ID: 1150563213

View in Genome Browser
Species Human (GRCh38)
Location 17:66313070-66313092
Sequence CAGAGGAAACAGAAGTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 684}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150563213_1150563215 -5 Left 1150563213 17:66313070-66313092 CCTCTCTACTTCTGTTTCCTCTG 0: 1
1: 0
2: 5
3: 63
4: 684
Right 1150563215 17:66313088-66313110 CTCTGCCAGTTTTGAGTGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150563213 Original CRISPR CAGAGGAAACAGAAGTAGAG AGG (reversed) Intronic
900404856 1:2488209-2488231 TTTAGGAAACAGAAGTAGATGGG + Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
901755976 1:11441841-11441863 GAGAGGAGACAGGAGGAGAGAGG + Intergenic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
901915225 1:12494284-12494306 CAGAGAATACAAAAGCAGAGTGG - Intronic
902314242 1:15605779-15605801 CAGATGAAACTGAAGGATAGAGG - Intergenic
902708409 1:18222227-18222249 CAGAGGACATAAAACTAGAGAGG - Intronic
902801652 1:18833922-18833944 GAGAGGTCACAGAGGTAGAGGGG + Intergenic
902961062 1:19963054-19963076 CAGAGGAAACAGATATCGGGGGG - Intergenic
903139798 1:21332646-21332668 GGGAGGAAACAGGAGGAGAGCGG + Intronic
903139804 1:21332666-21332688 CGGAGGAGACAGGAGGAGAGGGG + Intronic
903366788 1:22810316-22810338 CACAGGAAACAGGAGAACAGTGG - Intronic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
903577007 1:24345309-24345331 CAGAGGGCACAGGTGTAGAGGGG - Intronic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
904824374 1:33265140-33265162 CAGGAGAAATAGAAGTAGGGAGG + Intronic
905008621 1:34731250-34731272 CAGAGGGAACAGTGGGAGAGAGG - Intronic
905205855 1:36342540-36342562 AAGAGGAAACAGGGTTAGAGAGG - Intronic
905267170 1:36762669-36762691 CACAGGAAACCGAAACAGAGAGG + Intergenic
905321017 1:37117411-37117433 CTGAGGAAACTGAGTTAGAGAGG + Intergenic
905776853 1:40673485-40673507 CCGAGGGTACAGAAGTAGGGAGG + Intergenic
906188818 1:43882245-43882267 CAGAGGGAACAGTGGTATAGAGG + Intronic
906577340 1:46902678-46902700 CAGAAGAAGCAGAAGTACACTGG - Intergenic
907154885 1:52324503-52324525 CAGAGGAAACAGCATAAGTGAGG - Intronic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
907931922 1:59008677-59008699 AGGAGGAAACCAAAGTAGAGAGG + Intergenic
908018071 1:59867450-59867472 TAGAGGAAAAAGAAGAAGACTGG - Intronic
908589833 1:65618625-65618647 CAAAGGAAACAGAATTAGGCTGG - Intronic
909227996 1:73050120-73050142 CAGAGCAAACAAAATCAGAGTGG + Intergenic
909516855 1:76520038-76520060 TAGAGGAAACAGAAATAAAATGG - Intronic
909683685 1:78321456-78321478 CAGAGGAAACAGAAGCCAATAGG + Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910199552 1:84684960-84684982 CAGAGGAAAAAGGAATGGAGGGG + Intronic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910294025 1:85626845-85626867 CTGAGGAAACAAAAGTGAAGTGG + Intergenic
910303624 1:85736349-85736371 CAGAGGAAATAGGAGCAGTGGGG - Intronic
910527813 1:88201251-88201273 CATAGAAAACTGAAGTAGGGAGG + Intergenic
910752570 1:90649791-90649813 CAAAGAAAACAGAGGTAGATGGG + Intergenic
910859514 1:91730234-91730256 CAGAGGAAACAGACGAGGACAGG - Intronic
910981736 1:92965091-92965113 CAGAGGAAACAGGAGTGGCAGGG - Intergenic
911227036 1:95317911-95317933 CGGTGGGAACAGATGTAGAGAGG - Intergenic
911437128 1:97875670-97875692 CAGAGGGAAAAAAATTAGAGAGG - Intronic
912617688 1:111121949-111121971 CAGAGGAAACAGTATGTGAGAGG + Intronic
913425006 1:118718739-118718761 AAGAGGAAGCTAAAGTAGAGAGG + Intergenic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
914259747 1:145988927-145988949 CAAGGCAAAAAGAAGTAGAGTGG + Intergenic
915770059 1:158411709-158411731 CAGGGAAAATAGAAATAGAGTGG + Intergenic
915839614 1:159203781-159203803 CTGAGGAAATAAAAGCAGAGAGG + Intronic
916909191 1:169326617-169326639 CAGAGGAAACAGCACTAGCTTGG - Intronic
917203905 1:172547899-172547921 GAGAGGGAACAGAGGGAGAGAGG + Intronic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917930189 1:179817518-179817540 CAGAGACTACAGAAGTGGAGAGG + Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918078404 1:181188026-181188048 CAGAGGAAACAGATATTGTGTGG + Intergenic
918358529 1:183730551-183730573 CAGAGGAAATTGAAATAGAAAGG - Intronic
918585401 1:186181843-186181865 CAGAGGAAACAAATGTAGACAGG - Intronic
918849857 1:189673243-189673265 CAAAGGAAAAAGAAAAAGAGTGG - Intergenic
919422976 1:197394156-197394178 CAGAGGAAGTGGAAGTAGAAGGG - Intronic
919479525 1:198070742-198070764 AAGAGGAAAAAAAAGAAGAGAGG - Intergenic
919642592 1:200060011-200060033 GAGAGGACACAGGTGTAGAGGGG - Intronic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920299634 1:204980651-204980673 GAGAGGAGACAGGAGCAGAGGGG + Intronic
920369292 1:205467752-205467774 CAGAGAACACTGAAGTACAGAGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921232192 1:213084149-213084171 GAGAGGAGACAGAGGAAGAGAGG - Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921399085 1:214700614-214700636 CAGAGGAAACAGTCGCAGGGTGG - Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921691844 1:218160647-218160669 CAGAAGGAAGAGAAGTGGAGAGG - Intergenic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922898983 1:229121901-229121923 CAGAGGAAACAGCAACATAGAGG + Intergenic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924737132 1:246768394-246768416 CAGAGGAAGCAGAGTTAGGGTGG - Intergenic
1063186317 10:3654986-3655008 GAGAGGAAAAAGAAGCAAAGAGG - Intergenic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064264641 10:13815641-13815663 CAGGGTCAACAGAGGTAGAGTGG - Intronic
1064877135 10:20006914-20006936 CAGAGGAAATACAAGAAGAAAGG - Intronic
1064943565 10:20761998-20762020 CAGAGGGAACAGCATCAGAGAGG - Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1066789367 10:39045731-39045753 CAGAGGAATCAGAATTAATGAGG - Intergenic
1067086276 10:43241398-43241420 GAGAGGCAACAGAACTACAGAGG + Intronic
1068423262 10:56822752-56822774 CAGAGGAAACATAAATTGTGAGG + Intergenic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1068923468 10:62510762-62510784 AAGAAGAAACAGACCTAGAGAGG + Intronic
1069245719 10:66202759-66202781 GAGAGGAAAGAGAAGTAGTATGG - Intronic
1069276463 10:66596594-66596616 AAGAGAAAAGAGAAATAGAGTGG + Intronic
1069574133 10:69514929-69514951 AAGAGGAACCAGAAACAGAGAGG - Intergenic
1069769089 10:70886437-70886459 AAGAGGAAACAGGCCTAGAGAGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070268078 10:74924120-74924142 CAGAGGTAACAGAAGTAAAGGGG + Intronic
1070678335 10:78431072-78431094 CTGTGGAAAGAGAAGCAGAGAGG - Intergenic
1071254008 10:83850482-83850504 CAGAGGAAAAGGAAGGAGCGAGG - Intergenic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072028567 10:91492144-91492166 ATCAGGAAACAGAATTAGAGAGG - Intronic
1072518853 10:96212682-96212704 CAGAGGAAACTGATGTGGTGTGG + Intronic
1072764832 10:98086907-98086929 AAGAGGAAACAGGAGTCAAGGGG + Intergenic
1072894327 10:99353245-99353267 CTGAGGAAACAGAAGTAAATAGG + Intronic
1073540623 10:104314235-104314257 CAGAGGAAACAGAATTTCAACGG - Exonic
1073994512 10:109300491-109300513 GAGAGGAAAGAAAGGTAGAGAGG - Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1074512438 10:114127997-114128019 GAGAGGAGACAGAAAAAGAGAGG + Intronic
1074524609 10:114252954-114252976 CAGAGGAAACAAAGCTAGAGGGG - Intronic
1074757326 10:116634135-116634157 CAGAGGAGAGAGACATAGAGAGG - Intronic
1075418420 10:122282758-122282780 CAGAGGATACACAAGTAAACAGG + Intronic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1076465169 10:130675530-130675552 CAAAGTAAACAGTAGTAGATGGG - Intergenic
1076487923 10:130836133-130836155 CAGAGGAAACAGCAACAAAGAGG - Intergenic
1076548731 10:131263837-131263859 CAGTGGAAACAGCTGTGGAGAGG - Intronic
1077571188 11:3339700-3339722 CAGAGGACACGGAGGTGGAGGGG + Intronic
1078138483 11:8672513-8672535 CTGAGGAAACAGTGTTAGAGAGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078806618 11:14712062-14712084 AACAGAAAACAGAAGTAGACAGG - Intronic
1079053648 11:17186114-17186136 CAGAGGTAACAGAAGAGCAGAGG - Intronic
1079145632 11:17848975-17848997 CAGAAGAAAGAGAGCTAGAGTGG - Intronic
1079329756 11:19523614-19523636 TAGAGGAGAAAGAAGAAGAGTGG - Intronic
1079396644 11:20069331-20069353 GAGAGGGGACAGAAGTAGGGAGG + Intronic
1080160118 11:29163620-29163642 GAGAGGCAGCAGAAGTAGAATGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1080922288 11:36721131-36721153 AAGAAGAAAAAGAAGTATAGAGG - Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081538328 11:44011842-44011864 GAGAGGAAAAAGAGGAAGAGAGG + Intergenic
1081578393 11:44334175-44334197 AAGAGGAAACTGAGGCAGAGAGG - Intergenic
1081583185 11:44366316-44366338 TTGAAGAAACAGACGTAGAGAGG - Intergenic
1081698095 11:45132619-45132641 GAATGGAAACAGAAGTAGAAAGG - Intronic
1082072873 11:47953038-47953060 CAAAGGAAACAGACCCAGAGAGG - Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083980214 11:66161508-66161530 GAAAGGAAACTGAAGTAGAGCGG + Intronic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084607899 11:70183246-70183268 CAGAGGAAATCAAAGTGGAGAGG - Intronic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085270670 11:75267947-75267969 CAAAAGAAACAGAAGTTTAGAGG - Intronic
1085487411 11:76877763-76877785 CAGAGGAAAAGGAAGAAGATGGG - Intronic
1085863560 11:80261842-80261864 GGGAGGAAGCAGAAGCAGAGGGG - Intergenic
1085878100 11:80433181-80433203 AAGAGCAAAAATAAGTAGAGAGG - Intergenic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG + Intergenic
1087245109 11:95826096-95826118 CAGAGGCAGAAGAAGTGGAGGGG - Intronic
1087378770 11:97378077-97378099 TAGAGGACACAGAAATAAAGTGG - Intergenic
1087684330 11:101245981-101246003 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684333 11:101246015-101246037 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684338 11:101246070-101246092 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684343 11:101246125-101246147 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684365 11:101246360-101246382 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1088057146 11:105597791-105597813 CAGAGGACAGGGAAGTTGAGTGG + Intergenic
1088170978 11:106996241-106996263 CATAGGAAAAAGAAGGGGAGGGG + Intronic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1088332749 11:108670319-108670341 GAGAGGGAACAGGAGTAGGGAGG + Intronic
1088436943 11:109824393-109824415 TATAGAAAACAGAATTAGAGAGG - Intergenic
1088999676 11:115041298-115041320 CAGGAGAGAGAGAAGTAGAGTGG + Intergenic
1090081241 11:123614216-123614238 CAGGGGAGGCAGAAGAAGAGGGG + Intronic
1090496758 11:127220623-127220645 CAGAGGAAACTGAGGCACAGAGG - Intergenic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091343121 11:134835348-134835370 GAAAGGAAACAGAAGAAGATGGG - Intergenic
1093576841 12:20741076-20741098 CACAGGAGAGAGAAGTACAGAGG + Intronic
1093707393 12:22289330-22289352 CTGAGGAAACAGGCTTAGAGCGG + Intronic
1093753594 12:22829012-22829034 CAGAGGGATCAGAAGAAGATAGG + Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094746682 12:33352673-33352695 CAGAGGACACAGTAGAGGAGAGG + Intergenic
1096361036 12:50987175-50987197 CTGAGGAAACAGCTGTAGAGAGG + Exonic
1096446251 12:51695078-51695100 CAAAGGAAAAAGAAGAAGAAAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097023699 12:56038224-56038246 GAGGGGAATCAGAAGAAGAGAGG - Exonic
1097147057 12:56949012-56949034 GAGAGGAGAGAGAAGAAGAGTGG - Intergenic
1098386229 12:69921681-69921703 AAGAGGAAATAAAAGTGGAGAGG - Intronic
1098478353 12:70932910-70932932 CAGAGGAAACACAAAAAGAGAGG - Intergenic
1099070621 12:78041989-78042011 CAGAGAAAAAGGAAGTAGATGGG - Intronic
1099529749 12:83763268-83763290 AAGAGGAGGCAGAGGTAGAGTGG + Intergenic
1100772123 12:97935027-97935049 AAGAGGAAACATAAAGAGAGAGG + Intergenic
1100833856 12:98546372-98546394 CAGAGGAAAGAAGAGTAGAAAGG + Intronic
1100848460 12:98684463-98684485 AGGAGGAGACAGAAGAAGAGAGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101286316 12:103316943-103316965 CTGAGGAAAGAGAAGTGAAGTGG - Intronic
1101540991 12:105665330-105665352 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1103172464 12:118833420-118833442 CAAAGGGAACAGAAGCAGAAAGG - Intergenic
1103739411 12:123081338-123081360 TAGGGGAAACAGCAGTTGAGGGG - Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1105465003 13:20631741-20631763 GGGACGAAACAGAAGTACAGAGG + Intronic
1105605567 13:21923849-21923871 CAGGGGACAAGGAAGTAGAGAGG - Intergenic
1105870846 13:24505155-24505177 CAGAGGAGAAAGAAAGAGAGAGG + Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106823064 13:33488088-33488110 CAGAGGAAGAGGAACTAGAGGGG - Intergenic
1106845444 13:33733120-33733142 CAGGTGAAACAGAGGTAGACAGG + Intergenic
1106881771 13:34139348-34139370 AAGGGGCAACAGAAGTAAAGGGG - Intergenic
1107574462 13:41702825-41702847 CAGCAGGAACAGAAGTTGAGGGG - Intronic
1107960787 13:45556115-45556137 ACGAGGAAACAGCAGCAGAGGGG - Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108526164 13:51287790-51287812 CAGAGGAAACTGAGGTGCAGCGG + Intergenic
1109506472 13:63309019-63309041 CAGAGGATAAAGAAGCACAGAGG + Intergenic
1109678240 13:65709596-65709618 ATGAGGAAACAGAAGCACAGAGG - Intergenic
1110295725 13:73862357-73862379 GATAGGAAACAGACGTGGAGAGG + Intronic
1110688633 13:78405049-78405071 CAAAGGAAACAGAAGCTGAGTGG + Intergenic
1111469837 13:88665225-88665247 CAAGGGAAACAGAATTAAAGAGG - Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1112141819 13:96652396-96652418 AAGAAGGAACAGAAGTAGTGAGG - Intronic
1112173424 13:96996434-96996456 AGGAGGACACAGAATTAGAGTGG + Intergenic
1112235353 13:97630962-97630984 CAGAGGAATGAGAAGAAAAGTGG + Intergenic
1112471108 13:99690393-99690415 CACAGGGAAGAGAAGTAGAGAGG - Intronic
1112483193 13:99796004-99796026 CAGGGGAAAGCAAAGTAGAGAGG + Intronic
1112903433 13:104388096-104388118 ATTAGGAAACTGAAGTAGAGTGG - Intergenic
1113061476 13:106326699-106326721 CAGGGAAATCAGAAGTATAGAGG + Intergenic
1113350343 13:109523516-109523538 CAGACGAAAAACAAGTGGAGAGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114307980 14:21440866-21440888 CAGAGGACACAGAAGCAGTTAGG + Intronic
1114444015 14:22774124-22774146 CACAGGAAACATAACTGGAGTGG + Intronic
1114542929 14:23476236-23476258 TAGATGAAACAGAAGCTGAGCGG + Exonic
1114701264 14:24680807-24680829 CAGAGGTCACAGAAGCAGTGGGG - Intergenic
1114794433 14:25696514-25696536 CAGAGGAGACAGAAATAAGGGGG + Intergenic
1114851725 14:26390316-26390338 GACAAGAAACAGGAGTAGAGTGG - Intergenic
1115048772 14:29029921-29029943 GAGAAGAAACTGAAGTACAGAGG + Intergenic
1115315449 14:32020545-32020567 CAGAAGAAACAGAAGTGCACTGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1116911417 14:50469617-50469639 CAGAGGGAACAGAATGAAAGGGG + Intronic
1117219634 14:53590017-53590039 CGGGGGAAACAAAAGTGGAGAGG + Intergenic
1117346994 14:54842529-54842551 GCTAGGAAACAGAAGTAGAGAGG + Exonic
1117476161 14:56097022-56097044 CACAGGAGAGAGAAGTGGAGAGG + Intergenic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118484156 14:66198100-66198122 CAAATGAAACAGTGGTAGAGGGG - Intergenic
1119188043 14:72658596-72658618 CAGAGGAAAAAGAAATGGATAGG + Intronic
1119297251 14:73543015-73543037 CAAAGGAAAAAGAAGAAGAATGG - Intronic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119465979 14:74858966-74858988 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1119922588 14:78460127-78460149 CAGATGAAAGAGATGCAGAGTGG + Intronic
1119929673 14:78532995-78533017 CAGTGGTAGCAGAAATAGAGAGG - Intronic
1119934593 14:78579905-78579927 AAGAGGAAACAGGCATAGAGAGG - Intronic
1120551264 14:85875965-85875987 CAGAGGCAACAAAAGGAAAGTGG - Intergenic
1121379873 14:93455170-93455192 AAGAGGATACACAGGTAGAGAGG - Intronic
1121576041 14:94988709-94988731 AAGAGGAAACAGACTCAGAGAGG - Intergenic
1121736231 14:96220100-96220122 CAGAGGAGACAGAGGTAGTGGGG - Intronic
1121911740 14:97798025-97798047 CACAGAAAACTGAAGTAGGGGGG - Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122289457 14:100672390-100672412 CAGAGCAGACAGCAGCAGAGGGG + Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122452709 14:101823642-101823664 CGGTGGAAACTGAAGCAGAGAGG + Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124026252 15:25968906-25968928 CAGAGTATACAAAATTAGAGAGG + Intergenic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125523435 15:40360675-40360697 CAGAGGATACGGGAGAAGAGTGG - Intronic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1126328250 15:47505022-47505044 CACAGAAAACAGAATTACAGTGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126796436 15:52263771-52263793 CAGAGGAAAGTAAAGCAGAGGGG - Intronic
1127057791 15:55150294-55150316 CAGGGGAAACAGAAGTGTATAGG - Intergenic
1127392741 15:58520292-58520314 CAGAGGACACAGAAGTTAAAAGG - Intronic
1127923301 15:63512263-63512285 AAGAGGAAGAAGAAGAAGAGGGG - Intronic
1128513748 15:68329011-68329033 AAAAAGAAATAGAAGTAGAGTGG + Intronic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128762579 15:70227430-70227452 CAGAGGAAATGGAAGTTTAGAGG + Intergenic
1130145205 15:81268859-81268881 CTGAGGAAACTGAGGCAGAGAGG + Intronic
1130193252 15:81756023-81756045 CAGAGAAAACAAGAGAAGAGAGG + Intergenic
1130230341 15:82092168-82092190 CAGAGGAAACTGAAGTGCAAAGG + Intergenic
1130333015 15:82935780-82935802 CAGAGGAGACAGAAGTGGGTGGG - Intronic
1131066359 15:89437136-89437158 GAGAGGAAAAAGGGGTAGAGAGG - Intergenic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1131808269 15:96146122-96146144 CAGAGGAAGCAGAAGCAAAGGGG - Intergenic
1132017717 15:98333452-98333474 CCCAGGAAACATAAGCAGAGTGG + Intergenic
1132374381 15:101319110-101319132 GAAGGGAAACAGATGTAGAGGGG - Intronic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133152830 16:3849800-3849822 CAGAGGAAACACCAGTGCAGTGG - Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134267718 16:12706293-12706315 TCCAGGAAACAGAAGCAGAGAGG + Intronic
1134408003 16:13979331-13979353 CAGAGAACACAGTAATAGAGAGG - Intergenic
1134410514 16:14000034-14000056 CAGAGGAAGCAGAGGAGGAGAGG + Intergenic
1134452934 16:14374422-14374444 AAGAGGAAACAGATGCGGAGAGG + Intergenic
1134771428 16:16812667-16812689 CAGAGGCAACAGACCTAGAAGGG - Intergenic
1134888188 16:17813626-17813648 CAGAGGAATCAGAGGCATAGAGG + Intergenic
1135721528 16:24822255-24822277 CAGAGGAAACAGCAGAGGAGTGG + Intronic
1135855272 16:26004022-26004044 ATGAACAAACAGAAGTAGAGAGG - Intronic
1137977289 16:53042406-53042428 GAGGGGAAACAGAGGAAGAGAGG - Intergenic
1138212753 16:55176679-55176701 CAGAGGAAAACGAGGCAGAGAGG - Intergenic
1138533615 16:57648219-57648241 GACAGGAAACAGAAGGAAAGAGG + Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1138757484 16:59505967-59505989 GAGAGTAGAGAGAAGTAGAGGGG + Intergenic
1139084557 16:63568693-63568715 AAGATGAAACAGAAGTAAGGTGG + Intergenic
1139654306 16:68378014-68378036 CAGAGGAAAGGGCAGTGGAGGGG - Intronic
1139782867 16:69366171-69366193 GAGAGGAAGCAAAAGTACAGTGG + Intronic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1141009937 16:80387809-80387831 AAGAGGAAACCAAGGTAGAGAGG + Intergenic
1141401305 16:83749430-83749452 CAGAGGAATCAAAACTAGAAGGG + Intronic
1141708127 16:85680838-85680860 CAGAGAAAAGAGCTGTAGAGAGG + Intronic
1142166937 16:88596339-88596361 TAGATGAAAAAGAAGTACAGAGG + Intronic
1143829327 17:9638404-9638426 CGGAGTACACAGAAGTAGAGAGG + Intronic
1144700165 17:17332374-17332396 AAGAAGACACAGAAGTAAAGGGG - Intronic
1145942203 17:28748488-28748510 CTGGGGCCACAGAAGTAGAGAGG - Intronic
1146470468 17:33120481-33120503 CAGATGACACAGAGGCAGAGGGG + Intronic
1146507035 17:33414404-33414426 CAGGGGAGAAGGAAGTAGAGGGG + Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1147569465 17:41559625-41559647 GAGTGGAGAGAGAAGTAGAGGGG - Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148824045 17:50379034-50379056 CAGAAGATACAGAAGAAGACTGG - Intronic
1148974694 17:51516819-51516841 CAGAGGCAGCTGAAGTATAGGGG + Intergenic
1149783292 17:59415207-59415229 CAAGGGAAACAGCAGAAGAGAGG + Intergenic
1149899800 17:60464627-60464649 TAGGGGAAACAGGTGTAGAGAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151713612 17:75820283-75820305 CAGAGGAAACTAAGGCAGAGAGG - Intronic
1151971632 17:77460456-77460478 CATAGGACCCAGAAGGAGAGGGG - Intronic
1152881922 17:82822504-82822526 CAGCGGAAAGAGCAGAAGAGTGG + Intronic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1155373703 18:25133287-25133309 GGGAGCAAACAGAAGTAGTGAGG - Intronic
1155762774 18:29588343-29588365 CAGAGCAAGAAAAAGTAGAGTGG + Intergenic
1156247744 18:35318408-35318430 CACAGGGAAATGAAGTAGAGAGG - Intergenic
1156286267 18:35699156-35699178 CAGAGTAGAGAGAATTAGAGGGG - Intronic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156933569 18:42675364-42675386 CAGAGGCAACACCAGTAGTGGGG - Intergenic
1157335098 18:46732267-46732289 CTGAGGAAACAGGCATAGAGTGG + Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158796590 18:60853719-60853741 ATGAGGAAACTGAAGAAGAGAGG - Intergenic
1158915452 18:62122027-62122049 CAGAGGTTAGAAAAGTAGAGGGG + Intronic
1159115584 18:64109241-64109263 CACAGGAAACAGAACTCAAGAGG + Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1161765303 19:6204575-6204597 CAGAAGAAACAGGACAAGAGAGG + Intergenic
1161911914 19:7200243-7200265 CAGAGGAAACAGAAAAGAAGAGG + Intronic
1163110670 19:15159499-15159521 AAGAGGAAGCATAAGTAGACTGG + Exonic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1165141021 19:33699959-33699981 TAGAGGCAACAGAAGTGCAGCGG + Intronic
1165365427 19:35362230-35362252 CTGAGAAAACAGATGTGGAGAGG + Intergenic
1165749405 19:38251148-38251170 CAGAGGCCACAGGAGGAGAGAGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166304928 19:41932302-41932324 CAGAGGACACAGTGGTAGGGTGG - Intergenic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
926222711 2:10946694-10946716 CAGAGGAAAGAGATGCAGATGGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927712712 2:25335784-25335806 CATTTGAAACAGAAGCAGAGAGG + Intronic
928652737 2:33419688-33419710 CACAGGAATAAGAAGTAGACAGG + Intergenic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929863465 2:45698601-45698623 AAGAGGAAAGAGAGGAAGAGAGG + Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930622546 2:53658987-53659009 AAAAGGAAAGAGAAGAAGAGGGG + Intronic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
931090967 2:58885639-58885661 CACAGGTCACAAAAGTAGAGAGG - Intergenic
931096250 2:58943850-58943872 CAGGAGAGAGAGAAGTAGAGAGG - Intergenic
931707313 2:64957913-64957935 CACAGGAAACATAAGAAGTGGGG + Intergenic
931945037 2:67297024-67297046 GAGATGAAGCAGAGGTAGAGTGG + Intergenic
932055578 2:68440050-68440072 CAGAGAGAACAAAAATAGAGAGG + Intergenic
932278557 2:70470160-70470182 GAGAAGGAACAGAAGAAGAGGGG + Intronic
932320664 2:70819969-70819991 CCCAGGAAACAGAATCAGAGAGG - Intronic
933150977 2:78914925-78914947 TAGAGGAAACAAAATCAGAGAGG - Intergenic
934056165 2:88253116-88253138 AAGAGGAAAAAGAAAGAGAGAGG - Intergenic
934162473 2:89264839-89264861 CATTGGAGACAGAAGTGGAGAGG - Intergenic
934204801 2:89917877-89917899 CATTGGAGACAGAAGTGGAGAGG + Intergenic
935352632 2:102166740-102166762 AAGAGGAAACAGGGTTAGAGAGG - Intronic
935463021 2:103361800-103361822 CAGAGGAGGCAGAGGAAGAGCGG - Intergenic
935598779 2:104900981-104901003 CACAGAAAACAGAGGTAAAGTGG - Intergenic
935936975 2:108196455-108196477 ATGAGGAAACAGAGGTACAGTGG - Intergenic
936652656 2:114446836-114446858 CATAGGAAACAGAAGACAAGGGG + Intronic
936734931 2:115428847-115428869 AACTGGACACAGAAGTAGAGTGG - Intronic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937511740 2:122603236-122603258 TACAGAATACAGAAGTAGAGGGG + Intergenic
937636107 2:124156890-124156912 CAGAGGAAACTGAGGCACAGAGG - Intronic
937770398 2:125713948-125713970 CAGAGGTTGCACAAGTAGAGTGG + Intergenic
938224768 2:129606313-129606335 CAGAGGAAACAGAAGTGACGCGG - Intergenic
938802305 2:134774481-134774503 CAGAAGAAACATATATAGAGAGG - Intergenic
938886442 2:135654157-135654179 CATAGGAGACAGAAGCAGATTGG - Intronic
939183995 2:138839360-138839382 AACAGGAAACAGATGTAGAGAGG + Intergenic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
939756536 2:146119273-146119295 CAGAAGAAAGAGAAGTTTAGTGG + Intergenic
939758535 2:146144770-146144792 CAGAGGGGACAGGAGTGGAGGGG - Intergenic
940277760 2:151957229-151957251 CAAAGAAAAAAAAAGTAGAGTGG + Intronic
940894834 2:159071084-159071106 CAGAAGGGACAGAAGTAGACAGG - Intronic
941208296 2:162602551-162602573 CAGAGGAAACAGATGTGCAAAGG - Intronic
941989062 2:171537018-171537040 CAGAGGAAGCTGAGGCAGAGAGG - Intronic
942589828 2:177530759-177530781 CAGAGAAAACAGATGTAGTCTGG + Intronic
942916367 2:181312653-181312675 GACAGGAAACACTAGTAGAGGGG - Intergenic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
945608222 2:211963608-211963630 AAGAGGAAAGAGAGGGAGAGAGG - Intronic
945769090 2:214017132-214017154 CTGAGGAAGCAGAAGTCAAGGGG + Intronic
946003494 2:216503254-216503276 TACAGGAAACTGAAGCAGAGAGG - Exonic
946391201 2:219418057-219418079 CAGGGGAGACAGCAGAAGAGAGG - Intergenic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
946574533 2:221060012-221060034 TAGAGGACTCAGAAGTAAAGTGG - Intergenic
946611154 2:221459309-221459331 GAGAGGAAAAAAAAATAGAGGGG - Intronic
946743960 2:222827552-222827574 CAGAGGTAATGGGAGTAGAGGGG + Intergenic
947123848 2:226846353-226846375 CAGAAAAATCAGAATTAGAGGGG - Intronic
948611715 2:239173113-239173135 CAGAGAATACAAAAGGAGAGAGG + Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169036392 20:2455910-2455932 CAGAGGAAAGAAAAGGAAAGGGG + Intergenic
1169984256 20:11424487-11424509 CAGAGGTAACACTAGTACAGTGG - Intergenic
1170309572 20:14977569-14977591 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1170355622 20:15489082-15489104 CAGAGGAAACACAACTTGAAAGG + Intronic
1170762899 20:19266391-19266413 CAGAGGGAAAAGAAATACAGTGG - Intronic
1171169582 20:23003489-23003511 AAAAGGAAACAGAAACAGAGAGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171415900 20:24980197-24980219 TGGAGGAAACCAAAGTAGAGAGG + Intronic
1171988334 20:31676334-31676356 ATGAGGAAACAGAGGCAGAGAGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172820944 20:37733590-37733612 CAGAGGACACAGAAGTCCAAAGG - Intronic
1173078677 20:39845455-39845477 CAGAGGAAACAGATGTGCAAAGG + Intergenic
1173622546 20:44447930-44447952 CAGAGCAAACAGGAAGAGAGAGG + Intergenic
1173633679 20:44535995-44536017 CATAGAAAACAAAAGTAGAATGG - Intronic
1173852520 20:46227907-46227929 AAGAGGAAACAGACTCAGAGAGG - Intronic
1174511212 20:51054302-51054324 CAGAAGAAACAGACACAGAGAGG + Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1174941962 20:54939155-54939177 CAGAAGAAACAGCACTTGAGAGG + Intergenic
1175075692 20:56370806-56370828 CATAGGAAACAGATGAAGCGAGG + Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175669504 20:60889967-60889989 CAGAGCAAACAGAAGTGCAAAGG + Intergenic
1176225337 20:63994926-63994948 CAGAAGTCACAGAAGAAGAGTGG + Exonic
1176926275 21:14753375-14753397 CAGAGGAAAAAGATGTGAAGAGG - Intergenic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177503684 21:21993483-21993505 CAGAGAAAACAGAATTATACAGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178260693 21:31097476-31097498 CAGAAGGAACACAAGGAGAGAGG - Intergenic
1178474054 21:32920771-32920793 CAGAGGAGACAGATGTGCAGGGG + Intergenic
1178819099 21:35959188-35959210 CAGAGGAACCAGAAGAAAACAGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179338964 21:40486484-40486506 AAGAGGAAAGGGAAGGAGAGAGG + Intronic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1180236407 21:46462074-46462096 CAGAGAACAGAGTAGTAGAGTGG + Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181462894 22:23095715-23095737 CAGAGGAAAAAGAAGCAGCCCGG + Exonic
1181464920 22:23105840-23105862 CAGCTGAAACAGAAGTGGACTGG + Intronic
1181558626 22:23686685-23686707 GAGAGGAAACACAGGGAGAGGGG + Intergenic
1181654111 22:24281013-24281035 CAGAGGAACAGGAAGCAGAGAGG + Intronic
1181825067 22:25508344-25508366 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1182786516 22:32912318-32912340 CAGAGGAAACAGAATACGTGGGG + Intronic
1183092054 22:35529137-35529159 CAGAGGAAAGGGCAGCAGAGGGG - Intergenic
1183352338 22:37341280-37341302 CAGAGGGGACAGCAGTAAAGTGG - Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184911638 22:47539234-47539256 AAGAGTTAACAGAAGTGGAGTGG + Intergenic
950178043 3:10889804-10889826 CAGAGGAAGCAGAAGTTCTGGGG + Intronic
950435949 3:12980189-12980211 CATAGGAAACAGAGGCACAGAGG + Intronic
950456987 3:13098610-13098632 CAGAGGAAACAGCAGTGGAAAGG + Intergenic
951224402 3:20104392-20104414 ATGAGGAAAGGGAAGTAGAGAGG + Intronic
951973620 3:28477242-28477264 CATAGGAAACAGATGAAAAGAGG - Intronic
952013476 3:28929862-28929884 CAGAGAAAAGAGAAATTGAGTGG - Intergenic
952469399 3:33630281-33630303 ATGAGGAAACTGAAGTACAGAGG + Intronic
953199074 3:40761590-40761612 AAGAGGAAACACAAGAAGAAAGG + Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953577884 3:44127877-44127899 CCAAGGAAGCAGCAGTAGAGAGG - Intergenic
953787454 3:45921841-45921863 CTGAGGAAACAGAAATGGAAAGG + Intronic
953992566 3:47495550-47495572 GCGAGGAAACAGACCTAGAGAGG - Intergenic
954078652 3:48199489-48199511 AGGAGGAAACTGAGGTAGAGAGG + Intergenic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
954685510 3:52368048-52368070 CAGAGGAAACATCAGTGGTGAGG + Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956490383 3:69765095-69765117 CCGTGGAAACAGAAATAGAAAGG + Intronic
956506112 3:69942086-69942108 CAGAGGAAACAGAAAAGGATTGG - Intronic
957168589 3:76708334-76708356 CAGAGGGAACAGAAGCACAACGG + Intronic
957962050 3:87268850-87268872 CAGAGGAGAGAGAAGAACAGAGG + Intronic
958713501 3:97748756-97748778 CAGAAGAGAGAGTAGTAGAGAGG - Exonic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
959667792 3:108941185-108941207 AAGAGGAATGAGAAGTAGCGGGG - Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960315687 3:116173752-116173774 TAGAAGAAATAGAAGAAGAGGGG + Intronic
960636476 3:119789684-119789706 CCGAGGAAACAGAAGTTGTGAGG - Intronic
962358359 3:134714344-134714366 AAGAGGACATAAAAGTAGAGAGG + Intronic
962504937 3:136036993-136037015 CATAGGAAAGAGGAGAAGAGAGG + Intronic
963410629 3:144922493-144922515 CACATGAAACTGAAGTAGGGAGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
964031130 3:152140058-152140080 TAGAGGAAACAGACATAGAGAGG - Intergenic
964471727 3:157064059-157064081 CAGATGAAAAAGAAGTGGGGAGG - Intergenic
965727676 3:171736316-171736338 AAGAGGAAACAGGAACAGAGAGG + Intronic
966374101 3:179277962-179277984 CAAAGGAATCAGAAGAAAAGGGG - Intergenic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967783453 3:193465007-193465029 CAGAGGAGGCTGAAGAAGAGAGG - Exonic
967826195 3:193879499-193879521 CAGAGGAATGAGGAGAAGAGGGG + Intergenic
968123359 3:196141644-196141666 AAGAGGAAACGAAAGAAGAGGGG + Intergenic
968385847 4:136631-136653 CACAGAAAACACAAGTAGAAAGG - Intronic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969688041 4:8687921-8687943 CTGAGGAAACAGGATCAGAGAGG + Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971070517 4:23086079-23086101 CAGAGGCACGAGAAGTAGAGGGG + Intergenic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971792114 4:31183314-31183336 CGGAGGAAACTGAGGTAAAGAGG + Intergenic
971810974 4:31426691-31426713 TAGTGGAAACAGAATTAAAGAGG - Intergenic
972069592 4:34999979-35000001 CAGAGAAGATAGAAATAGAGGGG - Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972684143 4:41335459-41335481 CCTAGGAAACAAAAATAGAGTGG - Intergenic
973321250 4:48812473-48812495 CAAAGGAAACTGAAAAAGAGTGG + Intronic
973552976 4:52053464-52053486 CAGATGAAGCAGGAGTGGAGGGG - Intronic
973791346 4:54380813-54380835 AAGAGGGAACAGAAAGAGAGAGG - Intergenic
973825932 4:54707890-54707912 AAGAGGAGACAGAGGTACAGAGG + Intronic
974092559 4:57327344-57327366 AAGAGGAAACAGCACCAGAGAGG - Intergenic
975406886 4:73999899-73999921 CACAGATAACAGAAGGAGAGAGG - Intergenic
975668576 4:76757275-76757297 ATGAGGAAACTGAAGTACAGAGG + Intronic
975840709 4:78470823-78470845 AGGAGGAAACAGAAAGAGAGGGG + Intronic
976050408 4:81005429-81005451 CAAAGGAAAATGAATTAGAGTGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
976975606 4:91162996-91163018 CACAATAAAAAGAAGTAGAGAGG - Intronic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
978264694 4:106809928-106809950 CAAAGGAAACTGAACTAGACCGG + Intergenic
978456221 4:108895507-108895529 CTGAGGAAAAATAAGAAGAGAGG + Intronic
980261235 4:130450484-130450506 CAGAAGAAGCAGAACTAAAGTGG + Intergenic
980397152 4:132228332-132228354 TAAAGGAAGCAGAAGCAGAGGGG + Intergenic
980635417 4:135495696-135495718 CAGAGTAAAAAGAATTAGTGGGG + Intergenic
981596230 4:146425896-146425918 TAGAGGAAGCAGAGGTAGGGAGG - Intronic
981650454 4:147051538-147051560 CAGAGGAGACAGAACCAGAGAGG + Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
983885862 4:172979823-172979845 CAGATGAAGCAGGAATAGAGGGG + Intronic
984424447 4:179565141-179565163 CAGGAGAAAAGGAAGTAGAGAGG - Intergenic
984632858 4:182078746-182078768 CAGAGGAAATAGAGAGAGAGAGG + Intergenic
984875315 4:184362660-184362682 CAAAGAAAACAGAAACAGAGAGG + Intergenic
985533073 5:444996-445018 CAGATGAAAAAGGAGAAGAGAGG + Intronic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987211318 5:15686522-15686544 AAGAAGGAACACAAGTAGAGTGG - Intronic
987585848 5:19855199-19855221 CATAGGAAACAGAAGAGCAGGGG - Intronic
987790565 5:22561689-22561711 CAGAGGAAACTGAAGTCAAGAGG + Intronic
988558133 5:32256021-32256043 AAGAGGAAACAGACCCAGAGAGG - Intronic
988606550 5:32683545-32683567 GAGAGGAAACAAAAGTTGCGGGG - Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989627980 5:43450561-43450583 CAGAGGAAACTGAGGCAGTGAGG + Intronic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
991126475 5:63075436-63075458 CAGTGGGAAGGGAAGTAGAGGGG - Intergenic
991246368 5:64512492-64512514 TTGAGGAAACTGAAGCAGAGAGG - Intronic
992361222 5:76040584-76040606 CAGAGGAAGCAAAAATGGAGAGG + Intergenic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
992733398 5:79694368-79694390 GAGAGGAGACAGAAGTAAATAGG + Intronic
992868633 5:80983202-80983224 CAGAGGAAACAGGGGCAAAGGGG - Intronic
993535281 5:89076661-89076683 CTGAGAAAACAGATTTAGAGAGG + Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
993884099 5:93396453-93396475 AAGGGGAAAGAGAAGTAAAGAGG - Intergenic
994374094 5:98998359-98998381 CAGAAGATACAAAAGAAGAGTGG - Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
994946345 5:106397288-106397310 AAAAGGAAACAGAAATTGAGGGG + Intergenic
995419329 5:111945550-111945572 AAGAAGAAACAGAAGAAAAGAGG + Intronic
995554103 5:113309933-113309955 CAGAAGAAAGAGAGGAAGAGAGG - Intronic
996475674 5:123917666-123917688 GAGAGGAAAGAGAAATAAAGAGG + Intergenic
996578353 5:125001170-125001192 CAGAGGAGACGGGAGGAGAGGGG - Intergenic
997453329 5:134000666-134000688 CTGAAGAAAAAGGAGTAGAGAGG - Intronic
997701986 5:135908935-135908957 ATGAGGAAACAGAGGTAGAGAGG + Intergenic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999217457 5:149947139-149947161 CAAAGGATACAGATGAAGAGAGG - Intergenic
999252657 5:150191810-150191832 GAGAGGGAAGAGAAGGAGAGTGG - Intronic
999303337 5:150504391-150504413 CAGAGGACACGGAAACAGAGGGG - Intronic
999826676 5:155280281-155280303 CCGAGTTAACAGAGGTAGAGAGG + Intergenic
999852560 5:155558669-155558691 CTGAGGAAACAGAGTCAGAGAGG + Intergenic
1000154744 5:158539411-158539433 CAGAGCTAACAGAAGGAAAGAGG - Intergenic
1001604731 5:172951546-172951568 CAGAGGAACGAGGAGAAGAGAGG - Exonic
1002018811 5:176348315-176348337 GAGAGGTAACAAAAGAAGAGAGG - Exonic
1003173941 6:3741019-3741041 CAGATGAGACAGAAGTGGACAGG + Intronic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003497009 6:6673050-6673072 GAAAGGAGGCAGAAGTAGAGGGG - Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004293372 6:14388392-14388414 CAGAGGTAACAGAGATAGAGGGG - Intergenic
1004545717 6:16596662-16596684 CAGAGGAATTTGAAGTGGAGGGG - Intronic
1004904460 6:20223337-20223359 GAGAGAAAACAGAAAGAGAGGGG + Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005332648 6:24764659-24764681 CAGATGAAATGGAAGAAGAGAGG - Intergenic
1005709871 6:28493354-28493376 CAGTGGAGACACAAGTAGAAAGG - Intergenic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006304997 6:33213514-33213536 CAGAGGAAACAGGAAGTGAGGGG - Intergenic
1006360598 6:33585027-33585049 ACGAGGAAACAGACGCAGAGAGG - Intergenic
1006433679 6:34014681-34014703 AAGAGGAAAGAGACGTGGAGGGG + Intergenic
1006746420 6:36345995-36346017 CAATGGAAAGAGAAGTAGATGGG - Intergenic
1007280431 6:40708388-40708410 CAGAAGAAAAAGAGGTGGAGGGG + Intergenic
1007670920 6:43552961-43552983 AAGAGGAAACAGATTTAGAGAGG - Intronic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1008016798 6:46529660-46529682 AAGAGGAAACAGACACAGAGAGG - Intergenic
1008347732 6:50449853-50449875 CAGGGGCATCACAAGTAGAGAGG + Intergenic
1008469672 6:51869780-51869802 CATAGGAAAAAAAAGTAAAGTGG + Intronic
1009349148 6:62652786-62652808 CAGAGGAGACAGGAGAAAAGAGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010566919 6:77427070-77427092 CAGAGGAAATAGACTCAGAGAGG - Intergenic
1011821570 6:91258795-91258817 AAGAGGAAACAGAGATAGTGTGG - Intergenic
1012746480 6:103096499-103096521 CAGAATAAACAGAAATACAGGGG - Intergenic
1013967465 6:115972099-115972121 CCCAGGAAACAGAAGCTGAGAGG - Intronic
1015186373 6:130421041-130421063 CAGATGAAACAGAAGGGGAGGGG - Intronic
1016792029 6:148076106-148076128 TGTAGGAAACAGAAGGAGAGTGG - Intergenic
1016793794 6:148095770-148095792 CTGAGGAAACAGGAACAGAGTGG - Intergenic
1016862189 6:148731829-148731851 AAGAGGAGGCAGAAGAAGAGGGG + Intergenic
1017209144 6:151835457-151835479 CAAAGGGAACGGAAGTGGAGTGG + Intronic
1017501130 6:155024052-155024074 CAGAGGACACAGGCTTAGAGAGG + Intronic
1017772739 6:157655618-157655640 CAGAGGGAACCCAGGTAGAGTGG - Intronic
1018463919 6:164025152-164025174 TGGAGGGAAGAGAAGTAGAGGGG - Intergenic
1019299389 7:295824-295846 CAGAGGAAACCAAGATAGAGAGG - Intergenic
1019315496 7:382436-382458 CTGAGGACACAGCAGTAGAATGG + Intergenic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1020077204 7:5266270-5266292 CAGAGGAGACAGGAGCGGAGGGG + Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020746340 7:12083266-12083288 CAGAGGAAAAAGAATTACAAAGG + Intergenic
1021054910 7:16035612-16035634 AAGAGGAAACAGAAGCACATAGG - Intergenic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1021942256 7:25689430-25689452 TTGATGAAACAGAACTAGAGAGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022257576 7:28674603-28674625 CAGAGGAATCAGGAGAACAGAGG - Intronic
1022351869 7:29573754-29573776 CAAGGGAAACAGAATCAGAGAGG - Intergenic
1023445232 7:40224737-40224759 CACAGGAAACAGTAGTATAGCGG - Intronic
1023679266 7:42667513-42667535 AACAGGAGACAGAAGAAGAGGGG - Intergenic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024434566 7:49335288-49335310 CAAAAGTAATAGAAGTAGAGTGG + Intergenic
1024803662 7:53110629-53110651 AAGAGGAAACAGAAATTCAGAGG - Intergenic
1025201910 7:56967395-56967417 CAGAGGAGACAGGAGCAGAGGGG - Intergenic
1025670036 7:63609533-63609555 CAGAGGAGACAGGAGCAGAGGGG + Intergenic
1026562372 7:71461061-71461083 CAGAGGCATCTGAACTAGAGCGG - Intronic
1027171790 7:75878084-75878106 AAGAGGAAACAGGACTAGGGAGG - Intronic
1027376766 7:77558517-77558539 AAAAGGAAACAGATGTGGAGGGG + Intronic
1027990916 7:85360121-85360143 CAGAGGACTCAGAAGAAGACAGG + Intergenic
1028115762 7:86995945-86995967 CAGAAGAAACACAAGTAACGTGG + Intronic
1028359044 7:89945748-89945770 AAGAGGAAATAAAAGTACAGAGG + Intergenic
1028760132 7:94486855-94486877 CAGAGGAGACAGATCTTGAGAGG - Intergenic
1028814311 7:95126988-95127010 AAGAGGAAAGAGAGGTAAAGAGG - Intronic
1028859018 7:95626696-95626718 CCAAAGAAACAGAAGTAGATTGG + Intergenic
1028874604 7:95806979-95807001 AAGAGGAAACAGGTTTAGAGAGG - Intronic
1029171519 7:98632555-98632577 CAGAGGAGACAGAAAAAAAGTGG + Intergenic
1029276798 7:99410031-99410053 CAGAAGAAACAGGACCAGAGAGG + Exonic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1030498308 7:110327782-110327804 TAGAGGAAACACATGTAGATGGG + Intergenic
1031654209 7:124332249-124332271 GAGAGGGAAGAGAAGGAGAGAGG + Intergenic
1032719791 7:134541540-134541562 AAGAGGAAATGGAGGTAGAGGGG + Intergenic
1032853995 7:135818927-135818949 CAGAGGAAAAAGAAGAGGAGAGG - Intergenic
1032891239 7:136197834-136197856 AAGAAGAAAAAGAAGAAGAGAGG + Intergenic
1033418244 7:141183305-141183327 CAGAGGACCCAGAATTTGAGAGG - Intronic
1034231127 7:149529368-149529390 CAGAGGAGACAAAAGGAAAGAGG + Intergenic
1034607355 7:152329609-152329631 AAGAGGAAAAGGAAGTAGAAGGG + Intronic
1035179204 7:157077149-157077171 CACAGGAATGAGAAGGAGAGAGG - Intergenic
1035854998 8:2965035-2965057 CAGAGGAAGGACAAGAAGAGGGG - Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036546260 8:9772036-9772058 GAGAGGAGACAGAGGTAGGGAGG + Intronic
1036775500 8:11609082-11609104 AAGAGGAAACAGACTTAGATGGG + Intergenic
1037055762 8:14439741-14439763 CTTAGGAAACAGAAATTGAGGGG + Intronic
1037602075 8:20405591-20405613 CAGAGGAAACGCCAGCAGAGAGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037846949 8:22291930-22291952 CAGGGCAATCAGAAGTAGTGGGG + Intronic
1038020113 8:23545537-23545559 CAGTGGACACACAAATAGAGAGG - Intronic
1038308314 8:26424523-26424545 AGGAGGAAGCAGAAGTAGATGGG + Intronic
1038615709 8:29092332-29092354 CAGAGAAAACAGAGGTTGAGAGG + Intronic
1039041871 8:33416151-33416173 CAGAAGAAACAGAAATAAAATGG + Intronic
1039179550 8:34850112-34850134 CATAGGAAACATCAGTAGTGAGG - Intergenic
1039247810 8:35628974-35628996 CAGAGGAAAGAGCACCAGAGAGG - Intronic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041581782 8:59469167-59469189 CTGAGGAAATAGAAGTGGAAGGG - Intergenic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1042970531 8:74403330-74403352 AGGAGGAAATAGAAGAAGAGGGG + Intronic
1044288720 8:90441928-90441950 AAGAAGGAACAGAAGTAGAAGGG + Intergenic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045592938 8:103618625-103618647 TAGAGGAATCAGAAGAAGAGGGG - Intronic
1045806225 8:106165543-106165565 AAGAGGAAACAGGAGAGGAGGGG + Intergenic
1046974029 8:120253378-120253400 AAGAGGAAACAGAATTGAAGAGG - Intronic
1047054885 8:121152998-121153020 CAGAGGAAGAAGAGGTAGAAGGG - Intergenic
1047147917 8:122226421-122226443 AAGAGGAAAAAAAAGTAGAGGGG - Intergenic
1047224700 8:122946424-122946446 CAGATGAAAAAGAAGAAAAGAGG - Intronic
1047481175 8:125284447-125284469 ATGAGGAAACAGAACCAGAGAGG + Intronic
1047691166 8:127356135-127356157 TAGAGAAAACAGAAGAGGAGTGG + Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1048200946 8:132373553-132373575 CAGAGGAAACTGAGGCACAGAGG + Intronic
1048873510 8:138817872-138817894 CTGAGGAAACAGCACCAGAGAGG + Intronic
1048924308 8:139257027-139257049 CAGAGGGAAGGGAAGAAGAGTGG - Intergenic
1050194288 9:3064457-3064479 CAGAGGTTACAGAAGTAGGGTGG - Intergenic
1050686100 9:8171006-8171028 GAGAGGACACAGAAACAGAGTGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051826772 9:21231106-21231128 CAATGAAAACAGAGGTAGAGGGG + Intronic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052200784 9:25777036-25777058 CAGAGGAGACAGACTGAGAGAGG + Intergenic
1052642709 9:31189713-31189735 CAGAGGAGAAAGAAGACGAGTGG - Intergenic
1054827661 9:69589392-69589414 CAGAGAAAGAAGAATTAGAGTGG - Intronic
1055048284 9:71953634-71953656 CAGTGGGAACAAAAGTTGAGAGG - Intronic
1055591041 9:77814105-77814127 CAAAAGAAACAGAAGGACAGAGG + Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1055783797 9:79849677-79849699 CTGTGGAAACAAAAGTAAAGAGG + Intergenic
1057488836 9:95506883-95506905 AAGAGGAAGCCGAGGTAGAGAGG + Intronic
1057619263 9:96620019-96620041 CAGAAGAAACAAAAGTTGGGGGG - Intergenic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1059202388 9:112430280-112430302 CAGAGGAAGCAGCAGTGGATAGG + Intronic
1059472183 9:114514005-114514027 CTGAGGAAACAGAACCAGAGGGG - Intergenic
1059628214 9:116090912-116090934 CAGAGGACTCAGATGTAGATAGG + Intergenic
1060207488 9:121690774-121690796 CAGAGGACACCCAAGTAAAGGGG - Intronic
1060384621 9:123213551-123213573 CAGAGGAAACAATAGTTTAGAGG + Intronic
1061736662 9:132665385-132665407 CAGAGGAGACAAAAGTATAAAGG + Intronic
1061825823 9:133257634-133257656 CAGAGGAGGCAGAAGCTGAGTGG - Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1185830108 X:3293337-3293359 AAGAGGAAAGAGAAGAGGAGAGG + Intergenic
1186137596 X:6535017-6535039 CAGAGGAATCTGTAGGAGAGAGG - Exonic
1186336283 X:8592648-8592670 GAGAGGAAATAGAAATAGAAAGG + Intronic
1186940605 X:14503234-14503256 CAGAGGACAGAGCAGTAGGGTGG + Intergenic
1187125271 X:16448657-16448679 CAAAGGAAACAGAAACAGAGAGG - Intergenic
1187144220 X:16622876-16622898 ATGAGGAAACTGAGGTAGAGAGG - Intronic
1187674819 X:21705608-21705630 CTGAGCAAACAGAACAAGAGAGG - Intergenic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1188083308 X:25872575-25872597 CAGCTGAGACAGACGTAGAGTGG + Intergenic
1188981160 X:36728445-36728467 TAGAGGAACCAGAAGCAGTGTGG - Intergenic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189730965 X:44020544-44020566 GAGAGGTAAAAGAAGTAAAGTGG + Intergenic
1189800820 X:44690406-44690428 GGGAGGAAAAAGAAGCAGAGTGG + Intergenic
1190133605 X:47773572-47773594 AAGAGGAAAAAGAAACAGAGAGG + Intergenic
1191043471 X:56110589-56110611 CACAGGAAACAAAATTAGAAGGG - Intergenic
1191680292 X:63833462-63833484 AAAAGGAAACAGAACTGGAGGGG + Intergenic
1191940433 X:66474485-66474507 CAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1192192615 X:69001074-69001096 CAGAGGAAACAGATGCAAAGTGG + Intergenic
1192219168 X:69185423-69185445 CAGAGGAAGAGAAAGTAGAGAGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193437383 X:81492492-81492514 CAGAGGAAATAGTTTTAGAGAGG - Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1193848421 X:86504196-86504218 CAGATGAAACTGAAGCATAGAGG + Intronic
1194980064 X:100431403-100431425 AGGAGGCAAGAGAAGTAGAGAGG - Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195363160 X:104104562-104104584 CAGAGGATACAGAACTAGGCAGG + Exonic
1196080923 X:111630051-111630073 AAGAGGAAAAGGAAGAAGAGGGG - Intergenic
1196200195 X:112878084-112878106 TTGAGGAGACAGAAGTGGAGAGG - Intergenic
1196311943 X:114178662-114178684 CAGAGGAGAAGGAAGAAGAGGGG - Intergenic
1197069021 X:122270905-122270927 CAGAGGAAACAGACGTATTTGGG - Intergenic
1197357430 X:125452852-125452874 GAAAGGAAGCAGAAGTTGAGGGG + Intergenic
1197384151 X:125782764-125782786 CAGAGGAAACAGAAAGGGATGGG - Intergenic
1197535222 X:127679030-127679052 TAGAGGAAGTAGAAGGAGAGTGG + Intergenic
1197615208 X:128682978-128683000 CAGAGGAAACTGAGGTACAGAGG - Intergenic
1197616347 X:128696047-128696069 AGGAGGAAACAAAAGTAGAAGGG + Intergenic
1198020576 X:132653564-132653586 CAGAGAAAACAGATTCAGAGAGG + Intronic
1199284622 X:146042210-146042232 GAGAGGATACAGGAGAAGAGAGG + Intergenic
1199404304 X:147438383-147438405 CCGAGGAAACAGAAGTGGAGAGG + Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1200755297 Y:6985028-6985050 ATGAGGAAGCAGAAGTGGAGAGG - Intronic
1201247756 Y:12022961-12022983 CAGAGGAAAGGGAAGAGGAGAGG + Intergenic
1201247866 Y:12024172-12024194 AAGAGGAAAGAGAAGAGGAGAGG - Intergenic
1201452969 Y:14136136-14136158 CAGAGGAGAGGGAAGTGGAGAGG - Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic