAGAAAGGAAAAGAAGAGAGG - Intronic
912758724 1:112346947-112346969 CAGAGAAAAGGGAAAAAGACTGG + Intergenic
912976559 1:114336253-114336275 CAGAGAGAGGGGAACAAGACTGG + Intergenic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913153133 1:116065611-116065633 GAGAGAACCGAGCAGAAGACAGG - Intronic
914427423 1:147590453-147590475 GAGAGAAGAGAGAAGAAGCCAGG - Intronic
914489397 1:148141959-148141981 GAGAGAAAGAAAAAGAAGAAAGG + Intronic
914508791 1:148312252-148312274 TAGACAAAGGAGAGCAAGACTGG + Intergenic
914806754 1:150997455-150997477 GAGAGTAGGGAGAGGAAGACAGG + Intronic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916030756 1:160875763-160875785 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916030762 1:160875787-160875809 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916270838 1:162939774-162939796 AAGAGAGAGAAGAAAAAGACTGG + Intergenic
916412436 1:164559380-164559402 GGGAGAAAGGAGAGGAAGGCAGG - Intronic
916620380 1:166490237-166490259 CAGAAAAAGGAAAAGACGAGGGG - Intergenic
916864000 1:168836850-168836872 CTGAGAAAGGAGAATCAGGCAGG - Intergenic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917628231 1:176867302-176867324 AAGGGAAGGGAGAAGAAGAGGGG + Intronic
917653975 1:177107470-177107492 CAGAGCAAGGAGAAAAAAAGTGG - Intronic
917685795 1:177414501-177414523 CAGAGAAAGGAGCAGAGGAAGGG + Intergenic
917743104 1:177980850-177980872 GAGAGAAAGGAGAGCAAGAGAGG + Intronic
917770661 1:178274156-178274178 CTAAGAAAGCAGAAGAAGGCAGG - Intronic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
918073664 1:181152700-181152722 CAGAGAAGGGAGGAGAGCACTGG + Intergenic
918212885 1:182367236-182367258 CAGTCAAAGGAGGAGAAGCCAGG + Intergenic
918480465 1:184972592-184972614 GAGAGAAAGCTGAACAAGACTGG + Intronic
918641473 1:186845913-186845935 CAGGGAAAGGAAAAAAAGAAAGG + Intronic
918744761 1:188185165-188185187 GATAGAAAGGAGAAGTAGAGTGG + Intergenic
919038135 1:192343168-192343190 TAGAGAAAGGAGAAAAAATCAGG - Intronic
919263212 1:195225597-195225619 CTGAGAAAGGAAAGGAAGAAGGG - Intergenic
919523529 1:198619339-198619361 GAGAGAAATGTGAAGAAGGCTGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919984331 1:202662276-202662298 CAGAGATAGGGGAAAAACACTGG - Intronic
920383792 1:205552627-205552649 AAGGGAAACGAGAAGAAGAAAGG + Intergenic
920461831 1:206146407-206146429 CAGGGAAAAGAGAACTAGACAGG - Intergenic
920549322 1:206845446-206845468 AAGAGAAAGGAAAAGTAGACGGG - Intergenic
920868101 1:209769852-209769874 CAGAGAAAAGATAGGAAAACCGG + Intronic
921015044 1:211181910-211181932 CAGTAAAAGTAGAAGAAAACCGG + Intergenic
921326347 1:213989010-213989032 AAGAGAAAGGACAAGGGGACCGG - Intronic
921633750 1:217466785-217466807 AAGAGAAAGGAGAAAAAGAAAGG + Intronic
922029166 1:221781420-221781442 CTGGGAAAGGAGGAGAAGCCGGG + Intergenic
922133951 1:222806603-222806625 CAAAGAAAGGAAAGGAAGAAAGG - Intergenic
922144325 1:222923813-222923835 GAGAGAAAGGAAAAAAAGAAGGG + Intronic
922149949 1:222992051-222992073 GAGAGAAAAGAGAAGTTGACTGG + Exonic
922182910 1:223249866-223249888 CAGTGAAAAGAGAGGAAGAAAGG + Intronic
922570317 1:226630879-226630901 AGGAGAAAGGAGAAGAAGGAAGG + Intergenic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923203662 1:231737561-231737583 CAGTGAAAGGAGAATAGGAGAGG + Intronic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
923400029 1:233607939-233607961 GAGAGGAAGGAAAAGAAGAAAGG - Intergenic
923694536 1:236234557-236234579 GAGACAAAGGATAAGAAGCCAGG + Intronic
923872534 1:238011467-238011489 CACAGAAAGCAGAAGAAATCTGG - Intergenic
924131859 1:240917673-240917695 CAGAGAAGGCAGAAAGAGACAGG + Intronic
924149179 1:241110524-241110546 CAGAGAATGCAGAAGATGCCTGG + Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924224279 1:241908060-241908082 CAGAGAAACCTGAAGAACACTGG + Intergenic
924659100 1:246000341-246000363 AGGAGAAAGGAAAAGGAGACAGG + Intronic
924715261 1:246566835-246566857 CTGAGAAAGGAGAGGAAAACAGG - Intronic
1062972292 10:1657804-1657826 GAGAGACAGGAGAGAAAGACCGG - Intronic
1063020266 10:2119898-2119920 CACAGTAAGGAGAAGACAACAGG - Intergenic
1063138135 10:3234846-3234868 AAGGGAAAGGAGAACAGGACCGG + Intergenic
1063184436 10:3638005-3638027 CAGAGAAAGAATAAGAAATCTGG - Intergenic
1063486586 10:6425993-6426015 CAGAGTGAGGAGAGGACGACTGG + Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1064181076 10:13116262-13116284 CACAGGAAGGAGAAGCAGAAGGG + Exonic
1064570689 10:16689809-16689831 AAAAGAAAGGTGAAAAAGACAGG + Intronic
1064596843 10:16953898-16953920 GAGAGGAAGGGGAAGAAGAGGGG + Intronic
1064620933 10:17216737-17216759 CAGAGAAAAGAGGAGCAGATTGG + Intergenic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065265128 10:23966688-23966710 CAGAGAAAGAGGAAGAAGACTGG + Intronic
1065299501 10:24308513-24308535 CACTGAATGGAGAAGAAGGCAGG + Intronic
1065334711 10:24644744-24644766 CAGAGAAAGAAGAATCAGAAAGG - Intronic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065547698 10:26838408-26838430 AAGAGGAAGGAGCAGAGGACAGG + Intronic
1065677227 10:28189726-28189748 CAGAGAAGGAAGGAAAAGACAGG + Intronic
1065696162 10:28382114-28382136 GAGAGAAAGGAGGAGAAAAAAGG - Intergenic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066129221 10:32374439-32374461 TAGAGAAAAGAGATGAAGAGAGG - Intronic
1066396693 10:35031548-35031570 CAGAGAATGAAGTGGAAGACAGG - Exonic
1067097589 10:43312729-43312751 CAGAGAAAGAAGGAGAACAGGGG - Intergenic
1067126077 10:43516669-43516691 CAGAAAAATGTGAAAAAGACTGG - Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067171353 10:43909342-43909364 AAGAGAAAAGAAAAGAAGCCAGG + Intergenic
1067215793 10:44301619-44301641 GAGAGAAAGGAGCAGAAAGCTGG + Intergenic
1067541939 10:47161128-47161150 CTGAGAAAGAAGAAGAGGAGGGG - Intergenic
1068247504 10:54391711-54391733 CAAAGAAAGGAGAATATGAAGGG - Intronic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068580374 10:58732278-58732300 GAGAGAAAGAAGGAGAAGAGAGG + Intronic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1069214932 10:65807697-65807719 CTGAGAAAGGACAACAAAACTGG - Intergenic
1069273598 10:66561983-66562005 CAGAGAAGAGAGAAGATAACAGG + Intronic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069844303 10:71360120-71360142 AAAAAAAAGAAGAAGAAGACAGG - Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069950067 10:72012501-72012523 CTAAGACAGGAGCAGAAGACTGG + Exonic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070463672 10:76696027-76696049 CAGAGAAGGCAGAAAAAGAGTGG - Intergenic
1070673808 10:78398146-78398168 TAGAGAAAGGAGATGGAGACAGG + Intergenic
1071094037 10:81952487-81952509 AGGAGAAAGTAGAAGAAAACAGG + Intronic
1071136736 10:82462321-82462343 CAGAGACAGAAGAAGAAAATGGG - Intronic
1071167024 10:82818420-82818442 CTGTGGAAGGAAAAGAAGACAGG + Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1071802349 10:89077523-89077545 AAAAGAAAGGAAAGGAAGACAGG - Intergenic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1072197483 10:93128796-93128818 GAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1072431396 10:95374706-95374728 GAGAGAAAGGAGAAGAAATGAGG + Intronic
1072758533 10:98037158-98037180 CAGAGACAGGGGAAAAAGAAGGG - Intergenic
1072896044 10:99367804-99367826 CAGATAAGAGAGATGAAGACAGG + Intronic
1073048363 10:100653221-100653243 CAGAGAAAGAAGATAAAGACAGG - Intergenic
1073072265 10:100802191-100802213 CAGAGAATGGGGAAGAATACTGG + Intronic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073337224 10:102718846-102718868 GAGAGAAAGGAGGTGGAGACAGG - Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074222687 10:111453789-111453811 CAGTAAAAGGGGATGAAGACTGG - Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074747376 10:116548442-116548464 TAGACAAGGGAGAAGAAAACTGG + Exonic
1074932948 10:118147676-118147698 GATAGAAAGGAGAACAAGGCAGG - Intergenic
1074945404 10:118276334-118276356 CAGATAAATGATGAGAAGACAGG - Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075474622 10:122723537-122723559 CAAAGAAAGCAGAATAAGGCAGG - Intergenic
1075579573 10:123606872-123606894 AAGAGAGAGGAGAAGAAGAGGGG - Intergenic
1075680808 10:124329952-124329974 CAGGGGATGGAGAAGAAGAATGG - Intergenic
1076197889 10:128533170-128533192 GAAAGAAAGGACAAGAAGAAAGG + Intergenic
1076564167 10:131386823-131386845 CAGAGAAAGGAGAGGAGCAGAGG + Intergenic
1077080200 11:721652-721674 CGGAAAAAGGGGAAGAAGAAGGG + Exonic
1077344991 11:2043204-2043226 TAGAGAAAGGAGAATAAGATTGG - Intergenic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1077729815 11:4718412-4718434 CAAACAAAGGAGCAGAAAACAGG - Intronic
1077736930 11:4801157-4801179 CAGAGAACTCAGAAGAAGACAGG - Intronic
1077759443 11:5076281-5076303 GTGAGAAACGAGAAGAAGGCTGG + Intergenic
1077792026 11:5451315-5451337 AAGAGAAGGGAGAAGAAAACAGG - Intronic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1077866216 11:6223742-6223764 GCGAGAAAAGAGAAGAAGACGGG + Exonic
1078420092 11:11204192-11204214 CAGGGAAATGAGATGAAAACTGG - Intergenic
1078524963 11:12093292-12093314 CAGACATTGGAGCAGAAGACAGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078657518 11:13255575-13255597 CAGAGAGTGGACAAGAAGCCAGG + Intergenic
1078669823 11:13354732-13354754 CAAAGAAAGAAGACGAAGAAAGG - Intronic
1078929842 11:15904608-15904630 CAGAGGAAGGTAAGGAAGACAGG + Intergenic
1078943700 11:16038460-16038482 GAGAGAGAGGAAAAGAAGACTGG + Intronic
1079091160 11:17481223-17481245 CACACAAAGGAGAAGACCACTGG - Intergenic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079325683 11:19489298-19489320 GAGAGAGAGGGGAAGAAGAAGGG + Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079645198 11:22854632-22854654 TAGAGAATGCAGAAGAAGAATGG + Intronic
1080089610 11:28330358-28330380 TAAAGATAGGAAAAGAAGACCGG - Intronic
1080440186 11:32286968-32286990 CAGAGAAATGTGAATATGACTGG + Intergenic
1080950129 11:37022267-37022289 GAAAGAAAGGGGAAGAAGACAGG + Intergenic
1080951266 11:37035903-37035925 AATAGAAAGGAGAAGTAGAAAGG - Intergenic
1081279031 11:41185403-41185425 CAAAGAAAGGAGAGAAAGAATGG + Intronic
1081282575 11:41227853-41227875 CAGAAAAAGGAAGGGAAGACAGG - Intronic
1081307087 11:41526154-41526176 CAAAGAAGGGAGAAACAGACTGG - Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1081748295 11:45488371-45488393 CAGAGAAAGAGCTAGAAGACAGG + Intergenic
1081909549 11:46692177-46692199 CAGTGGAAGGAAAAGCAGACTGG + Intronic
1082080942 11:48012177-48012199 AAAAGAAATGAGAAGAAAACTGG - Intronic
1082190787 11:49241423-49241445 GAGAGAAGGGAAAAGAAGAGAGG - Intergenic
1082679213 11:56148078-56148100 CAGACAAAGCAAAAGCAGACAGG - Intergenic
1082893881 11:58169697-58169719 AACAAAAAGGAGAAGAAGAAGGG - Intronic
1083046863 11:59744396-59744418 TAGATAATGGAGAAAAAGACAGG + Intronic
1083139780 11:60712400-60712422 GAGAGGAAGGAGAAGAAAAGGGG + Intronic
1083209259 11:61172643-61172665 CAAAGAAGGGAGCAGAAGAGAGG - Intergenic
1083261794 11:61527100-61527122 CAGAGATAAGAGATAAAGACCGG + Intronic
1083288946 11:61679563-61679585 CACAGAGAGGAGCAGAAGGCGGG - Intergenic
1083801095 11:65046755-65046777 CACAGAAAGGAGAAGAACCTGGG + Intronic
1083813835 11:65120772-65120794 GAGAAGAAGAAGAAGAAGACAGG - Exonic
1083888363 11:65583725-65583747 CAGAGAAGGCTGAAGAGGACAGG + Exonic
1084581076 11:70023834-70023856 AAGAGGATGGGGAAGAAGACTGG + Intergenic
1084590722 11:70088521-70088543 AAAAAAAAGAAGAAGAAGACAGG + Intronic
1084890958 11:72237039-72237061 CAGTGGAAGGAGAACTAGACGGG - Intronic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085249635 11:75134413-75134435 AAGAGAAAGGATACAAAGACAGG - Intronic
1085318016 11:75557713-75557735 AAGGGAGAGGAGAACAAGACGGG + Intergenic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085895854 11:80638692-80638714 AAGGCAAAGGAGAAGAAGAAGGG + Intergenic
1086073820 11:82828855-82828877 CAGAGATTGGAGAAGATGGCAGG - Intronic
1086239320 11:84670201-84670223 CAGTGAGTGGTGAAGAAGACAGG - Intronic
1086307172 11:85493837-85493859 GAGAGAAAAGAAAAGAAGAAAGG + Intronic
1086379251 11:86235093-86235115 AGGAGAAAGGAAAAGAAGAAGGG + Intergenic
1086384726 11:86295487-86295509 GAGAAAAAGAAGATGAAGACAGG + Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1086798194 11:91135867-91135889 AACAGAAAGGAAAACAAGACTGG - Intergenic
1087020716 11:93600163-93600185 CAGGGAAAGAAGAAGATGACTGG + Intergenic
1087112904 11:94490513-94490535 CAGATAACGTAGAAGAAAACTGG - Intronic
1087534062 11:99421372-99421394 CAGAGAACTGGGAAGAAGAATGG + Intronic
1088021133 11:105120982-105121004 CAGTCAAAGGATAAGATGACAGG - Intergenic
1088063829 11:105690906-105690928 CAGAGGAAGAAGAAAAAGATTGG - Intronic
1088156609 11:106812486-106812508 AAGAGAAAGAAAAAGAAAACAGG - Intronic
1088174033 11:107030767-107030789 CAGAGGAAAGAGAGAAAGACAGG + Intergenic
1088210877 11:107454244-107454266 CAGAGAAAGGCTAAGAGGATAGG - Intronic
1088358303 11:108966079-108966101 CAGAGAGAGGAGGTGAAGAACGG + Intergenic
1088415717 11:109586797-109586819 GGGAGAAAGGAAAAGAAGAAAGG + Intergenic
1088680009 11:112231887-112231909 CAGAGACAGGAGAAGAGGAGGGG + Intronic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089078312 11:115756633-115756655 CAGAGAAAGGATAAGCATTCGGG - Intergenic
1089113665 11:116076935-116076957 CACAGAATGGTGGAGAAGACAGG + Intergenic
1089319962 11:117619039-117619061 GAGAGAAAGGCAAAGAAGCCAGG - Intronic
1089559513 11:119336737-119336759 CAGAAAAACCAGAAGCAGACAGG - Exonic
1089690554 11:120184443-120184465 GAGCGAAAGGAGAAACAGACAGG - Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090121991 11:124039628-124039650 AAGACAAAGGAACAGAAGACCGG - Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090495712 11:127210097-127210119 CATAGAAAGGGGAAAAAGAAGGG - Intergenic
1090502983 11:127279783-127279805 AAGAAAAAGAAGAAGAAGAAGGG - Intergenic
1090566306 11:127995632-127995654 CAGAGAACAGAGAAGATGAGTGG - Intergenic
1090623553 11:128584878-128584900 GAGAGAGAGAAGAAGAAGAAAGG + Intronic
1090885442 11:130872238-130872260 CAGAGACAGGTGAGGATGACAGG + Intergenic
1091073513 11:132591970-132591992 CAGTGAGAGGAGATGAACACTGG + Intronic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1091680455 12:2523109-2523131 CGGAGAAAGGAGGAAAAGAGCGG + Intronic
1091723397 12:2829190-2829212 TAGAGGAAGGATGAGAAGACTGG + Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091854095 12:3724950-3724972 GAGAGAATGGAGAAGAAGAATGG + Intronic
1092909984 12:13138193-13138215 AAGAGGACTGAGAAGAAGACAGG - Intronic
1092982521 12:13810879-13810901 TATTGGAAGGAGAAGAAGACAGG - Intronic
1093161052 12:15746995-15747017 CAGAAAAAGGCAAAGAAGAAAGG - Intronic
1093191393 12:16078961-16078983 GAAAGAAAAGAGAAGAAGCCAGG - Intergenic
1093717110 12:22395441-22395463 CACAGGAAGAAGAAGAATACAGG - Intronic
1093841254 12:23904234-23904256 TAGAGAAAAGAGAAGAAAAATGG - Intronic
1094059698 12:26300635-26300657 CAGAGAAAGCTGAAGATGACAGG - Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1095326335 12:40898018-40898040 TAGAGAAAGGAGAATAATAAAGG - Intronic
1095515322 12:42999354-42999376 CAAAGAAAGGAGAAAAAGAAAGG - Intergenic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1095863915 12:46950695-46950717 TAGAGAAAGGATCAGAAGCCAGG - Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096262207 12:50099921-50099943 CAGACAAGGGACAGGAAGACAGG - Exonic
1096705036 12:53415405-53415427 CAGGGAAAGGAAAAGAAGGGGGG + Intronic
1096882366 12:54683441-54683463 CAGAGAAAGGAGACTAAGTCTGG - Intergenic
1096973489 12:55685182-55685204 CAGTTCAAGGAGGAGAAGACGGG - Exonic
1097202741 12:57293368-57293390 CAGAGAAAGGAAGAGAAGTAAGG + Intronic
1097296243 12:57965960-57965982 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097657634 12:62387871-62387893 CAGAGAAAGCAGAAGAGCATGGG + Intronic
1098150906 12:67545352-67545374 AAGAGACAGGAGATGGAGACAGG - Intergenic
1098175378 12:67784808-67784830 AAGAGAAGGGAGAAGAAGTAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098330619 12:69348600-69348622 GAGAGAAGGAAGAAGAAGAAGGG + Intronic
1098332018 12:69362840-69362862 GAAAGAAAAGAGAAGAAGATGGG + Exonic
1098366827 12:69712219-69712241 CAGAGCAGGGTGGAGAAGACTGG + Intergenic
1098731598 12:74042148-74042170 GAGAGAAAGGAGTAGAGGAGGGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1099132569 12:78854102-78854124 CAGAGAAAGAAATAGAAGATAGG + Intergenic
1099161911 12:79252201-79252223 CAGAGAAATGAGAATAAAAATGG + Intronic
1099184453 12:79502727-79502749 CAGAGAGAGGAGGAGATGCCAGG + Intergenic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099451172 12:82808680-82808702 CAGTGGCAGGAGAAGAATACTGG - Intronic
1099544806 12:83965201-83965223 CAAAGAAAGGGGAAGCAAACAGG + Intergenic
1100010587 12:89948006-89948028 CAGAGAAAGGATTAGCAAACAGG + Intergenic
1100745021 12:97636132-97636154 GAGAGAAAAGAGAAAAAGAAAGG - Intergenic
1101026990 12:100618710-100618732 CAGAGAATGGAGAATAGTACCGG - Intronic
1101037657 12:100721181-100721203 CAGGGACAGGAGAGGAAGATGGG - Intronic
1101122434 12:101597135-101597157 CACAGTTAGGAGAAGAAGAAAGG - Intronic
1101263684 12:103061894-103061916 GAGAGAAAGGAGTATAAAACAGG - Intergenic
1101579581 12:106030865-106030887 CAAAGAAGGGAGAAGAAAAAAGG + Intergenic
1101663000 12:106783531-106783553 AAGAGAATGGAAAAGTAGACTGG - Intronic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1101980859 12:109405879-109405901 CAGAGACAGGAGATCAGGACAGG - Intronic
1102039808 12:109793668-109793690 CAGAGAAAGGGATAGAAGAGAGG + Intronic
1102102240 12:110288880-110288902 AAGAGAAAGGGGAGGAAAACTGG - Intronic
1102513217 12:113429372-113429394 CATCGAAAGGAAAAGGAGACAGG - Intronic
1103006409 12:117423853-117423875 CAGAGAAAGGGGAAGAACAAAGG + Intronic
1103034692 12:117647054-117647076 GAGAAAAAAGAGAGGAAGACAGG + Intronic
1103066271 12:117900455-117900477 AAGGGAAAGGAGAATAAAACAGG + Intronic
1103143904 12:118577362-118577384 CAGAGAAAGGATTAGAACTCAGG + Intergenic
1103229906 12:119320693-119320715 CAGAGCAAGGTGAAGAAAAGTGG - Intergenic
1103352014 12:120290608-120290630 AAAAGAAAGAAGAAGAAGCCGGG - Intergenic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104169301 12:126264697-126264719 CAGAGAAATGAGATGAGGACTGG - Intergenic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104377796 12:128280187-128280209 CGGAGAGAAGAGATGAAGACAGG - Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105806625 13:23955265-23955287 CAGAGTAGGAAGAAAAAGACAGG + Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1106375707 13:29185327-29185349 CAAGGAAAGGAGAAAAAGAAAGG + Intronic
1106865780 13:33962155-33962177 TAGAGAAAGGAGAGGAAGTTTGG - Intronic
1106915283 13:34507208-34507230 CAGAGAAAGAAGAAGAAAAATGG - Intergenic
1106927113 13:34624366-34624388 CACTAAAAGGAGAAGAAGACGGG + Intergenic
1107309203 13:39058844-39058866 TAGAGAAAGGAAAGGAAGAAAGG - Intergenic
1107768054 13:43758467-43758489 CAGAGGAGGGACAAGAAGAGAGG + Intronic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107847181 13:44527586-44527608 CAGAGAAGGCAGAAAAAGAGTGG + Intronic
1107897124 13:44976329-44976351 AGGAGGAAGGAGAAGAAGAAAGG + Intronic
1108218618 13:48210596-48210618 TATAGAAAGGAAAAGAAAACGGG + Intergenic
1108376277 13:49817078-49817100 AAAAGAAAAGAAAAGAAGACAGG - Intergenic
1108425966 13:50300609-50300631 GAAGGAAAGGAGAAGAAGACTGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108950230 13:56083464-56083486 CAGAGGAAGAAGAGAAAGACAGG + Intergenic
1109131474 13:58591828-58591850 AAGACAAAAGAGAAGAAAACTGG + Intergenic
1109556870 13:63987536-63987558 AAGAGAAAGGAGAAGAAAAGTGG - Intergenic
1109730199 13:66403041-66403063 CTGAGAAAGAAGAAAAAGACAGG + Intronic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1110378412 13:74820925-74820947 CTGAGAGAGGAGCAGAAGAGTGG + Intergenic
1110388871 13:74948280-74948302 CTGAGAAAAGAGAACAAAACTGG + Intergenic
1110694364 13:78470956-78470978 CAGAGAGAGGAAAAGAAGATGGG + Intergenic
1110901459 13:80830772-80830794 CAGAGAAAGGAGAGTAAAAAGGG + Intergenic
1110904451 13:80867913-80867935 AAGAGAAAGGAGGAGAGGAAGGG + Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111344770 13:86936672-86936694 CAGGGAAGGGTGAAGAAGAATGG + Intergenic
1111384094 13:87500860-87500882 CAGAGAAAAGACGTGAAGACGGG + Intergenic
1111390277 13:87585202-87585224 AAGGCAAAGTAGAAGAAGACAGG - Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111603032 13:90498509-90498531 GAGAGAAAAGAGAGAAAGACAGG - Intergenic
1111782767 13:92750471-92750493 CAGAAAAAGGAGAAAATGAGAGG + Intronic
1112235353 13:97630962-97630984 CAGAGGAATGAGAAGAAAAGTGG + Intergenic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1112639059 13:101252258-101252280 CAGAGAACAGAGAGGAAGAAGGG - Intronic
1113179661 13:107611001-107611023 GAGAGAAAGAAGTAGAGGACAGG + Intronic
1113196091 13:107808263-107808285 CCGAGAAAGGTTAAGAAGAGAGG - Intronic
1113348906 13:109508769-109508791 TAAAGAAAGGAAAAGAAGCCGGG - Intergenic
1113393476 13:109920439-109920461 CAGAGAAAGTGGAAGAACTCAGG - Intergenic
1113498229 13:110750790-110750812 CAGAGAATGGAGAAATAGAAAGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114862319 14:26539614-26539636 GAGAGAAATGGGAAGAAAACAGG + Intronic
1114979171 14:28140703-28140725 AAGAGAAAGAAAAAGAAGAAAGG - Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115346936 14:32353213-32353235 CAGAGAAAGGAGGTAAAGAAGGG - Intronic
1115691768 14:35851531-35851553 GAGAGGAAGGGCAAGAAGACAGG + Intronic
1115842216 14:37484738-37484760 CAGAGAAAGAATAAGAGAACTGG - Intronic
1116110999 14:40581302-40581324 CAGTGAAAAGAGAAGATGATAGG - Intergenic
1116686668 14:48048469-48048491 GAGATAAAGGAGAAAATGACAGG + Intergenic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117006845 14:51429063-51429085 AAGAGAAAAGAGAAGAGAACAGG + Intergenic
1117151082 14:52888977-52888999 GACAGAAGGGAGAAGGAGACGGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117809308 14:59529913-59529935 TAGATAAAAGAGAGGAAGACAGG - Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1117999553 14:61510412-61510434 AAGAGAAAGGAAAAGAGGAGGGG + Intronic
1118136087 14:63029655-63029677 GAGAAAAATGAGAAGAAGAGAGG + Intronic
1118508725 14:66445901-66445923 CAGGTAAATGAGAAGAGGACGGG - Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118704934 14:68471794-68471816 CAGACAAAGGAGATGCAAACAGG - Intronic
1119180162 14:72600092-72600114 GAAAGAAAGGAGGAGAAGAAGGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119535968 14:75402476-75402498 TGAAGACAGGAGAAGAAGACAGG + Intergenic
1119866252 14:77977700-77977722 AAGACAAAGTATAAGAAGACTGG + Intergenic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120162996 14:81165289-81165311 CAGATACAGGACAAGAAGAGTGG - Intergenic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120332971 14:83117092-83117114 CAGATAAAGGAGGAGAAAAATGG - Intergenic
1120333646 14:83125709-83125731 CAGAGAAAGAAGAGGAGGAAGGG - Intergenic
1120527148 14:85590348-85590370 AACAGAAGGGACAAGAAGACAGG - Intronic
1120642322 14:87029992-87030014 TACAGAAAGGAGACTAAGACAGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121129936 14:91436891-91436913 CAGAGAAAGGAGAAAAGGCTGGG - Intergenic
1121139248 14:91526405-91526427 CAGAGAAAGGAAAACTAAACAGG - Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121416943 14:93786345-93786367 CAGAGAAGAGAGCAGAAGATGGG + Intronic
1121524942 14:94613234-94613256 TAGAGAGAGGAGAAGAAAAGGGG - Intronic
1121592408 14:95125816-95125838 GAGAGAGAGGAAAAAAAGACAGG + Intronic
1121833659 14:97073108-97073130 AAAAGAAAGAAGAAGAAGAAAGG - Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122055868 14:99097979-99098001 CAGTGAATGGGGAAGAAGGCTGG - Intergenic
1122158984 14:99769157-99769179 CTGAGAAAGGAGGACCAGACAGG - Intronic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122551178 14:102550860-102550882 CAAAAAAAGAAGAAGAAGAAAGG + Intergenic
1122807002 14:104264842-104264864 CAGGGATAGGAGCAGATGACAGG - Intergenic
1123082191 14:105700639-105700661 CAGAGATGGGAGAAAAAGAGAGG - Intergenic
1123434632 15:20246307-20246329 CAGAGATGGTAGGAGAAGACTGG + Intergenic
1123825767 15:24080815-24080837 AAGAGGAAGAAGAAGAAGAAAGG - Intergenic
1124100837 15:26691145-26691167 CAGAGCAGGGAGAGCAAGACTGG - Intronic
1124631568 15:31340480-31340502 CAGAGAAAGGATGACAAGAAAGG - Intronic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1124920957 15:34025798-34025820 CGGAGGAAGGAGAAAAAGACAGG + Intronic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125073006 15:35578253-35578275 CAGATAAACCTGAAGAAGACTGG - Intergenic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1125395027 15:39237343-39237365 CATAGAAAGGATAATCAGACAGG + Intergenic
1125522569 15:40356300-40356322 CTGAGGAAGTAGAAGAAAACAGG + Exonic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125579612 15:40776017-40776039 CAGAGAACTGGGAGGAAGACGGG + Intronic
1125857386 15:42963386-42963408 CAAAGATAGGGTAAGAAGACTGG + Intronic
1126113049 15:45186911-45186933 CCCAGAAAGGAGGTGAAGACGGG - Intronic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127867600 15:63044345-63044367 AAAGGAAAGGAGAAGAAGAGAGG - Intronic
1127923301 15:63512263-63512285 AAGAGGAAGAAGAAGAAGAGGGG - Intronic
1128247218 15:66141394-66141416 GTGAGAAAAGAGAAGACGACTGG + Intronic
1128994498 15:72286795-72286817 CAGAGAAAGGACTAGAAGTAAGG - Intronic
1129766200 15:78170181-78170203 AGGAGAAGGGAGAGGAAGACAGG - Exonic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130392592 15:83472296-83472318 AAGAGAAGGGAAAAGAAGGCAGG - Intronic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1130805728 15:87319821-87319843 CAGAGAAAGCAACAAAAGACCGG - Intergenic
1131550412 15:93352232-93352254 CAAAGAAAAGAGGAGAAGGCTGG - Intergenic
1131557654 15:93413722-93413744 CAGAGAAAGGAGAAGCTGCTGGG - Intergenic
1131626119 15:94122593-94122615 CAGAGAAGTAAGAAGAAAACAGG + Intergenic
1131660325 15:94507295-94507317 CAAACAAAGGAGAAAAAGAAAGG + Intergenic
1131706338 15:95000135-95000157 CACAGAAAGGAAAAGACGCCAGG + Intergenic
1131819583 15:96258647-96258669 TACATAAAGGAGAAGAAGAAAGG + Intergenic
1132068905 15:98758280-98758302 CCAAGAAAGGAGAACTAGACGGG - Intronic
1132703601 16:1231876-1231898 CAGAGAATGGAGGAGAAGCAGGG - Intergenic
1132704908 16:1239485-1239507 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1132707917 16:1254519-1254541 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133217875 16:4304390-4304412 CAGGGAAAGGAAAACAAGGCAGG + Intergenic
1133368268 16:5228380-5228402 AAGAGAGAGGAGGAGAAGAGAGG + Intergenic
1133717929 16:8467066-8467088 GGGAGGAAGGAGAAGAAGAAAGG + Intergenic
1133758663 16:8781121-8781143 GAGAGAAAGGAAATGAAGACTGG + Intronic
1134128444 16:11632317-11632339 CTGAGAAAGGTGAGGACGACTGG + Intronic
1134567579 16:15264659-15264681 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1134734909 16:16492011-16492033 GAGAGAAGGAAGAAGGAGACAGG + Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1134932613 16:18220208-18220230 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1135159639 16:20082453-20082475 GAGAGAAGGGAGAATAAGAAAGG + Intergenic
1135179382 16:20259723-20259745 AAGAGAGAGGAGAGGAAGTCAGG + Intergenic
1135218507 16:20593019-20593041 AAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1135259545 16:20969066-20969088 CAGAGAAAGAAAAAGCAGATGGG - Intronic
1135592838 16:23717030-23717052 GAGAGGAAGGAGAACAAGAAGGG + Intergenic
1135683273 16:24477171-24477193 CAGGGAAACTAGAAGAAGCCTGG - Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136033295 16:27519153-27519175 CTGATAAGGCAGAAGAAGACAGG + Intronic
1136469895 16:30473099-30473121 CAGAGAAGGGAGCATAAGAAGGG + Intronic
1136912020 16:34151554-34151576 AAGAGAAAAGAAAAGAAGAAAGG + Intergenic
1137374701 16:47942644-47942666 AAGAAAAAGAAGAAGAAGAAAGG - Intergenic
1137404073 16:48176370-48176392 AAGTGACAGGAGAGGAAGACAGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137853044 16:51765449-51765471 AAGAGAAAGGAAAAAAAGAAAGG - Intergenic
1138000649 16:53275605-53275627 TAGAGAATGGAGAAGAAAACTGG - Intronic
1138191006 16:55014186-55014208 CAGAGGAAGGAGTAGAAGATTGG + Intergenic
1138222071 16:55260404-55260426 CAGAGAAAAGGAAAGAAGAATGG - Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138594131 16:58020561-58020583 AAGAGAGAGGAGAGGAAGAGAGG - Exonic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1138945660 16:61846514-61846536 TGGACAAAGGAAAAGAAGACAGG - Intronic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139852857 16:69961399-69961421 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139881828 16:70184307-70184329 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139944187 16:70627472-70627494 AAGAGAAAGAAAAAGAAGAGGGG - Intronic
1140178301 16:72687699-72687721 GAGAGAAAGGAGAAAGAGAATGG - Intergenic
1140370682 16:74411199-74411221 CAGGGAGAAGAGAAGCAGACGGG - Intronic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140542198 16:75766903-75766925 CTGGGAAAGGAGTAGAAGAGAGG - Intergenic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141445968 16:84058531-84058553 CTGAGAAAGGGGATGAAGCCAGG - Intronic
1141941187 16:87277214-87277236 AAAAGAAAGGAGCAGAAGGCCGG + Intronic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142717605 17:1755503-1755525 CATAGAGAGAAGAAGAAGCCAGG - Intergenic
1142899193 17:3001954-3001976 AAAAAAAAGGAGAAGAAGAGTGG - Intronic
1142951207 17:3481977-3481999 GAGAGGAAGGAGAAAAAGAGAGG + Intronic
1143224527 17:5289159-5289181 AAGAGGAAGAAGAAGAAGAAAGG - Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143887876 17:10078976-10078998 CAGAGAAAGAAGAGAAAGAAAGG + Intronic
1144278080 17:13695942-13695964 TAGAGAAGGCAGAAGAAGAGTGG - Intergenic
1144431130 17:15192567-15192589 AAGAGAAATGAGAAGAAGGTGGG - Intergenic
1144602689 17:16632192-16632214 CTGAGAAAGGTGGAGAAGATGGG - Intronic
1144875308 17:18394305-18394327 AAGAGAATGGGGGAGAAGACGGG + Intergenic
1145156916 17:20550116-20550138 AAGAGAATGGGGGAGAAGACGGG - Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145282893 17:21480659-21480681 GAGAGAGAGGTGAAGAAGATGGG - Intergenic
1145725921 17:27124188-27124210 CAAAGAAAGGAGAAGATGAAGGG - Intergenic
1146587639 17:34096264-34096286 CCTGGAAAGGAGGAGAAGACTGG + Intronic
1146958901 17:36955452-36955474 GAGAGAAAGGAGGCAAAGACAGG - Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147500095 17:40954830-40954852 GAGAGTGAGGAGCAGAAGACGGG + Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1147853515 17:43460518-43460540 GAGAAAAAGGAGTGGAAGACAGG - Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1147991434 17:44336085-44336107 CAGAGATAGCAGGAGCAGACAGG - Intergenic
1147997192 17:44366792-44366814 GAGAGAAATGAAAAGAAGAAGGG - Intergenic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148440907 17:47711202-47711224 CAGGGAAAGGAGGACAGGACTGG - Exonic
1148488096 17:48004152-48004174 CGGAGAAGGAGGAAGAAGACGGG - Intergenic
1148503026 17:48106451-48106473 CAGAGAAAGGGGAAGCACATAGG + Intronic
1148596377 17:48859200-48859222 CAGAGAATGAGTAAGAAGACAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148693884 17:49547873-49547895 CAGAGAAAACAGAAAAGGACAGG + Intergenic
1148807764 17:50272852-50272874 CAGAGAGAGGAGAAACAGACGGG + Intronic
1148835795 17:50465156-50465178 CAGAGAGAGGAGGGGACGACTGG - Intronic
1148882983 17:50745827-50745849 AAGAGAAAGGAAAAGACGAAGGG + Exonic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151082426 17:71344123-71344145 GAAAGAAAGGAAAAGAAAACAGG + Intergenic
1151287852 17:73126288-73126310 GAGAGAAAGGCAAAGAAGAGTGG - Intergenic
1151390608 17:73784477-73784499 CAGAGAAAGGAACTGGAGACAGG - Intergenic
1151686346 17:75649108-75649130 CAGAGAAACAAGAAGATGCCAGG + Intronic
1153089546 18:1328400-1328422 CAGATAAAGCCGCAGAAGACTGG + Intergenic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153158655 18:2178309-2178331 CAGAGAGAGGAGAGAAACACAGG + Intergenic
1153532439 18:6061696-6061718 CAGAGAAGGGAGAAAAAGAGAGG - Intronic
1153580829 18:6571664-6571686 CAGAGAGAGTGGAAGAAGAAAGG - Intronic
1153676963 18:7464405-7464427 CAGAGCAATAAGCAGAAGACAGG + Intergenic
1153706218 18:7748401-7748423 CAGAGGAAGGGGAGGAAGAAGGG - Intronic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153861736 18:9217664-9217686 CAGAGAAAAGAGTAGACCACTGG - Intronic
1154123497 18:11670266-11670288 GAGAGTAAGAAGAAAAAGACGGG - Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155563378 18:27105071-27105093 CAAAGAAAGAAAAAGAAGAAAGG - Intronic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1155847208 18:30723082-30723104 CTGAGGAGGGAAAAGAAGACTGG - Intergenic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156192747 18:34738568-34738590 AAGAGAAAGGAGTAGAAGGAGGG - Intronic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1157410590 18:47459727-47459749 CAGAGAAGGGGGAAGTAAACTGG + Intergenic
1157535253 18:48452941-48452963 CAAAGAAAGGGGAAGAAGAGAGG + Intergenic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157687009 18:49650807-49650829 CAGTGAAAGGAGAAGACCTCAGG - Intergenic
1157728378 18:49982982-49983004 CAGAGAAAGGAGAAGATCTCTGG - Intronic
1158273138 18:55738163-55738185 AAGAGAAAGGAGTAGAAGACTGG - Intergenic
1158409084 18:57188509-57188531 CAGAGAAAGGAGAGCGAGAGAGG + Intergenic
1158412514 18:57220774-57220796 GAGAGAAAGGAGAAAAAGCAAGG - Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1159237752 18:65698993-65699015 CACAAAAATGAGAACAAGACAGG - Intergenic
1159770908 18:72544161-72544183 AAAAAAAAGAAGAAGAAGACTGG + Exonic
1159783820 18:72691217-72691239 CGGAGAATGCAGAAGAATACCGG - Intergenic
1159981734 18:74789550-74789572 CAGACAGAGGAAAAGACGACTGG - Intronic
1160095032 18:75863512-75863534 CAGAGAAAGGAGTGGAAGGAAGG + Intergenic
1160361657 18:78287856-78287878 CAGAGAAAGCAGAAAATGAGGGG - Intergenic
1160744110 19:702562-702584 CAGAGAAGAGGGTAGAAGACAGG + Intergenic
1161025162 19:2033460-2033482 GGGGGAAAGGAGGAGAAGACAGG + Intronic
1161117636 19:2507569-2507591 GAGAGAAAGAAAAAGAAGAGAGG - Intergenic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161563985 19:4989287-4989309 CAGAAAAAAGAAAGGAAGACTGG - Intronic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161890047 19:7028673-7028695 GAGAGAAAAGAAAGGAAGACAGG + Intergenic
1161891405 19:7042073-7042095 GAGAGAAAAGAAAGGAAGACAGG - Intergenic
1161893490 19:7060530-7060552 GAGAGAAAAGAAAGGAAGACAGG - Intergenic
1162076466 19:8191154-8191176 CAAACAAAGAAGAAGAAGAAAGG - Intronic
1162217136 19:9145526-9145548 CAGCCAGAGGAGAAAAAGACAGG - Intronic
1162870874 19:13585699-13585721 CAGAGAATGGAAAAGAAAATAGG + Intronic
1163113536 19:15176004-15176026 CAGAGAGAGGGGCAGAAGAGGGG + Intronic
1163538565 19:17892974-17892996 AAGAGAAAGGAAAAGAAAAGAGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164148982 19:22532577-22532599 CAGAGAAAGGAGGCGAGGCCAGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1165332940 19:35151406-35151428 GAGAGACAGAACAAGAAGACAGG - Intronic
1165613043 19:37173419-37173441 CAGAGGAGGGAGGAGAAGTCCGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166184655 19:41132087-41132109 AAGAGAAGAGAGAAGAAGAAAGG + Intergenic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1166601719 19:44101563-44101585 CAGAGCAAGAAGGAGAGGACAGG - Intronic
1166622305 19:44312541-44312563 CAGGGAATGGAGAAGAGTACTGG - Intergenic
1167030162 19:46953626-46953648 CAGAGAAAGGAATAGCAGAATGG - Intronic
1167213912 19:48151272-48151294 CAGAGAAGGAAGGAGAAGACGGG - Exonic
1167488962 19:49780995-49781017 CAGGGACAGGAGAAGCAGAGAGG + Intronic
1168056715 19:53868574-53868596 CTGGGAAAGGAGGAGAAGACAGG + Intronic
925189838 2:1874132-1874154 GAGGGAAAGGAGAAGAATATTGG - Intronic
925617058 2:5753811-5753833 CAGAGAAAGGGAGACAAGACTGG + Intergenic
925655191 2:6139335-6139357 CACAGGAAGTAGAAGAAGAATGG - Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
926292037 2:11538986-11539008 GGGAGAAAGGAGGAGAAGAGAGG - Intronic
926537083 2:14126090-14126112 AAGAGAGAGGAGAGGAAGAATGG + Intergenic
926825074 2:16898225-16898247 CAGAAACAGGAGAAAAGGACAGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927412101 2:22838422-22838444 CAGAGAGAGAAAAAGAAGAGAGG + Intergenic
927826297 2:26312197-26312219 GAGAAAAGGGAGAGGAAGACAGG + Intronic
928044245 2:27911462-27911484 CAGAGAAAGGACAATAAGGTAGG + Intronic
928151822 2:28837821-28837843 CAGGGAGAGGAGAAGCTGACTGG + Intronic
928732458 2:34247367-34247389 CAGACAAAAGTGAAGAACACAGG - Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929408097 2:41666095-41666117 AAGAGGAAGGATATGAAGACAGG + Intergenic
929886383 2:45882699-45882721 AAGAGAAAGACGGAGAAGACAGG + Intronic
930538644 2:52676511-52676533 GAGAGAGAGAAGAAGAAGAGAGG - Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930875004 2:56205319-56205341 CAAAGAAAGGAGAAAATGTCTGG - Intronic
931173667 2:59831207-59831229 AAGAGAAAAGTAAAGAAGACTGG - Intergenic
931175546 2:59850845-59850867 AAGGGAAATGAGAAGAAGAGAGG + Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931524100 2:63133645-63133667 AAGGCAAAGGAGAAGCAGACAGG - Intronic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
932213997 2:69954589-69954611 CAGAGACAGGAGGAGAAGACGGG - Intergenic
932275366 2:70448050-70448072 CTGAGAAAGGAGAAAAAGATGGG - Exonic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932952186 2:76306556-76306578 CAGAGAAGGAAGAAAAAGAGTGG - Intergenic
933022671 2:77214261-77214283 CAGAGTTAGGATAAGAACACAGG - Intronic
933376298 2:81483596-81483618 GAGAGAAAGGAGAGAAAGAGGGG - Intergenic
933882652 2:86686128-86686150 CAGAGAAGGCAGAAAAAGAGTGG - Intronic
934056942 2:88259015-88259037 AAGAAAAAAAAGAAGAAGACTGG + Intergenic
934724525 2:96607087-96607109 CAGAGAAGGGAGAAAAAGAGAGG + Intronic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935114302 2:100121258-100121280 CAGAGAGAGGAGAAGCAGCTGGG + Intronic
935210402 2:100934996-100935018 GAGAGAAGAGGGAAGAAGACGGG - Intronic
935225933 2:101053201-101053223 CAGAGAAAGGAAAGAAAGCCAGG + Intronic
935231179 2:101098056-101098078 CAGAGAAGGCAGAAAAAGAAAGG + Intronic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
935388005 2:102521571-102521593 CTGAGTAAGGAAAGGAAGACGGG - Intronic
935408712 2:102736725-102736747 CGGAAACAGGAGCAGAAGACAGG - Exonic
935732810 2:106078633-106078655 GAGAGGGAGGATAAGAAGACGGG + Intergenic
935787971 2:106566419-106566441 GAGTGAAAGGTGAAGAAGAGAGG + Intergenic
935839660 2:107095371-107095393 GAAAGAAAAGAGAAGCAGACAGG - Intergenic
936392680 2:112089582-112089604 CAGAGAAAGAAGAAAAAGCATGG - Intronic
936398580 2:112149100-112149122 TAGAGAAAGCAGAAGATGCCAGG - Intronic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
936922238 2:117700825-117700847 GAGAGAAATGAGAAGAGGAGAGG + Intergenic
937610015 2:123849983-123850005 CAGATAAAGGAAAAGAGGAAAGG + Intergenic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938190394 2:129274288-129274310 CAGGAAAAGGAGCAGAGGACAGG - Intergenic
938457208 2:131474391-131474413 AAAAAAAAGAAGAAGAAGACTGG - Intronic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
938784561 2:134614024-134614046 CAGAGAAAGAAGAAAAAGGTAGG + Intronic
939038250 2:137158406-137158428 CAGAGAAAGGAAGAGAGAACAGG - Intronic
939215701 2:139235747-139235769 AACAGAAAGGAGAGTAAGACAGG - Intergenic
939493809 2:142905251-142905273 GAGAGCAAGGAGAAAAAGATGGG + Intronic
939708263 2:145481760-145481782 GAGAGGAAGGAGAGAAAGACAGG - Intergenic
939790162 2:146562375-146562397 GAGAGAGAAGAGAAGAAGAAAGG + Intergenic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
940682778 2:156807205-156807227 CAGTGTAGGGAGAAGATGACTGG - Intergenic
940879792 2:158935310-158935332 CTGAGAAAGGAGGAGAAGATGGG - Intergenic
941258951 2:163272262-163272284 CAGAGACAGGAGAAAAAGTGTGG - Intergenic
941281919 2:163562546-163562568 TAGAGAAAGGAGAGGAACATTGG + Intergenic
941588671 2:167390968-167390990 TAGATAAGGGAGAATAAGACAGG + Intergenic
941616097 2:167721600-167721622 TAGAGAAAGGAGGAGAAAACTGG + Intergenic
941920829 2:170849254-170849276 CAGAGAAAGGAGAGGAAGAGGGG - Intronic
942134999 2:172916381-172916403 CAGAGAGAGCAGAGGAGGACTGG - Intronic
942295893 2:174516883-174516905 AAGAGAAAGGTAAAGAAGGCAGG - Intergenic
942899377 2:181095759-181095781 CAGAGAAAGGGGAAGCTGTCAGG - Intergenic
943003929 2:182365617-182365639 AGGAGTAAGGAGAAGAACACAGG - Intronic
943111661 2:183613936-183613958 CAGGGAAAGATGAAGAACACTGG + Intergenic
943148324 2:184075005-184075027 GAGAGAAAGGAAGAGAAGAGAGG - Intergenic
943187422 2:184629813-184629835 CAGAGAAAGAAGACTATGACAGG + Intronic
943236010 2:185320663-185320685 CATAGATAGAAGAAGAAGATAGG + Intergenic
943538096 2:189178052-189178074 AATAGAAAGTAGAAGAAAACAGG - Intronic
943730332 2:191296172-191296194 CAGAGAAAGTGGAAGAATACAGG + Exonic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944498902 2:200337762-200337784 TAGAGAAAGAAAAAGAAGAGAGG - Intronic
944641017 2:201725704-201725726 CAGAGATAGGTGAAGGACACAGG - Intronic
944894920 2:204154213-204154235 AAGACAAAGGAGAATAAAACTGG - Intergenic
945461448 2:210113981-210114003 CAGAAAAAGAAGAGAAAGACAGG + Intronic
945867395 2:215191535-215191557 CAAAGAGAGGAGAAGAAGCAGGG + Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946291657 2:218749983-218750005 CAGAAAAAGGATAAAAAGAGTGG - Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946538230 2:220655418-220655440 CAGAGAAAAGAGAATAATTCTGG + Intergenic
946595704 2:221303530-221303552 CAGAGACAAGAGAAGAACCCAGG - Intergenic
946854724 2:223941410-223941432 CAGAGGAAGGAGGAAAGGACAGG - Intronic
947360046 2:229337479-229337501 CAGAGAAAGAAGATGAATATGGG - Intergenic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948274276 2:236696164-236696186 GAGGGGAATGAGAAGAAGACAGG - Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948569757 2:238910357-238910379 CGGAGAAAGGAAAAGAATAGCGG - Exonic
1169144993 20:3246603-3246625 AAGAAAAAAGAGAAAAAGACAGG - Intergenic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169386894 20:5157432-5157454 CAGAGAAAGGAGGAGTTGATTGG + Intronic
1169482122 20:5992991-5993013 TAGAGAAAGCAGAAGAAATCTGG + Intronic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169655242 20:7915353-7915375 AAGGGGAAGGAGAAGAAGAAGGG + Intronic
1169717869 20:8640941-8640963 CAGAGGAATGTCAAGAAGACTGG + Intronic
1169813112 20:9629024-9629046 GCCAGAAAGGAGAAGAAGCCTGG - Intronic
1169830040 20:9815060-9815082 AAGAGAAAGGAGGAGATGCCAGG + Intronic
1169899903 20:10542324-10542346 CAGAGAAACCATAAGGAGACAGG - Intronic
1170346126 20:15388861-15388883 AAGAGAAAGCAGAGGAAAACTGG + Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170532645 20:17309892-17309914 AAGAGGAAGAAGAAGAAGAAAGG + Intronic
1170588812 20:17755541-17755563 GAGAGATAGGGGAAGAAGATGGG + Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170751355 20:19149364-19149386 CAGAGAAGGCAGAAAAAGAGTGG + Intergenic
1171907336 20:30909900-30909922 AAGAGAAAAGAAAAGAAGAAAGG + Intergenic
1172145368 20:32754038-32754060 CAGACTCAGGTGAAGAAGACAGG - Intergenic
1172691249 20:36791811-36791833 TAAAGAGAGGAGAGGAAGACAGG + Intronic
1172811257 20:37649939-37649961 CTCAGAAAGGAAAAGAAGAAGGG + Intergenic
1172824937 20:37773877-37773899 AAGAAAAAGAAGAAAAAGACAGG - Intronic
1173441173 20:43077608-43077630 CAGAGAGAGTAGAAAAAGCCAGG + Intronic
1173755446 20:45511672-45511694 GAGAGAGAGGAGAAAAACACAGG - Intergenic
1173777539 20:45723315-45723337 GCAAGAAAGGAGAAGATGACGGG + Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174015055 20:47481118-47481140 GAAAGAAAGGAAAAGAAGAAAGG - Intergenic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174507238 20:51024287-51024309 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174507241 20:51024319-51024341 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174516209 20:51094304-51094326 CAGGGAAAGGAAAAGAAAACAGG + Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175084309 20:56445873-56445895 GAGAGAAAGGAGGAGAAAAGAGG - Intronic
1175656533 20:60775939-60775961 GGGAGAAAGGAGTAGAAGCCAGG - Intergenic
1175891457 20:62317856-62317878 CAGGGAAGGGAGAAGAAAAGAGG + Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176658889 21:9614799-9614821 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176721653 21:10398596-10398618 AAAAGAAAAGAAAAGAAGACAGG - Intergenic
1177007069 21:15686692-15686714 AAAAGAAAGGGGAAGAAGAGAGG - Intergenic
1177067850 21:16463334-16463356 TAGAGAGATGAGAAGAAGACAGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177316957 21:19474816-19474838 AAGAGAAAGGAAAAGAAAAATGG + Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1177718463 21:24872126-24872148 ACTAGAAAGGAGAAGAAGAAAGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177953360 21:27566650-27566672 AAGAGAAAGGGGGAGAAGAATGG + Intergenic
1178007971 21:28244554-28244576 CAGAGAAAAGAGAATCAGATTGG + Intergenic
1178228793 21:30756228-30756250 TAGTGAAAGGAGAAGAAAAATGG - Intergenic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178262614 21:31113994-31114016 CAGAGAAAGGAGGACAGGAGTGG + Intergenic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1178819099 21:35959188-35959210 CAGAGGAACCAGAAGAAAACAGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1180302841 22:11051374-11051396 AAAAGAAAAGAAAAGAAGACAGG - Intergenic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181645322 22:24228102-24228124 CAGGGAAAGGCCATGAAGACAGG + Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181900533 22:26151847-26151869 AAAAGAAAGGAAAAGAAAACAGG - Intergenic
1181923515 22:26339316-26339338 CAGAGAGAGGGAAAGAAGAAAGG + Intronic
1182511746 22:30824929-30824951 CAGAGTCAGGACAAGAAGCCAGG - Intronic
1182839955 22:33381319-33381341 TATAGAAAGAGGAAGAAGACAGG - Intronic
1182936306 22:34225332-34225354 CAGTGAGAGGAGAAGAAAATAGG + Intergenic
1182960142 22:34464295-34464317 CAAAGAAAGAAGAACAAGGCAGG - Intergenic
1183031697 22:35111241-35111263 CAGAGACAGGAAGAGAAGGCTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1183608779 22:38883454-38883476 AAGAGAAAAGAAAAGAAAACTGG - Intergenic
1184111532 22:42398314-42398336 CAGTGACAGCAGAGGAAGACTGG - Intronic
1184877589 22:47285293-47285315 AACAGAAATGGGAAGAAGACAGG - Intergenic
1184893683 22:47394611-47394633 CAGACAGAGGAGGAGAAGACAGG + Intergenic
1185195728 22:49468141-49468163 CAGAGAGAGGAGAGGAACCCTGG + Intronic
1185220213 22:49625687-49625709 CAGAGAAGGCAGAAAAAGAATGG + Intronic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949538899 3:5017028-5017050 CAGAAAAATGAGAATAACACTGG - Intergenic
949876772 3:8631361-8631383 CAGAGCAAGAGGAAGAAGATGGG - Intronic
950329050 3:12141628-12141650 CAGAGAAAGGAGCAAAACTCAGG - Intronic
950823140 3:15784576-15784598 CACAGAAGGCAGAAGAAGAATGG + Intronic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
951484225 3:23194020-23194042 CACAGAAAAGGGAAGAAGCCAGG - Intergenic
952117041 3:30195266-30195288 CAGAGGTATGAAAAGAAGACAGG + Intergenic
952234553 3:31465258-31465280 CAGAGAAAAGAAAAGAACAAAGG + Intergenic
952255940 3:31695764-31695786 TTGAGAAGGGAGGAGAAGACAGG - Intronic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
952341658 3:32452310-32452332 CACAGAGATGAGAAGCAGACAGG + Intronic
952514632 3:34091446-34091468 GAGAGAAAGGAAAATAAGAAAGG - Intergenic
953226989 3:41030150-41030172 GAGAGAAAGGCAAACAAGACTGG + Intergenic
953557090 3:43954671-43954693 CAGAGAAGGCAGAAAAAGAGGGG + Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
955041829 3:55324731-55324753 CACAGAAAGGATAAGCAGCCTGG - Intergenic
955370835 3:58350402-58350424 CAGAGTAAGGACAAGAACCCGGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955475336 3:59330384-59330406 AGGAGAAAGGAGAAGGAGAAAGG + Intergenic
955535991 3:59924255-59924277 CAAAAAGAGGAGAAGAAGAAAGG - Intronic
955897376 3:63714966-63714988 CTGACAAATGAGGAGAAGACTGG + Intergenic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
956504054 3:69918796-69918818 CAGAGAAAAGAAAATAAGAGAGG - Intronic
956715924 3:72079963-72079985 GAGAGAAAGGGGAAGAAAAAGGG - Intergenic
956745937 3:72311081-72311103 GATAGAAAGGACAAGAGGACAGG - Intergenic
956849759 3:73217968-73217990 CAGAGAAGGGGGAAGAGGAAAGG - Intergenic
957115220 3:76015072-76015094 CAGGAAAAGGAGCCGAAGACTGG - Intronic
958069447 3:88591348-88591370 CAGAGAAATAGGAAGAAAACAGG + Intergenic
958925340 3:100151045-100151067 TAGAGAAAGGAGAGCAAGAAGGG - Intronic
959174158 3:102884264-102884286 AAGAAAAAGGAAAAGAAGAAAGG - Intergenic
959269356 3:104186752-104186774 CATAGAAAGGAGGTGAAGAATGG - Intergenic
959275109 3:104268908-104268930 CAAAGAAAGGCGAAGAACAATGG - Intergenic
959560798 3:107778462-107778484 CCAAGAAAAAAGAAGAAGACTGG + Exonic
959578508 3:107960789-107960811 CAGAGAGAGGAAAGGAAGACTGG - Intergenic
959653347 3:108773022-108773044 CAGAGAAAGGGGGAGAGGAAAGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
961207775 3:125100195-125100217 CAGGGACAGGAGAAAAAGAAAGG + Intronic
961585189 3:127916163-127916185 CAAAGAAAAGAAAAGAAAACTGG + Intronic
961671446 3:128534579-128534601 CAGTTAAAGAAGCAGAAGACAGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961976082 3:131026773-131026795 CGGAGAAAGCAGAGGAGGACCGG - Exonic
962030153 3:131591163-131591185 CATAGAAAGAGGAAGAAGAGTGG + Intronic
962501501 3:135998340-135998362 CAGACAAAGGACATGAAGAAAGG + Intronic
962827818 3:139112808-139112830 CAGAGAGAAGAGTAGAAGGCAGG + Intronic
963608161 3:147431319-147431341 CAGAAAAAGCAAAACAAGACTGG + Intronic
963765502 3:149331279-149331301 AGGAGAAAGGAGAAGAATATAGG - Intronic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963882139 3:150540046-150540068 CAGAGCAAGGATTAGAAAACTGG - Intergenic
963931346 3:151007156-151007178 CAGAGAAACGGGAAGAAATCAGG - Intergenic
964106613 3:153047024-153047046 AAAAGAAAAGAAAAGAAGACAGG - Intergenic
965552969 3:169988336-169988358 AACAGCAAGGAGAAGAATACTGG - Exonic
965774565 3:172215250-172215272 CAGAGAAGTGAGCAAAAGACAGG - Intronic
965876505 3:173328982-173329004 CTGAGAAAGAAGAACAAAACTGG - Intergenic
965878052 3:173352501-173352523 CAGAGAAAAGAGAGGAAAAAAGG - Intergenic
966367031 3:179200741-179200763 AAGAGAAAGATGAAGAAAACGGG - Intronic
966521891 3:180882266-180882288 AAGAGGAGGAAGAAGAAGACAGG - Intronic
966763771 3:183440355-183440377 CAGAGAAGGCAGAAAAAGAGTGG - Intergenic
966844811 3:184120330-184120352 CAAAAAAAGAAGAAGAAGAAAGG + Intergenic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967205815 3:187120100-187120122 TAGAGAAGAGTGAAGAAGACAGG + Intergenic
967254145 3:187572602-187572624 CAGTGAAGGGTAAAGAAGACAGG + Intergenic
967278327 3:187798260-187798282 CAGAGTCAAGAGAGGAAGACAGG + Intergenic
967424146 3:189307017-189307039 AACAAAAAGAAGAAGAAGACTGG - Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967501419 3:190202503-190202525 AAAAGAAAGGAGAAGAAAAAGGG + Intergenic
967628694 3:191716892-191716914 CTGAGAAAGGAGAGAAACACAGG - Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967826195 3:193879499-193879521 CAGAGGAATGAGGAGAAGAGGGG + Intergenic
967833206 3:193940118-193940140 GAGAGAAAGGAGAGGTTGACAGG - Intergenic
967926976 3:194658055-194658077 CAGAGACGGGAGAAAAGGACAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
969520792 4:7676752-7676774 GAGAGGAAGGAGGAGATGACAGG - Intronic
969520806 4:7676847-7676869 GAGAGGAAGGAGGAGATGACAGG - Intronic
969604980 4:8197871-8197893 TAGAGAAAGGTGAACAGGACGGG + Intronic
970063792 4:12068027-12068049 GAGAAAAAGGAGGAGAAGAACGG + Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970517935 4:16851950-16851972 CAGAGTAGGCAGAAGAACACTGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
971261742 4:25063482-25063504 CAGGGAATGGAGCAGAAGAATGG + Intergenic
971399331 4:26261497-26261519 CGGATAAAGGGGAAGAAGAGAGG + Intronic
972330043 4:38056135-38056157 CAGAGACCAGAGAAGAAGCCAGG - Intronic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
972790273 4:42365006-42365028 AAAAGAAAGGAGAAGAGGAGAGG - Intergenic
973120460 4:46515502-46515524 AAGAGGAAGGAAAAGCAGACTGG - Intergenic
973927520 4:55754419-55754441 CTGAGACAAGAGGAGAAGACAGG - Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974359980 4:60865053-60865075 CAGGGAAAGGACAAGAAGAAGGG - Intergenic
974414000 4:61580937-61580959 AAGAGAAAAGGGAAGAATACTGG + Intronic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974858626 4:67492084-67492106 GAGAGAAAGGGAAAGTAGACAGG + Intronic
974903445 4:68030296-68030318 AAGAGAAAGGAAAAGTAGAGTGG - Intergenic
975302857 4:72811687-72811709 GAGAAAAGGGAGAAAAAGACTGG + Intergenic
975362335 4:73485634-73485656 AAGAGGAAGAAGAAGAAGAAGGG + Intronic
975381886 4:73710125-73710147 CTGAGAAAGGAGATGTAGAAAGG + Intergenic
975397694 4:73896072-73896094 CAGAAAGAAGAGAAGAAAACAGG + Intergenic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976507382 4:85863999-85864021 CATAGAGAAGAGGAGAAGACTGG + Intronic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
976803417 4:89019017-89019039 CAGAGAAGTGAGAAGAGGCCAGG + Intronic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977254598 4:94726866-94726888 AAGAGAAAAGAAAAGAAGAAAGG - Intergenic
977346005 4:95817006-95817028 CATAAAAAAGAGAAGAAAACTGG - Intergenic
977376626 4:96213131-96213153 AAGAGAAGGGAGGAGAAGAGAGG - Intergenic
977739922 4:100467039-100467061 CAAAGAAAGGAGAAAAATAATGG + Intronic
978157786 4:105509372-105509394 AAGGAAAAGGAGAGGAAGACAGG + Intergenic
978161479 4:105553241-105553263 TAGAGAAGGGAGAAGAAAAGAGG - Intronic
978373239 4:108050318-108050340 CAGTGAAGGGACAAGAAGACTGG + Intronic
978373341 4:108050939-108050961 CAGTGAAGGGACAAGAAGACTGG - Intronic
978569933 4:110125959-110125981 GAGAGAAGGGAGAAAAAGATTGG + Intronic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
978708043 4:111740509-111740531 CAGAAAAAGAAGAATATGACTGG - Intergenic
979403913 4:120285413-120285435 CAGAGAAACGATAAGAACAAAGG + Intergenic
979466664 4:121047460-121047482 CAGAGAAAGGATACAAATACAGG + Intronic
979641870 4:123017752-123017774 CAGTGTAAGGACAAGAAGTCAGG - Intronic
979813633 4:125071012-125071034 CAGAGACAGAAGGTGAAGACTGG + Intergenic
979859620 4:125677046-125677068 GAGAGAAAAGAGACGAAGTCTGG - Intergenic
980093544 4:128466633-128466655 CAGTGGAAGAAGAAGAAGATAGG + Intergenic
980354106 4:131722694-131722716 CGGAGAGATCAGAAGAAGACAGG - Intergenic
980554807 4:134389298-134389320 AACACAAAGGAGAAGCAGACTGG + Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980707889 4:136523408-136523430 GAGAGAAAGGAAAAAAAGAAAGG + Intergenic
980995783 4:139778471-139778493 CAGTGGAAGGAGAAAAAGATGGG + Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
982115810 4:152097532-152097554 GAAAGAAAGGAAAAGAAGAAAGG + Intergenic
982234484 4:153239688-153239710 AAGAGAAAGGAGAACAAGAAAGG - Intronic
982659074 4:158185275-158185297 GAAAGAAAGGAGAAGAAAATGGG + Intergenic
983202547 4:164877094-164877116 AGGAGAAAGGAGAAGAGGAGTGG + Exonic
983463785 4:168060354-168060376 CACACAAAGAAAAAGAAGACTGG - Intergenic
983739764 4:171114892-171114914 CAGGGAAGGGAGAAGCAGAGTGG - Intergenic
983871486 4:172829202-172829224 CACAGACAGGAGAGGAAGAGAGG + Intronic
984018309 4:174452685-174452707 CTGATAAAAGAGAAGAAAACAGG + Intergenic
984102856 4:175507230-175507252 AAGAGAAAGTAGAATAAGAGTGG - Intergenic
984413000 4:179419433-179419455 CAGAGTCAGGAGCAGAAGAAAGG + Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985291995 4:188395548-188395570 AAAAGAAAGGAGAATAATACAGG - Intergenic
985416436 4:189740629-189740651 CAGAGAAAGGTTAAGGACACAGG + Intergenic
985427942 4:189848204-189848226 CAGAGAAAGGTATGGAAGACAGG + Intergenic
985889825 5:2706522-2706544 CAAAGAAGGGAGGGGAAGACAGG + Intergenic
985916726 5:2925797-2925819 CAGAGGAAGAAGAAGAGGAAAGG - Intergenic
986004288 5:3655014-3655036 CAGAGACAGGAGCAGAAGCAGGG - Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986278653 5:6304519-6304541 GAGAGAAAGAAGAAGAGGAGGGG + Intergenic
986603633 5:9499363-9499385 CAGAGAATGGATAAGAACAAGGG + Intronic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
987288066 5:16479564-16479586 GAGGTAAAGGAGAAGAGGACTGG - Intronic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
987969628 5:24925467-24925489 AAAAGAAAGGAGAAAAAGAGAGG - Intergenic
988252678 5:28780617-28780639 CAGAGAAATGAAAATAAAACAGG + Intergenic
988276361 5:29085902-29085924 CAGAGAACGTTGAAGAAGATAGG - Intergenic
988426620 5:31072690-31072712 CAGAAATAGGAGAAGAAGAAGGG - Intergenic
988514751 5:31894865-31894887 AAGGGAAAGGAGAGCAAGACTGG - Intronic
988628385 5:32901481-32901503 CAGAGAGCTCAGAAGAAGACAGG - Intergenic
988948308 5:36230186-36230208 AGGAGAAAGGAGCAGAAGTCAGG - Intronic
988996874 5:36723395-36723417 CAGGGAAAGAAGAATAATACAGG + Intergenic
989214428 5:38889828-38889850 CCAAGAAAGTAGAAGAAAACAGG - Intronic
989368159 5:40679455-40679477 CCGAGAAAGGAGAAGAAATACGG - Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989736731 5:44716523-44716545 GAGAGAAAGGAAAGGAAGAAAGG + Intergenic
989826940 5:45868227-45868249 CAGAGTAAGGTGAAAAAGATTGG + Intergenic
990066728 5:51725619-51725641 CATAGAAAGGAAAAGGACACTGG + Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990219770 5:53575080-53575102 GAGAGAAAAGAGAAGAAAATGGG + Intronic
990379507 5:55208062-55208084 AAGAGGAAGAAGAAGAAGAAAGG + Intergenic
990384497 5:55246393-55246415 CAGAGGAAGGAGAAGCCAACAGG + Intergenic
990716354 5:58641569-58641591 CTGAGTAAGGAGTAGAAGAGAGG - Intronic
990842591 5:60100428-60100450 GAGATAAAAGAGAAGAAGAAAGG + Intronic
990878842 5:60517911-60517933 GAGAGAAGAGAGAAGAAGAGAGG + Intronic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991124320 5:63052516-63052538 GAGAGAGATGAGAAGCAGACAGG + Intergenic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992427261 5:76670661-76670683 AAGAGAAAGGGGAGGAAGAGAGG + Intronic
992497888 5:77310832-77310854 CCTACAGAGGAGAAGAAGACTGG + Intronic
993456555 5:88133657-88133679 GAGAGAAAAGAGAAGAGGAGAGG + Intergenic
993466573 5:88254408-88254430 AAAAGAAAGGAGAGGAAGAAGGG + Intronic
993579486 5:89641608-89641630 CAGACAAAGGAGAGAAAGAAAGG + Intergenic
993850143 5:92998425-92998447 CAGAGAAACAAGAAGAAGATGGG - Intergenic
993900818 5:93583438-93583460 GAGAGAAAGGAGAAGAAGAAGGG - Exonic
994111412 5:96008784-96008806 CAGAGAGAGCAGAAGAATCCTGG + Intergenic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994134958 5:96275551-96275573 CAGGGAAAGGAGGTGGAGACAGG - Intergenic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994350610 5:98742233-98742255 GAGAGCAAGGAAAAGAAGAGTGG + Intergenic
994390512 5:99187033-99187055 AAGAAAAAGGAAAAGAAAACTGG - Intergenic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
994770599 5:103976193-103976215 CACACAAAGGAGAAAAAGAAAGG + Intergenic
995172669 5:109135701-109135723 CAAAGAAATGGGAATAAGACAGG - Intronic
995227508 5:109718279-109718301 CAGAAAAAGGAAAAGAATAAAGG - Intronic
995356687 5:111245499-111245521 CAGAGAAAGTAGACCAAGAAAGG - Intronic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995866550 5:116697864-116697886 CATAGAAAAGAGGAGAAGGCCGG + Intergenic
996373738 5:122780450-122780472 AAGAGAAAGTAGAATAAGACAGG + Intronic
996651333 5:125880455-125880477 CAGAGCAAGGAGAAAAAAAATGG + Intergenic
996763425 5:127010005-127010027 CTGAGAAAGGAACAGAAAACTGG - Intronic
996815428 5:127568361-127568383 AAGAGAAAGTGGAAGAAGAGGGG + Intergenic
996923594 5:128797279-128797301 AAGAGAAAAAAGAAGAAGAAAGG - Intronic
996949318 5:129107104-129107126 CAAATAAATGAGAAGAATACTGG + Intronic
997100586 5:130964547-130964569 CAGAAAAATGATGAGAAGACTGG - Intergenic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997492969 5:134294648-134294670 AAGATGAAGGAGAAGAAGAAAGG + Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998871700 5:146558878-146558900 CACAGAAAATAGAATAAGACGGG + Intergenic
998992375 5:147832050-147832072 AAGAGAAAGAAGAATAAGAAAGG - Intergenic
999390517 5:151186348-151186370 AAGAGGAAAGAAAAGAAGACGGG + Intronic
999414643 5:151384183-151384205 CAGAGCAAGGACTAGAACACAGG - Intergenic
999913080 5:156227297-156227319 CACAGATAGGAGAATAAAACTGG - Intronic
999945447 5:156590752-156590774 GAGAGAAGGGAGAGGAAGAGTGG - Intronic
1000143857 5:158433742-158433764 AAGAGAAAGGAGAGGGAGAAAGG - Intergenic
1000195495 5:158953570-158953592 TTGAGAAAGGAGCAGAAGAGAGG + Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1000594740 5:163201979-163202001 GAGAGAGAGGAGGAGAAGCCAGG - Intergenic
1000711673 5:164587088-164587110 CAGAGACAGGACAACAAGATGGG + Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1001114062 5:168924115-168924137 GAGAGACTGGAGAAGCAGACGGG - Intronic
1001185529 5:169567860-169567882 AAAAAAAAGGAGAAGAAGAGAGG - Intergenic
1001604731 5:172951546-172951568 CAGAGGAACGAGGAGAAGAGAGG - Exonic
1001725882 5:173899609-173899631 TAGAGAAAGGATAAGATGAAGGG - Intronic
1001806512 5:174591361-174591383 GGGAGAAAGGAGAGGAAGGCAGG - Intergenic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002207573 5:177574170-177574192 AAGAGAAAATAGAAGAAGCCAGG - Intergenic
1002519843 5:179786280-179786302 AAGAGAAGGAAGAAGAAGAAAGG + Intronic
1003128305 6:3373639-3373661 AAAAGAAAGAAGAAGAAGAAAGG + Intronic
1003552997 6:7115397-7115419 CATAGAGGGGAGAAGAAAACAGG + Intronic
1004012454 6:11702687-11702709 CAGAGAAAGGAGGTGAGGCCAGG + Intergenic
1004290697 6:14364217-14364239 GAGAGAGAGGGGCAGAAGACAGG - Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004618096 6:17309572-17309594 CAGAGAGAAGAGAAGAGAACTGG - Intergenic
1004938114 6:20528032-20528054 CAGAGAAATGAGAACATCACAGG - Intergenic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005231585 6:23708022-23708044 GAGAGAGAGAAGAAGAAGACAGG + Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1006456005 6:34132320-34132342 CAGAGAATGCAGATGAGGACGGG - Intronic
1006553481 6:34845292-34845314 CTGAGCAAAGAGAAGAAAACTGG - Intronic
1007377450 6:41466573-41466595 GAGGGAAAGGAGAAGGAGATAGG + Intergenic
1007381262 6:41491705-41491727 CAGGGAGAGGAGGTGAAGACAGG + Intergenic
1007624185 6:43233697-43233719 GAAAGAAAGAAAAAGAAGACTGG - Intergenic
1007714791 6:43849482-43849504 CAGGGAGAGGAGAAGAAGCAGGG + Intergenic
1008286223 6:49654247-49654269 AAGAAAAAGAAGAAGAAGAAAGG - Intergenic
1008847672 6:55987385-55987407 CAGAGACTGGAAAAGATGACTGG - Intergenic
1009003415 6:57749261-57749283 CAGAGAAAGCAAGAGAGGACAGG + Intergenic
1009866148 6:69399998-69400020 CAGAGAAAAAAAAAGAAGAATGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1011120751 6:83949607-83949629 CAAAGGATGGAGTAGAAGACTGG - Intronic
1011198067 6:84802963-84802985 CAGAGCAGGGTGGAGAAGACTGG - Intergenic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011800663 6:91011564-91011586 TAGAGAAAGTAGAACAAGAGGGG - Intergenic
1011829301 6:91351910-91351932 CACTGAAAGGAGAAGAAGTGAGG - Intergenic
1011977259 6:93318460-93318482 ATGAGAAATGAGAAAAAGACAGG + Intronic
1012061041 6:94481491-94481513 AAGAAAAAGGAGAGGAAGAAAGG - Intergenic
1012333522 6:98024653-98024675 AAGAGTAAGGAGAAAAAGATGGG - Intergenic
1012556744 6:100522590-100522612 CAGAGACAGGGGAAGCAGAGTGG + Intronic
1012676376 6:102118233-102118255 GAGAGAAAAGAGAAAAAGAAAGG + Intergenic
1012846591 6:104397170-104397192 CAAAGAAGGGAGAAGAAAAGGGG + Intergenic
1013076917 6:106780003-106780025 CACAGTATGGAGAAGAAGACAGG + Intergenic
1013174863 6:107668632-107668654 AAGAGAAAGGAGAAGAGAAGAGG - Intergenic
1013360849 6:109392660-109392682 CAGAGACAGGAAAGGAAGATGGG + Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013452469 6:110297997-110298019 CAGAGAAAAGGGAGGAAGAGGGG + Intronic
1013556966 6:111266248-111266270 CAGAAAAAGGAGACAAAGAAGGG - Exonic
1013572715 6:111445805-111445827 CAGACATAGGAAAAGGAGACTGG + Intronic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1013688524 6:112613059-112613081 AAGGGAAAGGAGAGCAAGACAGG + Intergenic
1013855141 6:114563409-114563431 TAGAAAAAGGAAAAGAAGATTGG - Intergenic
1014335676 6:120133040-120133062 CACAGAGAGGAGAGGAAGAAAGG + Intergenic
1014367778 6:120565420-120565442 CAAAGTAAGGAGAACAAGAAAGG - Intergenic
1014494367 6:122102254-122102276 AAGAGAAAGGAGGAGGAGAAAGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014790830 6:125670059-125670081 TAGAGAGAAGAGAAGAAGATGGG - Intergenic
1014794983 6:125714555-125714577 AAGTGAAAGGACAAGAAGGCAGG - Intergenic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1014963257 6:127713798-127713820 GTGAGAAAGGAGAAGTAGAGAGG + Intronic
1015373334 6:132480851-132480873 CAGAGCAAGAAAAAGAATACTGG - Intronic
1015388331 6:132651695-132651717 GAGAGACAGGAGAAGAAGCAGGG - Intergenic
1015620268 6:135124792-135124814 CAGAGAAAGATCAAGAAGTCAGG + Intergenic
1015853807 6:137602739-137602761 GACAGAAGGGAGAAGAAGAGCGG + Intergenic
1015989511 6:138922539-138922561 CAGAAAAAGAAGAAAAAGAGAGG + Intronic
1016541025 6:145164649-145164671 CAATGAAAGGAGGATAAGACAGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016940756 6:149481309-149481331 GAGAGAAAGGACCAGAAGAAAGG + Intronic
1016983209 6:149872498-149872520 CTGAGAAAGAAGAACAAAACTGG - Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017028913 6:150203957-150203979 CAGGCAATGGATAAGAAGACTGG - Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1017516070 6:155156774-155156796 CAAAGAAAGGAGCAGAAGGGTGG - Intronic
1017866097 6:158444664-158444686 CAACCAAAGGAGGAGAAGACAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1019118833 6:169787089-169787111 GAGAGGAAGGAGAGGAAGAGAGG - Intergenic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019944623 7:4316792-4316814 GAGAGAAAGAAAAAGAAGAAAGG + Intergenic
1020087825 7:5320979-5321001 CCCAGAAAGGAGAAGCAGCCAGG + Intronic
1020381183 7:7548358-7548380 GAGAGAAAGGGGAATAGGACTGG + Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021261786 7:18467389-18467411 CAGAGAAAGCAGCAGAGGCCTGG - Intronic
1021306028 7:19033728-19033750 TAGAGAAAGAAAAAGTAGACTGG + Intronic
1021784881 7:24141898-24141920 CAGATAAATGAGAAGAACAGAGG + Intergenic
1022046208 7:26624526-26624548 CAGAGAATGGGGAAGCAGAGTGG + Intergenic
1022320408 7:29282884-29282906 CAGAGAAAGATGAAAAAGATTGG + Intronic
1022724614 7:32969661-32969683 CTGAGAAAGAAGAACAAAACTGG - Intronic
1022740650 7:33117459-33117481 CAGAGCAAGAAGAACAAAACTGG - Intergenic
1023090624 7:36614579-36614601 CAGGGCAAGAAGGAGAAGACAGG - Intronic
1023417824 7:39949594-39949616 CAGAGAAAGCCGAAGATGAGAGG - Intergenic
1023427687 7:40056419-40056441 CAGAGAAAGGGGATAAAGCCAGG - Intronic
1023439483 7:40171245-40171267 AAGAGCAAGGAGAAAAAGATGGG + Intronic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023575190 7:41619755-41619777 GAGAGAAAAGAGAAGAAACCAGG - Intergenic
1023719288 7:43076653-43076675 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1023877717 7:44297394-44297416 CACAGAAAGCAGAAAAAGAGTGG + Intronic
1023892700 7:44404851-44404873 TGGAGAAGGGAGAAGAAGATTGG - Intronic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024094132 7:45970998-45971020 CAGAAATAGGAGAAACAGACTGG - Intergenic
1024108041 7:46113405-46113427 AAGAAAGAGGAGAAAAAGACAGG - Intergenic
1024350980 7:48363714-48363736 CAGACAAAGGAGAATAAAATTGG - Intronic
1024413471 7:49075791-49075813 AGGAGAAAGAAGAAGAAGAAAGG + Intergenic
1024506962 7:50170075-50170097 CAGAGAAAGAAAAGAAAGACTGG + Intergenic
1025072320 7:55910952-55910974 CACAGTCAGGAGAAGCAGACGGG - Intronic
1025206485 7:56996161-56996183 CCCAGAAAGGAGAAGCAGCCAGG - Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1026245385 7:68615127-68615149 GAGAGGGAGGAGAAGAAGAAAGG + Intergenic
1026277761 7:68895075-68895097 TGGAGAAAGGGGAAGAAGAAAGG - Intergenic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026731209 7:72913387-72913409 CAGATAAAGTAAAGGAAGACTGG - Intronic
1026942141 7:74293364-74293386 AGGGGAAAGGAGAAGGAGACGGG - Intronic
1027112873 7:75454682-75454704 CAGATAAAGTAAAGGAAGACTGG + Intronic
1027285119 7:76639293-76639315 CAGATAAAGTAAAGGAAGACTGG + Intergenic
1027588419 7:80087318-80087340 AAGAGAAAGAAGGAGAATACAGG - Intergenic
1027940103 7:84667458-84667480 CTGACACAGGAGAAGAAGAAAGG - Intergenic
1027990916 7:85360121-85360143 CAGAGGACTCAGAAGAAGACAGG + Intergenic
1028117014 7:87009661-87009683 AAAAGGAAGCAGAAGAAGACTGG + Intronic
1028253349 7:88561630-88561652 CAGGGAGGGGAGAAGAAGAGAGG - Intergenic
1028742311 7:94289673-94289695 AATAAAAAGGAGAAGAAGATAGG + Intergenic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029646470 7:101859820-101859842 CAAAGAAAAGAGAAAAAGAAAGG - Intronic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1030190417 7:106805116-106805138 CAGAGAAAGTAGAAGACCAAAGG + Intergenic
1030238346 7:107292007-107292029 CAAAGAAAGGAGAGGAGGAAGGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030757829 7:113310683-113310705 CAGAGATGGGAGAAAAAGATAGG + Intergenic
1030957152 7:115868409-115868431 GGGGGAAAAGAGAAGAAGACAGG + Intergenic
1031051535 7:116950486-116950508 GAGAGAAAGAAGAAAAAGAAAGG - Intergenic
1031245965 7:119311516-119311538 AAAAAAAAGAAGAAGAAGACTGG + Intergenic
1031742034 7:125444899-125444921 CAAAGAAAGGAAAAAAAAACAGG - Intergenic
1031874486 7:127122972-127122994 CAGGAACAGGAGAAGAAGATGGG + Intronic
1032144058 7:129362780-129362802 CAAAGCCAGGAAAAGAAGACAGG + Intronic
1032168521 7:129564792-129564814 AATAGAAAGGAGGAGAAGAAGGG - Intergenic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032493941 7:132347046-132347068 CAGAGAAAGAAGAAAAAAAATGG - Intronic
1032540434 7:132698529-132698551 GAGAGAAAGGAGAGAAAGAAAGG + Intronic
1032866890 7:135934828-135934850 CAGAGAAAGTAAAGGAAGGCAGG - Intronic
1032945694 7:136849748-136849770 CAGGGGAAGGAGGAGAAGACAGG + Intergenic
1033504605 7:141987238-141987260 CACAGAAATGAAAAGAATACTGG + Intronic
1033652094 7:143351393-143351415 CAGAAAAAGGACAAGAAAAGGGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034411194 7:150943037-150943059 CACAGAGAGGAGAGGAAGAAAGG - Intergenic
1034859170 7:154581483-154581505 CAGGGAAAGGAGGAGAACACGGG + Intronic
1034859872 7:154585940-154585962 GGGAGAAAGGAGAGGAAGGCAGG + Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035121584 7:156572884-156572906 CACAGGGAGGAGGAGAAGACAGG - Intergenic
1035183081 7:157104976-157104998 GAGAGAAAGGCCAGGAAGACAGG - Intergenic
1035457858 7:159021074-159021096 CAGGGAGAGGACCAGAAGACCGG - Intergenic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1035575900 8:704764-704786 AAGAAAAAGAAGAAGAAAACAGG + Intronic
1035707470 8:1688223-1688245 CAGAGAAGGGAGGGGAGGACTGG - Intronic
1035854998 8:2965035-2965057 CAGAGGAAGGACAAGAAGAGGGG - Intronic
1036137535 8:6175612-6175634 CAGGAAAAGGAGAGGAACACGGG + Intergenic
1036589706 8:10157770-10157792 GAGAGAAAGAAGAAGAGGGCGGG - Intronic
1036685522 8:10907057-10907079 AAGAAAAAGAAGAAGAAGAAGGG + Intronic
1036776592 8:11617207-11617229 AGGAGAATGGAGATGAAGACGGG + Intergenic
1036786024 8:11687722-11687744 CAGAGAAAAGCCAAGAATACAGG + Intronic
1037520297 8:19674519-19674541 CAGAGGAGGGAGAAGAACAGTGG + Intronic
1037570856 8:20156629-20156651 AAGAGCAAGGAGAAAAAGATGGG - Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037712690 8:21367966-21367988 AAGAGAAAGAATAAGCAGACTGG + Intergenic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038315370 8:26480194-26480216 CAGTTAAAGGTGAAGAAAACAGG + Intronic
1038350833 8:26774852-26774874 CAGAGAAAATAGAACCAGACGGG - Intronic
1038408337 8:27339511-27339533 GAGAGAAAGAGGAAGAATACTGG + Intronic
1038452536 8:27649218-27649240 CAGAGGGAGGAGGAGATGACAGG - Intronic
1038609739 8:29049354-29049376 CAGAGAAGGTAGAAGAAGAGAGG + Intronic
1038960850 8:32517954-32517976 GAGAAACAGGAGAAGAAAACAGG + Intronic
1039124833 8:34189753-34189775 CAGCAAAAGGAAAAGAAGAGGGG - Intergenic
1039583763 8:38688068-38688090 GAAAGAAAGGAGAAGAAGGGAGG + Intergenic
1039827001 8:41183149-41183171 CAGAAAAAGCAGAAGATGAGTGG - Intergenic
1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG + Intronic
1039848775 8:41344593-41344615 GAAAGAAAGGAGAAGAAGAGAGG - Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040523630 8:48198910-48198932 AAAAGAAAGGAAAAGAAAACTGG - Intergenic
1040564431 8:48553170-48553192 TGGAGAAAGGAGAAGAAGCCCGG + Intergenic
1040781463 8:51114774-51114796 GAGAGAAGGGAGAAGGAGAGAGG - Intergenic
1040805858 8:51395685-51395707 CTGAAAAAGCAGTAGAAGACTGG + Intronic
1041536022 8:58926292-58926314 CAGAGTGAGGACCAGAAGACTGG - Intronic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042096872 8:65225807-65225829 AATAGAAGGGAGAGGAAGACAGG + Intergenic
1042268161 8:66929520-66929542 AAGAGGAAGAGGAAGAAGACAGG - Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042459605 8:69048156-69048178 AAGAGACAGAAGAAGAAAACAGG + Intergenic
1042599573 8:70485237-70485259 CAGAGAAAGGAAAGGCACACAGG - Intergenic
1043670154 8:82874559-82874581 TGGAGGAAGGAGAAGAGGACTGG + Intergenic
1043743758 8:83846877-83846899 CATAGAAAAGACAAGAAAACTGG + Intergenic
1043829408 8:84970000-84970022 CAGAGAGAGGAAGAGAAGGCTGG + Intergenic
1044503109 8:92985276-92985298 CAGAGAGAGAAGAAGAAGAGAGG + Intronic
1044553799 8:93540395-93540417 CAGTAAAAGAAAAAGAAGACAGG + Intergenic
1044794086 8:95878613-95878635 GAGAGAAAGGAGAGAAAGAAAGG + Intergenic
1044893450 8:96862341-96862363 GAGAGAGAGGAGAGAAAGACTGG + Intronic
1045524401 8:102929549-102929571 CAGAGAATCAAGAGGAAGACTGG - Intronic
1045674976 8:104597599-104597621 TAGAGATAGGAGAAGAGAACAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045707283 8:104940353-104940375 CAGAGAAGGCAGAAAAAGAGGGG - Intronic
1045749812 8:105470133-105470155 CAGAGAAAGGAAGAGTAGAGAGG - Intronic
1046623951 8:116557778-116557800 CAAAGAAAGAAAAAGATGACAGG - Intergenic
1047250520 8:123178732-123178754 AAGAGAAAGGATGAGAAGCCGGG - Intergenic
1047465878 8:125113708-125113730 ATGAGAAAGGAGAGGATGACGGG - Intronic
1047533170 8:125695687-125695709 CATAGAAAGAAGAATAAGATAGG + Intergenic
1047568487 8:126072785-126072807 AAGAAAAAGGAGAAAAAGAAGGG + Intergenic
1047595336 8:126372300-126372322 CAGAGAAAGGGAGAGAAGATGGG - Intergenic
1047670979 8:127147134-127147156 AAGAGAAAGGAGAGAAAGAAAGG - Intergenic
1047807766 8:128377542-128377564 CAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1047952468 8:129946490-129946512 CGAAGAAAGGGGAAGAGGACAGG + Intronic
1048115527 8:131517631-131517653 AGGAGAAAGGAGAAGAGGAGGGG - Intergenic
1048276122 8:133067305-133067327 TAGAGAAAGGAGAAGCAGATGGG - Intronic
1048360512 8:133693614-133693636 CTGAGAAAGGAGGAGAAGAGTGG + Intergenic
1048813676 8:138310921-138310943 CTAAGAAAAGAGAAGAGGACAGG + Intronic
1049521211 8:143092329-143092351 CAGAGAAAGGTGAAGACACCAGG + Intergenic
1049806372 8:144542565-144542587 AAGAGAAAGGAAAGAAAGACAGG - Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1051051460 9:12937354-12937376 TTGAGAAATGAAAAGAAGACAGG + Intergenic
1051141951 9:13987666-13987688 CAGAGAATGAAGGGGAAGACAGG + Intergenic
1051322611 9:15924659-15924681 CAATGAAAGGAGAGGAAAACAGG - Intronic
1051858838 9:21601041-21601063 CAAAGGAAGGACAAGAAGGCTGG + Intergenic
1051930857 9:22383677-22383699 CAGAGAATGAAGATGAAGAAAGG + Intergenic
1052032064 9:23640032-23640054 CAGAGAAGGGAGAAGCATATAGG - Intergenic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052313870 9:27096532-27096554 CAGAGAACTCAGAAGAAGACAGG + Intergenic
1052946421 9:34172004-34172026 AAAAAAAAGGAGAAGAAGAAGGG - Intergenic
1053148775 9:35729962-35729984 TAGAAAAAGGATGAGAAGACAGG + Intronic
1053187640 9:36031905-36031927 CTGGGACTGGAGAAGAAGACAGG + Intergenic
1053392525 9:37746078-37746100 CTGAGACAGAGGAAGAAGACAGG + Exonic
1053522519 9:38794657-38794679 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054194747 9:62019079-62019101 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054643661 9:67569611-67569633 CAGAGACAGGAGGAGAGGACAGG + Intergenic
1054827661 9:69589392-69589414 CAGAGAAAGAAGAATTAGAGTGG - Intronic
1055034921 9:71808377-71808399 AAGAGAATTGAGAAGAAGACTGG - Intronic
1056120181 9:83479741-83479763 AAAAGAAAAGAGAAGAAGAAGGG + Intronic
1056210325 9:84359113-84359135 CAGAGCAAGAAGGAGAGGACGGG - Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056486730 9:87066239-87066261 AACAGAAAGGGGAAGAAGTCTGG + Intergenic
1056506299 9:87261278-87261300 AACAGAAAGGAGAATAAAACAGG + Intergenic
1056689997 9:88799916-88799938 CATGGAAGGGAGAAGAAGCCAGG - Intergenic
1056775055 9:89505801-89505823 CAGAGAAAGGAGAAAACCATGGG - Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1056876276 9:90334923-90334945 CAGATAAAGCATAAGAAGAGGGG + Intergenic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057122278 9:92587105-92587127 CAGAGAAAAAAGAAAAAAACAGG + Intronic
1057232380 9:93331470-93331492 AAGAGAAAGAAGAAAAAGAATGG - Intronic
1057458807 9:95240054-95240076 AGGAGAAAGTAGAAGCAGACAGG + Intronic
1057558323 9:96107349-96107371 CAGAGGAGGGAGAAGAATAGGGG + Exonic
1057666079 9:97046440-97046462 CACTGAAAGGAATAGAAGACAGG + Intergenic
1057798517 9:98175169-98175191 GAGTGAAAGGGGAAGCAGACAGG - Intronic
1057910872 9:99019668-99019690 CAGAGAGAAGTGAAGAAAACTGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058625821 9:106931884-106931906 CACAGAAAGGAGAGGAAGAAAGG - Intronic
1058774017 9:108266368-108266390 CAGAGAAAGGAGGGGAAGCAAGG + Intergenic
1058832884 9:108835066-108835088 AATAGAAAGGAGAATAAGGCAGG - Intergenic
1058961115 9:109993812-109993834 AAGAGAGAGGAGGAGAAGAAAGG - Intronic
1059202828 9:112433992-112434014 CAGAGAAAGGATCAGAGGGCCGG + Intronic
1059206205 9:112468606-112468628 AGGAGAGAGGAGAAGAAGAGGGG - Intronic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059381046 9:113925598-113925620 CAGAGAAGGGAGAAAAAGAATGG - Intronic
1059549743 9:115217015-115217037 CACAGAAAGGAGAAGTTGAGAGG + Intronic
1059649232 9:116299707-116299729 CAGAGCAAGAAGTAGAAGACTGG - Intronic
1059914983 9:119089194-119089216 AGGAGCAAGGAGGAGAAGACTGG + Intergenic
1059997332 9:119924895-119924917 CAGAGGAGGGAGGCGAAGACTGG - Intergenic
1060098788 9:120818949-120818971 CAGAGGAAGGGGAATAGGACTGG + Intronic
1060338598 9:122751717-122751739 GAGAGAAAGGAGAATACGGCTGG + Intergenic
1060477100 9:123994984-123995006 AAAAGAAAGGAGAAAGAGACAGG - Intergenic
1060838603 9:126777210-126777232 AAGATAAAAGAAAAGAAGACAGG + Intergenic
1060956058 9:127640869-127640891 CAGAGAAAAAATTAGAAGACAGG + Intronic
1061053020 9:128207140-128207162 AAGAGTAAGGAGGAGCAGACTGG + Intronic
1061380569 9:130254310-130254332 CAGAGAGAGGAAGAGAAGCCTGG - Intergenic
1061475339 9:130861859-130861881 CAATGAAAAGAGAAGAAAACAGG + Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1203636635 Un_KI270750v1:118406-118428 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1185886804 X:3790319-3790341 CAAAGACAGGAGCAGTAGACGGG + Intergenic
1185940532 X:4314051-4314073 CAGAGAGAAGAGAGAAAGACAGG + Intergenic
1186299586 X:8185295-8185317 AAGAGAAAGCTGAAGAAGATAGG + Intergenic
1186433475 X:9523739-9523761 CACAGAAAGGTTAAGAACACTGG - Intronic
1186853551 X:13604062-13604084 AAGACAAAGGAGAACAAGAGAGG - Intronic
1186957152 X:14696157-14696179 CCAAGAAAGGAGAAGAAGGGAGG + Intronic
1187066932 X:15850104-15850126 CAGGCAAAGGAGATGAAGAAGGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187505433 X:19874961-19874983 GAGAGAGAGGAGAAAAAGAGGGG + Intronic
1187666208 X:21612976-21612998 CAGTCAAAGGAAAACAAGACAGG - Intronic
1187708997 X:22035283-22035305 GAGGGGAAGGAGAAGAAGAAAGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187827574 X:23347200-23347222 CAGGGAAGGGAATAGAAGACAGG + Intronic
1187917582 X:24169803-24169825 AAGAGAAAGCAGAAGAGGAGAGG + Intronic
1188012951 X:25076710-25076732 CACAGAAAAGAAAAGAAAACTGG - Intergenic
1188236659 X:27739915-27739937 CAGAGAAAGGAGAATAAATCTGG + Intronic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188368413 X:29338701-29338723 CAGAGACAGGAAGAGAAGAAGGG - Intronic
1188587677 X:31797913-31797935 CAGTGAGAGGAGCTGAAGACAGG + Intronic
1188713741 X:33434498-33434520 CTTAGAAAGAAGGAGAAGACTGG + Intergenic
1189425575 X:40897125-40897147 AAGAAAAAGAAAAAGAAGACTGG + Intergenic
1189989049 X:46577507-46577529 TAGAGAAGGGAGGAGAAGAGAGG + Intronic
1190023615 X:46902396-46902418 GAGAGAAAGGAGAAAAAGGAAGG + Intergenic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190994980 X:55598064-55598086 CAGAGAAAAAATAAGAAGAATGG - Intergenic
1191691479 X:63943530-63943552 CAGAGGTAGGACAAGAACACTGG + Intergenic
1192188736 X:68977790-68977812 GAAAGGAAGGAGAAAAAGACAGG + Intergenic
1192195703 X:69026493-69026515 CAGAGGAAGGAGAATACGAGTGG + Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1192340252 X:70258299-70258321 ACGAGAAAGGAGTAGAAGATTGG + Exonic
1192432701 X:71123236-71123258 CAGAGATAAGAGAACAAGATTGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193179703 X:78440322-78440344 AAGAGAAAGGAGGGGAAGATAGG + Intergenic
1193958883 X:87899159-87899181 CAGAGAAAGCAGAGGAAGAAGGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194407031 X:93509332-93509354 AAGAGAAAGGAGAATCAGAGGGG + Intergenic
1195211680 X:102656297-102656319 CTGAGACTAGAGAAGAAGACAGG + Exonic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195752530 X:108172818-108172840 CAGAAAATGCAGAAGATGACAGG + Intronic
1195931653 X:110083467-110083489 CAGAGAAAGCAAAAGAAATCTGG - Intronic
1195960613 X:110382677-110382699 AAGGGAAAGGAGAAAAAGAGAGG - Intronic
1196068535 X:111493152-111493174 AATAGAAAGAAGAAGAAGAAAGG + Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196352089 X:114743661-114743683 AAGGGAGAGGAGAAAAAGACGGG + Intronic
1196402752 X:115333186-115333208 CAGAGAAATGAAAAGTAGAATGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1198082404 X:133252182-133252204 GAAAGAAAGGAGAAGAGGAAGGG + Intergenic
1198744808 X:139878899-139878921 CATAGAAAGGAGACTAAGCCTGG + Intronic
1199365981 X:146983540-146983562 CAGAGATAGGACATGAACACTGG - Intergenic
1199511376 X:148626739-148626761 GAGAGAAAGGAGAGGGAGATTGG - Intronic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1200834335 Y:7718175-7718197 CAGGGAATGGAGAAAAAGTCTGG - Intergenic
1201474308 Y:14364206-14364228 AGGAGAAGGGAGAGGAAGACAGG + Intergenic