ID: 1150563831

View in Genome Browser
Species Human (GRCh38)
Location 17:66320038-66320060
Sequence ATGTATATGAATTAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150563831_1150563836 26 Left 1150563831 17:66320038-66320060 CCTGCCTCTTAATTCATATACAT 0: 1
1: 0
2: 0
3: 22
4: 261
Right 1150563836 17:66320087-66320109 TTGGTGAATCCTGTTGTCATAGG 0: 1
1: 0
2: 1
3: 12
4: 117
1150563831_1150563837 27 Left 1150563831 17:66320038-66320060 CCTGCCTCTTAATTCATATACAT 0: 1
1: 0
2: 0
3: 22
4: 261
Right 1150563837 17:66320088-66320110 TGGTGAATCCTGTTGTCATAGGG 0: 1
1: 0
2: 0
3: 9
4: 98
1150563831_1150563833 7 Left 1150563831 17:66320038-66320060 CCTGCCTCTTAATTCATATACAT 0: 1
1: 0
2: 0
3: 22
4: 261
Right 1150563833 17:66320068-66320090 CTGACCTTTGTTGACCTTCTTGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150563831 Original CRISPR ATGTATATGAATTAAGAGGC AGG (reversed) Intronic
900268568 1:1774418-1774440 ATGTTGGAGAATTAAGAGGCAGG - Intronic
901321328 1:8341909-8341931 ATGTAAATAAATAAATAGGCCGG + Intronic
902294767 1:15459458-15459480 AAGTATATAAATTGTGAGGCTGG - Intronic
903431371 1:23303249-23303271 ATGTCTATTTGTTAAGAGGCAGG - Intergenic
909425735 1:75522617-75522639 ATGCATATGACTAAAGAGTCGGG - Intronic
912587458 1:110780013-110780035 AGGTATATGAATGAAGAGTGGGG - Intergenic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
921021473 1:211239414-211239436 GTGTATATGAAATAAGAAACTGG - Intergenic
921789099 1:219269122-219269144 GTGTATATGAATGGAGAGACTGG + Intergenic
921899099 1:220431561-220431583 GTGAAAATGAATTAATAGGCTGG - Intergenic
922327847 1:224545672-224545694 ATTTATGTGAATAAAGAGTCTGG + Intronic
923298099 1:232614398-232614420 ATGTATATAAATTCTGAGGATGG - Intergenic
923350035 1:233095541-233095563 CTGAATATGCATTAAGAAGCAGG + Intronic
923784002 1:237050309-237050331 GTGTATAGGAACTCAGAGGCTGG + Intronic
924444577 1:244117234-244117256 ATGTATATAGATTAAAAGGAAGG - Intergenic
924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG + Intergenic
1063727945 10:8659953-8659975 AGATATATGCATAAAGAGGCAGG + Intergenic
1064177938 10:13091425-13091447 ATGTCTATGAACCAGGAGGCAGG + Intronic
1064763377 10:18645205-18645227 CTGTATATAAATTCAGAGTCAGG + Intronic
1064778442 10:18806255-18806277 ATATATATGAATTCAGTGACTGG + Intergenic
1064907876 10:20367439-20367461 ATGTAAATGAATAAAAAAGCTGG - Intergenic
1066469268 10:35682208-35682230 ATGGATAAGATTTGAGAGGCAGG + Intergenic
1068780835 10:60917678-60917700 ATGTGATTGTATTAAGAGGCGGG - Intronic
1069146611 10:64900098-64900120 TTGTTTCTGAATAAAGAGGCAGG - Intergenic
1070035495 10:72718898-72718920 ATTTATATGAATTCAAAAGCAGG + Intronic
1070630337 10:78080196-78080218 ATGTATATAAATTCAGATGCAGG - Intergenic
1071493713 10:86153768-86153790 ATCAATATTAATTAAGAGGCAGG + Intronic
1073403259 10:103276114-103276136 AAGTAAATGAATTAAGAAGGGGG + Intergenic
1074094013 10:110292166-110292188 GTGTCTCTGAACTAAGAGGCAGG - Exonic
1076741074 10:132485693-132485715 ATGTGTGGGAATGAAGAGGCAGG - Intergenic
1077623504 11:3749326-3749348 AAATAAATAAATTAAGAGGCCGG + Intronic
1078436719 11:11331417-11331439 ATGTATATGATATAAGAGTTGGG + Intronic
1078607368 11:12788796-12788818 ATGTGTATAATTTAAAAGGCAGG + Intronic
1082713109 11:56578642-56578664 GTGTACATGAATAAACAGGCAGG - Intergenic
1084649100 11:70478013-70478035 ATGAATGTGATTTAAAAGGCAGG - Intronic
1085499925 11:77010729-77010751 AAGTATATAAGTTGAGAGGCAGG + Intronic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1088205210 11:107384542-107384564 ATGTATTTGAATTTAGATACAGG - Intronic
1089138435 11:116267787-116267809 CTGTGTCTGAATTAAGAGTCTGG + Intergenic
1089940007 11:122406445-122406467 AAGTATATTTATTAAAAGGCTGG + Intergenic
1091936620 12:4439983-4440005 ATGAAGATGAATTAAGGGGCTGG - Intronic
1093317430 12:17668291-17668313 AAGTGCATGAAGTAAGAGGCAGG + Intergenic
1094663657 12:32496790-32496812 ATGGATAAGAATTAAGAGTGTGG + Intronic
1096266599 12:50127881-50127903 ATTTATTTGAATGAAGATGCAGG - Intergenic
1096655949 12:53092242-53092264 ATGTGGATGAATTAAAAGGAAGG + Intergenic
1097014156 12:55973732-55973754 ATGTTTATGAGTCAAAAGGCGGG + Intergenic
1097163404 12:57067027-57067049 ATGAAAATGAACTAATAGGCTGG + Intronic
1099270866 12:80508467-80508489 ATGAAAATGAATAAAGAGGGAGG + Intronic
1099802944 12:87480013-87480035 ATGTATATGAATGGAGGGACTGG - Intergenic
1101001986 12:100365998-100366020 ATGTACATGAGTTAAGAGTGTGG + Intronic
1101911678 12:108864795-108864817 ATTTAAATGAATTAATAGGCCGG + Intronic
1102852084 12:116257241-116257263 ACGTATATTATTTACGAGGCAGG + Intronic
1103258862 12:119567350-119567372 AAGAATATAAATTAATAGGCCGG + Intergenic
1104617944 12:130285893-130285915 ATGTAAAAAAATAAAGAGGCTGG - Intergenic
1105324163 13:19355150-19355172 ATCTATACTAATTAAGAGTCCGG + Intergenic
1105364456 13:19752097-19752119 ATGAATATGAATTAACTGTCTGG + Intronic
1107050138 13:36038228-36038250 ATGGGTGTGAATGAAGAGGCAGG + Intronic
1109480051 13:62940409-62940431 ATGTAAATCTATTAAGAGGCAGG - Intergenic
1109866959 13:68277119-68277141 AAAAATATGAATTAAGATGCTGG - Intergenic
1109976880 13:69848724-69848746 ATGCATATGAAATAAGTAGCAGG + Intronic
1110174487 13:72539269-72539291 ATCTAGATGAGTTAACAGGCAGG + Intergenic
1110965455 13:81689394-81689416 ATATATATGTATTAAAAGACAGG - Intergenic
1111792118 13:92870967-92870989 ATGTATATGGATGGAGCGGCAGG - Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113607118 13:111617058-111617080 ATGTACATTAATACAGAGGCAGG - Intronic
1114766303 14:25374457-25374479 ATGCTTATGAATTAATAGGGTGG - Intergenic
1114816834 14:25969047-25969069 AGGTGTATGAATAAAGATGCAGG + Intergenic
1116241512 14:42349213-42349235 ATAAATATGAATTGAAAGGCAGG - Intergenic
1117753472 14:58947988-58948010 ATGCATATGTCTTAAGAGCCAGG - Intergenic
1118582001 14:67310380-67310402 ATGTATATGAATTAATATACAGG + Intronic
1119256028 14:73197877-73197899 ATGAATATGAAATAAATGGCAGG - Intronic
1121344291 14:93123826-93123848 ATGTATATTAAAAAAGACGCAGG - Intergenic
1124437248 15:29661023-29661045 ATTTACATGAATTAAGAGTGTGG + Intergenic
1124608063 15:31185843-31185865 GTGTGTGTGTATTAAGAGGCAGG - Intergenic
1126682588 15:51217218-51217240 CTCTCTATGAATTTAGAGGCTGG - Intronic
1126893722 15:53235476-53235498 GTGTAAAGGAGTTAAGAGGCTGG - Intergenic
1127883815 15:63181570-63181592 ATGTATATATATTTAGAGGCAGG - Intergenic
1128404126 15:67317766-67317788 ATGTAATTGAATGAAGAGGAAGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129531876 15:76272793-76272815 ATGTATATATTTTAAGAGACAGG - Intronic
1131838379 15:96412453-96412475 ATGTATAAGAATGAAGATACTGG + Intergenic
1132124446 15:99210050-99210072 ATATATATCAAATAATAGGCAGG - Intronic
1133647890 16:7781389-7781411 AGGTATGTGAATTAAGGAGCAGG + Intergenic
1134021671 16:10925311-10925333 ATATATATGTTTTAAGAGGCAGG + Exonic
1135144301 16:19948254-19948276 ATGTATCTGAATTAAGGTGAAGG + Intergenic
1135575398 16:23582275-23582297 ATGTATATGAATAAAGTATCAGG - Exonic
1135833693 16:25803359-25803381 ATGTTTATGAATGATGAGACAGG - Intronic
1138075390 16:54037236-54037258 ATGCATATGATTTAAGTAGCAGG - Intronic
1138143127 16:54585658-54585680 ATCTGTATGAATTAATAGGCCGG + Intergenic
1138398787 16:56729349-56729371 CTATCTATGAATTAGGAGGCAGG + Intronic
1138583095 16:57954300-57954322 ATGTAAACAAATGAAGAGGCAGG + Intronic
1139124196 16:64058008-64058030 ATATATATGAAATAATAGGCCGG - Intergenic
1145029214 17:19491886-19491908 CAATATATGAATTGAGAGGCGGG - Intergenic
1145358497 17:22186940-22186962 ATGTAAATCTTTTAAGAGGCAGG + Intergenic
1150563831 17:66320038-66320060 ATGTATATGAATTAAGAGGCAGG - Intronic
1150673046 17:67218744-67218766 ATGTGAATCACTTAAGAGGCAGG - Exonic
1151142145 17:72003851-72003873 ATGTACATGAATTTACTGGCAGG - Intergenic
1155922558 18:31617944-31617966 ATGTATCTGAATAGAGAGCCCGG - Intergenic
1158672327 18:59487640-59487662 ATGTAGATGAACAAATAGGCAGG - Intronic
1159106325 18:64005406-64005428 ATGTATCAGTATTAAGAGGTGGG + Intronic
1159687162 18:71436956-71436978 ATGTAATTGTATTAAGAGGCGGG + Intergenic
1160123855 18:76153148-76153170 ATGCATATGAATTCATTGGCTGG - Intergenic
1161860017 19:6791005-6791027 ATGCATGTGAAATAGGAGGCAGG - Intronic
1162591628 19:11596122-11596144 ATGTATTAGTATTAAAAGGCAGG - Intronic
1164317842 19:24110023-24110045 CTGAAAATGAGTTAAGAGGCCGG - Intronic
1165643776 19:37415572-37415594 AGGTATGAAAATTAAGAGGCCGG + Intronic
1167533825 19:50036289-50036311 ATGTAGCTGTATTAAGAGGTGGG + Intronic
926025174 2:9536538-9536560 AGGTATATAAGTTTAGAGGCAGG - Intronic
926452905 2:13027429-13027451 ATGTATCAGTATTAAGAGGTGGG - Intergenic
927303578 2:21543918-21543940 ATGTATTTGTATTGAGTGGCAGG + Intergenic
927995888 2:27485711-27485733 ATGCAAATGCACTAAGAGGCAGG + Intronic
928895870 2:36262863-36262885 ATGAATATGATTTGAGAGGATGG + Intergenic
929568125 2:43002664-43002686 ATGTATACAAAATAACAGGCAGG + Intergenic
930489909 2:52056324-52056346 ATGATTGTGAATAAAGAGGCAGG - Intergenic
930792639 2:55350663-55350685 ATGTATATATTTTAAGAGACAGG + Intronic
931019779 2:58030802-58030824 ATGCATATGACTTCTGAGGCTGG + Intronic
931899453 2:66771424-66771446 TGGGATATAAATTAAGAGGCTGG - Intergenic
932948815 2:76269251-76269273 ATGAATTTGAATTAAGAGAGGGG - Intergenic
933104788 2:78310764-78310786 ATAAAAATGAATTAAGAGGCCGG - Intergenic
933664738 2:84955872-84955894 ATGGATAAGAAGTAACAGGCTGG + Intergenic
936812869 2:116422987-116423009 ATGTATATGGATTCACAGGCTGG + Intergenic
936956707 2:118029757-118029779 ATGTATGGGAATTATGAGTCTGG - Intergenic
941129685 2:161631398-161631420 ATTTATATAAATTAAGAAGAGGG + Intronic
941516010 2:166479720-166479742 TTGTAAATGAATCCAGAGGCTGG - Intronic
941545075 2:166839991-166840013 ATCCATATAAATTAAGAGACTGG + Intergenic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
941670174 2:168284296-168284318 ATTTATATGAATGAGGAGACTGG + Intergenic
941944637 2:171081411-171081433 ATGTCTATGAAACAGGAGGCAGG + Intronic
943184439 2:184588457-184588479 TTGTTTATGAATACAGAGGCAGG + Intergenic
944338967 2:198572474-198572496 ATGTATATGAAATAAAATGGAGG - Intronic
944440484 2:199738385-199738407 ATGTTTATTAATAAAGAGCCTGG + Intergenic
944494404 2:200291797-200291819 ATTTTTAAGAATTAAGTGGCCGG + Intergenic
947061290 2:226169484-226169506 AAGCATATAAAGTAAGAGGCTGG - Intergenic
948705585 2:239790284-239790306 ATGTTTATAAAATAAGATGCTGG - Intronic
948768958 2:240237679-240237701 GTGTAAATGCAGTAAGAGGCAGG - Intergenic
1169525040 20:6415311-6415333 ATGAAAGTGAATTAAGAGGTTGG + Intergenic
1170072674 20:12385215-12385237 ATTGATATGATTTAAGAGACTGG + Intergenic
1170380018 20:15748281-15748303 ATGTATTTGAACTCAGAGCCTGG - Intronic
1171121611 20:22573303-22573325 ATTTCAATGAATTAGGAGGCCGG - Intergenic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1172910384 20:38404751-38404773 ATGAATATGAATCAAAGGGCTGG + Intergenic
1175142373 20:56870530-56870552 ATGCATCTGCATTAAGGGGCAGG + Intergenic
1177485957 21:21756365-21756387 CTGCATATGAGTCAAGAGGCTGG + Intergenic
1181942720 22:26491073-26491095 ATCTATCTGAATAAAGGGGCTGG + Intronic
1182861667 22:33565213-33565235 ATGTATCTGAATTAAGGGAGAGG + Intronic
1183759268 22:39800656-39800678 ATGTAAATGAATCCAAAGGCAGG - Intronic
1183881919 22:40839852-40839874 ATATATATAAAAAAAGAGGCTGG + Intronic
950136875 3:10587334-10587356 ATGTATATATATAAAGAGACAGG + Intronic
952614528 3:35253904-35253926 ATGTACAAGAATTAAAAAGCAGG + Intergenic
953110507 3:39933041-39933063 ATCTAGATGAATTTAGATGCAGG + Intronic
953652028 3:44814773-44814795 ATGTTAAAGAATTAAGTGGCGGG - Intronic
954533141 3:51338042-51338064 GGGTATATGAATTAAGTGGAAGG - Intronic
955285864 3:57640883-57640905 AAGTATATGAATTCTGAGGTTGG - Intronic
955765595 3:62340917-62340939 ATGTACTTTAATTAAGAGTCTGG - Intergenic
957442733 3:80271458-80271480 ATGTATGTGCATATAGAGGCAGG + Intergenic
958872414 3:99576406-99576428 ATTTATATAAATTATCAGGCAGG + Intergenic
959138845 3:102459243-102459265 ATGCATATAAATTAACAGACGGG - Intronic
959223138 3:103548101-103548123 AGGTGTATGCATTTAGAGGCAGG - Intergenic
959824632 3:110779018-110779040 ATGTTTAGGAATTAAAAAGCAGG + Intergenic
962132123 3:132691927-132691949 CTGTATATGTATTAAGAGTTTGG - Intronic
962236757 3:133713490-133713512 ATGTCTAGGAATGTAGAGGCAGG + Intergenic
962400387 3:135053984-135054006 ATGTATATATATTTAGAGACAGG - Intronic
964056448 3:152466230-152466252 ATGCATATGATCTATGAGGCAGG + Intergenic
964128391 3:153260782-153260804 ATGTATTTAAATTATGTGGCAGG - Intergenic
965365486 3:167793745-167793767 ATGTATATAATTTTAGAGACAGG - Intronic
966229231 3:177632735-177632757 GTGATTAAGAATTAAGAGGCCGG + Intergenic
966705933 3:182913619-182913641 AATTATATAAATTAAGAAGCTGG - Intronic
967270713 3:187729809-187729831 CTGTACATGGAATAAGAGGCTGG + Exonic
967387305 3:188924329-188924351 ATGTGTATGAGAAAAGAGGCAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967652198 3:191999972-191999994 ATTTATATTTATTTAGAGGCAGG - Intergenic
970256784 4:14176457-14176479 ATGTGTATGCATGCAGAGGCAGG - Intergenic
971457143 4:26855814-26855836 ATGTCTGTGAATTATGAGGCAGG - Intergenic
971596150 4:28531464-28531486 ATGTATATGAATTAAATAGATGG + Intergenic
971661806 4:29427761-29427783 ATATATATGTATTTAGAGGCAGG + Intergenic
972442304 4:39106602-39106624 ATGAATTTGAATTAACAGGGGGG + Intronic
973067540 4:45815723-45815745 TTTTCTATGAATTAAGAGCCTGG + Intergenic
973274144 4:48291298-48291320 ATTTAGATGAATTCAGAGACAGG - Intergenic
973870468 4:55161027-55161049 ATGTATAGGAAAAAAGAGCCAGG - Intergenic
974599065 4:64053010-64053032 ATGTATATGTATGTATAGGCCGG - Intergenic
979394846 4:120175067-120175089 ATGTTGATGAAATAAAAGGCTGG - Intergenic
980030417 4:127822836-127822858 ATGTATATGATTTTAGAGACAGG + Exonic
980219555 4:129898211-129898233 AGGTATTTGAATCAAGAGGGTGG - Intergenic
982323686 4:154107603-154107625 GTGTATATGAGTTAAGTGGATGG + Intergenic
982536205 4:156609279-156609301 GGGTATATGTACTAAGAGGCAGG - Intergenic
983732914 4:171019774-171019796 ATGTATATGAAGTAACATTCAGG - Intergenic
983967026 4:173824692-173824714 ATGGCTATTTATTAAGAGGCTGG - Intergenic
984103823 4:175519132-175519154 ATGTATATGTATATAGTGGCAGG + Intergenic
984798843 4:183693500-183693522 ATTTAAAAGAAATAAGAGGCTGG - Intronic
987453075 5:18110367-18110389 ATTTATAAGTATTAACAGGCAGG + Intergenic
988382886 5:30521558-30521580 ATGTATGTGAATCAAAAGACAGG + Intergenic
988845258 5:35120976-35120998 ATTTATATAAATAAACAGGCTGG + Intronic
990206175 5:53431911-53431933 ATGCTTATGAATCAGGAGGCAGG + Intergenic
990748894 5:58990384-58990406 ATGGATATGAAGAAAGAAGCAGG + Intronic
991389071 5:66123045-66123067 ATGCATATAACTGAAGAGGCTGG + Intergenic
991405337 5:66295659-66295681 ATATATAAGAATTATTAGGCTGG + Intergenic
992784866 5:80159916-80159938 AAGAATATGAATAAACAGGCAGG - Intronic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
996955059 5:129173303-129173325 ATGAAAATGCATTCAGAGGCTGG - Intergenic
997369692 5:133350642-133350664 ATGTAAAAGAATACAGAGGCGGG + Intronic
998226125 5:140327732-140327754 ATAGCTATGCATTAAGAGGCTGG - Intergenic
1000263612 5:159613976-159613998 ATGTGATAGAATTAAGAGGCAGG + Intergenic
1002910008 6:1482889-1482911 ATGTATGTGCATTCAGAGACAGG - Intergenic
1003096095 6:3144686-3144708 AGAGATATGAATAAAGAGGCTGG - Intronic
1003435346 6:6082987-6083009 ATCTAAAAGAATTAAGAGGTGGG - Intergenic
1004337769 6:14780037-14780059 ATGTAACAGTATTAAGAGGCGGG + Intergenic
1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG + Intronic
1006285464 6:33090384-33090406 AATTATGTGAATTAAGAGGATGG + Intergenic
1006291915 6:33144523-33144545 AAGTACATGAATTAACATGCAGG - Intergenic
1006909091 6:37552428-37552450 TTGTTTATGAATTTTGAGGCTGG + Intergenic
1007046176 6:38776512-38776534 ATGTATATTAAAAATGAGGCTGG - Intronic
1007699691 6:43759351-43759373 ATGCATATGTATTATGAGGAAGG - Intergenic
1008398715 6:51038857-51038879 ATATATATGAATGAAGTGGTAGG + Intergenic
1008875107 6:56317541-56317563 TGGTCAATGAATTAAGAGGCTGG - Intronic
1009771504 6:68148548-68148570 ATGTATTTAAATAAGGAGGCAGG - Intergenic
1010088106 6:71945337-71945359 ATGGATATGATCTAAAAGGCAGG + Intronic
1010160758 6:72851676-72851698 ATGTAAATGAATGTAGAGGGTGG - Intronic
1010985931 6:82424035-82424057 TTAAATATTAATTAAGAGGCTGG - Intergenic
1011304595 6:85912130-85912152 AGGTATAGTAATTAAGAGGATGG - Intergenic
1011375746 6:86684878-86684900 ATGTAAAAGTATTAAGAGGTGGG + Intergenic
1012083923 6:94798581-94798603 AATTTTATGAATTGAGAGGCTGG + Intergenic
1012244913 6:96915226-96915248 GTGGATATGAGTTAAGAAGCAGG - Intergenic
1012760855 6:103298599-103298621 ATGTGATTGTATTAAGAGGCGGG + Intergenic
1013761160 6:113520039-113520061 ATGTATTTGAATTAATTGTCAGG - Intergenic
1014102176 6:117523502-117523524 ATGTATATGATGTAATACGCTGG - Intronic
1014619798 6:123652861-123652883 ATCTATACGTATAAAGAGGCTGG - Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015397794 6:132754481-132754503 ATAAATATTAATTAAGAGGAGGG - Intronic
1016159970 6:140867410-140867432 ATATATATGAAGAAATAGGCAGG + Intergenic
1016519574 6:144931448-144931470 TTACATGTGAATTAAGAGGCAGG + Intergenic
1019745016 7:2694967-2694989 ATATATATAAAATAATAGGCCGG - Intronic
1020905592 7:14060553-14060575 ATGTATATGCTTAATGAGGCTGG + Intergenic
1021847632 7:24778397-24778419 ATGTATTTGTATTAAGAGACAGG + Intergenic
1022263051 7:28725742-28725764 ATGTATATGAATAAATACTCAGG + Intronic
1023838809 7:44084079-44084101 AGGTAGATGAATTAGGAGGCTGG - Intergenic
1025025024 7:55509513-55509535 ATGTATTAGTATTAAGAGGTGGG - Intronic
1025075380 7:55937905-55937927 AAAAATAAGAATTAAGAGGCCGG + Intronic
1025251902 7:57357070-57357092 ATTTTTAAGAAATAAGAGGCCGG + Intergenic
1027793824 7:82666928-82666950 ATGTATATGAAATAAGTAACTGG + Intergenic
1027870920 7:83706978-83707000 ATTTAAATGAATTAGGATGCTGG + Intergenic
1028246317 7:88482724-88482746 ATGTATATGTATTGAGAGAGAGG + Intergenic
1028636934 7:92999599-92999621 ATGTGAATGAATGAACAGGCTGG - Intergenic
1030350003 7:108473986-108474008 ATATATATAAAATAATAGGCTGG - Intronic
1031370236 7:120956838-120956860 AGCTATATGAATTAAAAAGCAGG - Intronic
1031774313 7:125887882-125887904 AAATATAAGAATTAAGAGACAGG + Intergenic
1034015607 7:147581893-147581915 ATTTATATGTATAAATAGGCAGG - Intronic
1034984782 7:155503152-155503174 ATGTAAATGACTTAACGGGCTGG - Intronic
1035946285 8:3966905-3966927 ATGCCGATGAATTAAAAGGCTGG + Intronic
1037229981 8:16646403-16646425 ATGAAGATCAATTAAGAGCCAGG + Intergenic
1037635608 8:20699103-20699125 AGGTATATGAATTATGCGGGTGG - Intergenic
1039351359 8:36767080-36767102 TTCTATAAGAATTCAGAGGCTGG - Intergenic
1040858004 8:51970258-51970280 ATGTATGTGCATTATGAGGTGGG + Intergenic
1042219482 8:66459556-66459578 ATGATTAGTAATTAAGAGGCCGG - Intronic
1042411474 8:68471225-68471247 ATTTATGTGAGTTAAGAGGATGG + Intronic
1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG + Intergenic
1044043699 8:87402408-87402430 ATGTACATTAATCCAGAGGCAGG - Intronic
1044698617 8:94947945-94947967 ATGTATTTCAATTACCAGGCTGG + Intronic
1044933490 8:97272152-97272174 ATGTAGCTGAATTTAGAGACAGG + Intergenic
1045540380 8:103078725-103078747 CCGTAAATGACTTAAGAGGCAGG - Intergenic
1045844137 8:106613693-106613715 ATGTATAGGACATAACAGGCTGG - Intronic
1048129694 8:131681055-131681077 ATTTATATTAATTGAGAGGCAGG - Intergenic
1050035594 9:1432718-1432740 ATATATATGAAAAAAGTGGCTGG + Intergenic
1051011262 9:12417074-12417096 ATGTATATAAAGTAGGAGACTGG - Intergenic
1056223124 9:84469346-84469368 ATGTATATGTATTTAGAGACAGG + Intergenic
1056733876 9:89188064-89188086 ATATACATAAATTTAGAGGCAGG - Intergenic
1056769683 9:89467824-89467846 ATTTATAAGAATCATGAGGCTGG - Intronic
1058911064 9:109520451-109520473 AAGTATATGAATTGAGAGTTTGG + Intergenic
1060672029 9:125478331-125478353 ATATATATAAATTTAGAGACAGG + Intronic
1061093086 9:128437746-128437768 ATGTATATATATAAAGTGGCAGG - Intergenic
1062505340 9:136871514-136871536 ATTTATAAGAATTAATTGGCTGG - Intronic
1062559070 9:137131232-137131254 AAAAATATGAATTAAAAGGCCGG + Intergenic
1186096161 X:6104831-6104853 ATGTATATGGAGTTAGAGGTAGG + Intronic
1186536024 X:10349395-10349417 ATGTGTATGTATTCAGATGCTGG - Intergenic
1186928747 X:14363855-14363877 ATGTATATGAAGTATGATGTAGG + Intergenic
1187450770 X:19394078-19394100 AAGTATATTTATTAAGAGCCAGG - Intronic
1187525340 X:20048914-20048936 ATGTATATGTATTTAAAGACAGG - Intronic
1189485970 X:41432142-41432164 TTTTAAATGAATTAATAGGCTGG - Intergenic
1193936226 X:87625525-87625547 ATTTATATAACTTTAGAGGCTGG - Intronic
1194541792 X:95182175-95182197 TTTTTTATGAATAAAGAGGCTGG + Intergenic
1195219378 X:102731920-102731942 AGGCATATGCATTAAGAGACAGG - Intronic
1197332208 X:125167559-125167581 ATGTTTATGAATTAACAAGAAGG - Intergenic
1197772762 X:130099928-130099950 AAGAAAATGTATTAAGAGGCAGG - Intronic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1201966053 Y:19737129-19737151 ATGTCTATAAATTAAGACTCGGG + Intronic