ID: 1150565285

View in Genome Browser
Species Human (GRCh38)
Location 17:66333610-66333632
Sequence CTGTGCTTGTGAAGGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150565275_1150565285 -5 Left 1150565275 17:66333592-66333614 CCTCTTATTCCCCATGCCCTGTG 0: 1
1: 0
2: 3
3: 24
4: 295
Right 1150565285 17:66333610-66333632 CTGTGCTTGTGAAGGGGTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150565285 Original CRISPR CTGTGCTTGTGAAGGGGTCT GGG Intronic
900157961 1:1211129-1211151 CTGTGGCTGGAAAGGGGTCTTGG - Intergenic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900270536 1:1785040-1785062 CTATGCCTGGGGAGGGGTCTGGG + Intergenic
900680347 1:3912931-3912953 CTGTGATTGTGAGGTGGCCTTGG - Intergenic
901810644 1:11765310-11765332 CTGTGCCTGTGGAGTGGGCTTGG + Intronic
903797016 1:25936978-25937000 CTTTGCCTGTGAAGGGCTGTAGG + Intergenic
903819629 1:26092092-26092114 CTGTGCATGTGTAGGGGCCAGGG + Intergenic
904176399 1:28632675-28632697 CAGTGGTTGTTAAGGAGTCTGGG + Intronic
904296428 1:29522287-29522309 CTGTGCCTGTGAAGGGGGCTGGG + Intergenic
904409900 1:30319147-30319169 CTGTGCCCGTGAAGGGGGCCGGG - Intergenic
905347181 1:37319105-37319127 GTGTGCGTGTGTATGGGTCTGGG + Intergenic
905567019 1:38973705-38973727 CTGTGCCTTGGTAGGGGTCTTGG - Intergenic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906551816 1:46671742-46671764 CAGTGCTTGTGAAGTGGTCCTGG - Intronic
909415261 1:75399191-75399213 CTGTGCTTGATTATGGGTCTAGG - Intronic
910093504 1:83493420-83493442 CTGGGCATGTTAAGGGGGCTGGG - Intergenic
912488000 1:110044105-110044127 ATGTGCTAGTGAAGGGGGATAGG + Intronic
913645299 1:120849227-120849249 TTTTGCTTGAGAAGGGGTCTCGG - Intergenic
914081427 1:144414314-144414336 TTTTGCTTGAGAAGGTGTCTCGG + Intergenic
914176337 1:145282851-145282873 TTTTGCTTGAGAAGGTGTCTCGG + Intergenic
914531064 1:148524337-148524359 TTTTGCTTGAGAAGGTGTCTCGG + Intergenic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
918042741 1:180923111-180923133 CTGGGCTTGTGAAGGTTTCTGGG - Intronic
918080968 1:181207358-181207380 CTGTGGGTTTGAAGGTGTCTTGG + Intergenic
918693081 1:187507078-187507100 CTGTTCTTCTGAAAGGGTCTTGG + Intergenic
920709306 1:208279929-208279951 TTTTGGTTGTTAAGGGGTCTGGG + Intergenic
922626264 1:227046727-227046749 CATTGCTTGAGAAGGGGTATGGG + Intronic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
924900468 1:248392870-248392892 CTGTGCATGGGAAGGAGTGTAGG + Intergenic
1063118106 10:3085571-3085593 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118116 10:3085595-3085617 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118126 10:3085619-3085641 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118136 10:3085643-3085665 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063118146 10:3085667-3085689 CTGTGCTGGGGAAGGGGTGGGGG - Intronic
1063715931 10:8527106-8527128 CTGGGCTTGGGAAGGTGTGTAGG + Intergenic
1065259271 10:23907972-23907994 CTTTGCTTGAGATGGGGGCTTGG + Intronic
1067082767 10:43221015-43221037 CAGTGCTTCTGCAGGTGTCTTGG - Intronic
1067085709 10:43237181-43237203 GTGGCCTTGTGAGGGGGTCTTGG + Intronic
1067285211 10:44902952-44902974 CTGTGCTCTTCAAGGGGTGTAGG - Intergenic
1067552641 10:47246319-47246341 CTGTGTTTGGGAAGGGAGCTGGG + Intergenic
1069534858 10:69245727-69245749 CTGTGCTTGTGAGATGGGCTTGG - Intronic
1070639611 10:78158273-78158295 CTGAGCTTGAGAAGGGGTTCAGG + Intergenic
1070831443 10:79420289-79420311 CTGTGCTTTCTCAGGGGTCTTGG - Intronic
1073207449 10:101776342-101776364 CTGGGCTAGGGGAGGGGTCTGGG + Intronic
1073811881 10:107161322-107161344 CTGTGGTCCTGAATGGGTCTGGG + Intronic
1073907437 10:108299111-108299133 CTGTTTTAGAGAAGGGGTCTGGG + Intergenic
1074713004 10:116193003-116193025 CTGTGTGTGTGGAGGGGCCTGGG - Intronic
1075798417 10:125136800-125136822 CTGTGCTAGTGAAGCTGTTTTGG - Intronic
1077025863 11:439563-439585 CTGTGCATGGGAAGGTGTTTGGG + Intronic
1078184127 11:9037243-9037265 CTGTGATAGTGAAGTGTTCTGGG - Intronic
1078374748 11:10784443-10784465 CTGCGTTTGTGAAGGGGACCTGG - Intergenic
1079099776 11:17533919-17533941 CGGGGCTTGTGCAGGGGCCTGGG - Intronic
1079130942 11:17746579-17746601 CTGTGCTTGTGGAAAGTTCTAGG + Intronic
1079362966 11:19784936-19784958 CTGTGCCTGGGAAGGGGTTGAGG + Intronic
1079372696 11:19865015-19865037 CAGTGTTTTTGAAGGGGGCTGGG - Intronic
1080531512 11:33181019-33181041 CTGTGCTGGTGATGGAGACTAGG - Intergenic
1080576786 11:33607104-33607126 CTGTGTGTGTGAGGGGGTCGGGG - Intronic
1080749064 11:35136090-35136112 CTGTGGTTGGGATGGGGCCTGGG + Intergenic
1083533588 11:63448109-63448131 CTGGGCTTGGAAAGGGGTGTGGG - Intergenic
1083698440 11:64457915-64457937 CTGGCCAGGTGAAGGGGTCTGGG - Intergenic
1083929471 11:65832966-65832988 CAGGGCCTATGAAGGGGTCTGGG - Intronic
1084097601 11:66922017-66922039 CTGTGCTTGTGAATGAGGGTAGG + Intronic
1084105251 11:66976513-66976535 CTGGGCTTGGGTAGGGGCCTTGG + Exonic
1084478714 11:69404125-69404147 CTGGGCTTGTGGGGGGGCCTCGG - Intergenic
1087749476 11:101990825-101990847 CTGTACTTATTCAGGGGTCTTGG - Intronic
1088704388 11:112448318-112448340 CTGTGCTCTTGAAGGGGGCCAGG - Intergenic
1090359107 11:126160433-126160455 CTGTGTTTGTGCAGGGGTGGAGG + Intergenic
1090632595 11:128663106-128663128 ATGTGCTTGTAAAAAGGTCTGGG - Intergenic
1090638412 11:128708402-128708424 CTTTGCTGGTGAAGCTGTCTAGG + Intronic
1093472275 12:19515279-19515301 CTGTGCTTATGAAGGTATGTGGG + Intronic
1097288326 12:57894471-57894493 CTGTGCTTGTGAATGGCTGAGGG + Intergenic
1099304345 12:80936729-80936751 CTGAGCTTGTGAGGGCGTCCTGG + Intronic
1099752126 12:86788850-86788872 CTGTGCTTGGAAAGGATTCTTGG + Intronic
1100807402 12:98300832-98300854 CTGTCCTTGTGAAGATATCTTGG - Intergenic
1104837970 12:131804159-131804181 CTGTGAGTGAGAAGGGGGCTAGG + Intergenic
1105446454 13:20461847-20461869 CTGTGCTTGGGAAGATGGCTTGG - Intronic
1105531346 13:21223499-21223521 CGGTGATTGCTAAGGGGTCTTGG + Intergenic
1106000657 13:25719991-25720013 CTGTGCTGGTGTCTGGGTCTTGG + Intronic
1106624744 13:31409105-31409127 CTATGCTTGTGCAGAGGTTTGGG - Intergenic
1107310057 13:39067300-39067322 CAGTGCTTGGGTAGGGGTATGGG + Intergenic
1109325914 13:60867937-60867959 CACTGCATGTGAATGGGTCTTGG + Intergenic
1111790812 13:92852286-92852308 CTGTGGTTGTGTTGGGGTTTGGG + Intronic
1112841827 13:103588823-103588845 CTATGATTTTGAAGAGGTCTGGG + Intergenic
1113366731 13:109683329-109683351 CTGTGCTTGTGATGGGGTGTGGG - Intergenic
1114227192 14:20749624-20749646 CTGCATTTGTGAAGGGGTCCAGG - Intergenic
1114316617 14:21515507-21515529 CTATGTTTGAGATGGGGTCTCGG - Intergenic
1119001144 14:70883215-70883237 CGTTGCTAGTGAATGGGTCTGGG + Intergenic
1119199771 14:72743744-72743766 CTGTCCTTGTGAAGGGGGAGTGG - Intronic
1119886000 14:78142850-78142872 ATGCGCTTGTGCAGGAGTCTGGG + Intergenic
1121042514 14:90760646-90760668 CTGGGCTAGTGAAGGGGTGGAGG - Intronic
1121234811 14:92384473-92384495 CTGTGCTTGAGATGGGGGGTGGG + Intronic
1121343929 14:93121326-93121348 TTGTGCTTGTCAAGGAGTTTTGG - Intergenic
1123000705 14:105292754-105292776 CTGCGCCTGGGAAGGGGTGTGGG - Intronic
1124026726 15:25973781-25973803 CTGTGATGAAGAAGGGGTCTTGG + Intergenic
1124195206 15:27619415-27619437 CTGTGCCTGTGCCGGGGGCTGGG - Intergenic
1124236618 15:27994472-27994494 CTGTGCCTGGGAAGTGGTTTGGG - Intronic
1127398686 15:58564266-58564288 GTGGGCTTGGGAAGGGGTCCAGG + Intronic
1127689086 15:61377002-61377024 TTATGCTTGAGAAGGGGACTTGG + Intergenic
1128114190 15:65095069-65095091 CAGTGCTGGAGAAGGGGTGTGGG + Intronic
1128372262 15:67049074-67049096 CTGGGCTTGAGATGGGGTGTGGG - Intergenic
1130098997 15:80877724-80877746 CTGTGCTTCTGCAGAGGTCAGGG + Intronic
1130929429 15:88412407-88412429 CAGTGGTTGTGGAGAGGTCTTGG - Intergenic
1137291644 16:47055628-47055650 CTGTGCTCTTGAAGGGGGCCCGG - Intergenic
1137669839 16:50272588-50272610 ATGTGCTTGTGAATGGGGCAGGG - Intronic
1138413042 16:56854664-56854686 CTGTGTTGGGGAAGGGGTTTGGG - Intergenic
1138686768 16:58733515-58733537 CTTTGCTTGGGAAAGGGTCGAGG - Intronic
1141304933 16:82853718-82853740 CTGTGCTTTCAAAGGTGTCTTGG + Intronic
1141642713 16:85350571-85350593 GTGTGCTGGGGAAGGCGTCTTGG - Intergenic
1142355397 16:89599279-89599301 CTGTGCAGGTCAGGGGGTCTCGG + Intergenic
1142409753 16:89910003-89910025 CTGTGCGGGTGACGGGGCCTGGG - Intronic
1143390250 17:6555920-6555942 CTGAGCTGGTGACGGGGGCTGGG + Intronic
1145002062 17:19312589-19312611 CTGTGGTGTAGAAGGGGTCTGGG - Intronic
1147631736 17:41936583-41936605 GTGTGCCTGAGAAGGGGTCTTGG + Intronic
1149520170 17:57312708-57312730 CTTTGCTTGTGAAGGATTTTAGG + Intronic
1149929678 17:60738766-60738788 TTTTTCTTGTGAAAGGGTCTTGG + Intronic
1150565285 17:66333610-66333632 CTGTGCTTGTGAAGGGGTCTGGG + Intronic
1150570159 17:66378497-66378519 CAGTGATTGCTAAGGGGTCTGGG - Intronic
1150640402 17:66945856-66945878 CGGGGATTGGGAAGGGGTCTAGG + Intergenic
1151364362 17:73607511-73607533 CTGAGCCAGGGAAGGGGTCTCGG + Intronic
1151915597 17:77115562-77115584 CTGTGGCTGTGAAGGGGTGGAGG + Intronic
1155397465 18:25401971-25401993 CTCTGCATATGAAGGGTTCTAGG - Intergenic
1155629166 18:27871890-27871912 CTCTGCTTGGGAGTGGGTCTCGG + Intergenic
1156200897 18:34830417-34830439 GTATGCTTGTGAAGGGCCCTAGG - Intronic
1156331112 18:36124221-36124243 CACTGCTTGGGAAGAGGTCTTGG - Intronic
1156385722 18:36603366-36603388 GTGTGCTTGTGAAGGCCTGTGGG + Intronic
1157747024 18:50144857-50144879 CTGTGCATGTGAAGTGATCTGGG - Intronic
1161356853 19:3823873-3823895 CTGTGCGTGGGCAGGGGTCGAGG - Intronic
1162472864 19:10882888-10882910 CTCTGCTGGGGAAGTGGTCTAGG + Intronic
1162544986 19:11323849-11323871 CTGGTCCTGTGAAGGGGTGTTGG + Exonic
1165428192 19:35756976-35756998 CTGTGCCTGTGCAGCCGTCTTGG - Exonic
1165830282 19:38727283-38727305 CTGTGCGTGTGAAGTGGCCCAGG - Intronic
1167319820 19:48790160-48790182 TTGAGAATGTGAAGGGGTCTTGG - Intergenic
926366889 2:12141436-12141458 GTGTGTTTGTGAAGGGGGTTGGG + Intergenic
927554012 2:24020078-24020100 CTGTCCTGGTGAGGGGGCCTGGG + Intronic
927554481 2:24022509-24022531 CTGTCCTGGTGAGGGGGCCTGGG + Exonic
928687577 2:33764722-33764744 CTGGGCTTTTGATGGGGTCATGG + Intergenic
929705061 2:44201916-44201938 CTTGGCTTGTGATGGGATCTGGG + Exonic
930180558 2:48351626-48351648 CTGTGCATGTGAGGGGATCTAGG - Intronic
931744450 2:65279975-65279997 CTGTTCTTGTGAAGGGCTTGGGG + Intergenic
933321345 2:80779324-80779346 CTTTTCTTGTGAAGGGGAATGGG + Intergenic
933981142 2:87551957-87551979 CTGTGCCTGGGAAGGGGTGTTGG + Intergenic
934563639 2:95326581-95326603 CTGTGCTTGTGAATGGCGGTGGG + Intronic
936312691 2:111398842-111398864 CTGTGCCTGGGAAGGGGTGTTGG - Intergenic
936933270 2:117812275-117812297 CTAGCCTTGGGAAGGGGTCTGGG - Intergenic
937381069 2:121376822-121376844 CTGTGCATGCGAGGGGATCTAGG + Intronic
938340127 2:130530350-130530372 CTGGGGTTCTGAAGGGGTCCAGG - Intergenic
938349709 2:130590398-130590420 CTGGGGTTCTGAAGGGGTCCAGG + Intergenic
942123355 2:172800437-172800459 CTGGCCTTGTGATGGGCTCTGGG + Intronic
945354454 2:208822287-208822309 CTGTGATTGTGAAGCTCTCTGGG + Intronic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
948438602 2:237970601-237970623 CAGTGCTTCTTAAGGGGTTTAGG + Intronic
948931500 2:241135156-241135178 CTGTGCATATGAAAGGGACTCGG + Intronic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1173393877 20:42660092-42660114 TTGTGCTTATAAAGGGCTCTAGG + Intronic
1173727204 20:45306515-45306537 TTGTGTGTGTGGAGGGGTCTGGG - Intronic
1174087191 20:48017857-48017879 CTGGGCTTATGGAGGGGACTGGG + Intergenic
1174375031 20:50120901-50120923 CTGTTCTTTAGAAGGGGCCTGGG - Intronic
1175796687 20:61775659-61775681 CTGTGCCTGTGAGGGTGGCTTGG - Intronic
1176429650 21:6567915-6567937 CTGTGACTCTGAAGGGGTCTTGG - Intergenic
1177189875 21:17839039-17839061 CTGTGTTTCTCAAGGGGTATCGG + Intergenic
1179705044 21:43175377-43175399 CTGTGACTCTGAAGGGGTCTTGG - Intergenic
1179722392 21:43323111-43323133 CTGTGCGTGGGAAGGGCTCTTGG + Intergenic
1179929136 21:44555671-44555693 CCCTGCTTGTGAAGGGGGGTGGG - Intronic
1180023957 21:45148066-45148088 CTTAGCTTGTGACGGGGGCTGGG - Intronic
1181485602 22:23229820-23229842 CTGTGCTGGTGAAGGGGGCAGGG + Intronic
1183752702 22:39731068-39731090 CTGTGCTAGGGGAGGGGGCTGGG + Intergenic
1183759660 22:39804729-39804751 CTGTGCTTGGGGAAGGGCCTTGG - Intronic
1183808670 22:40235533-40235555 CTCTAATTGTGAAGGAGTCTTGG + Intronic
1184805453 22:46792451-46792473 CTGAGCTGGTGGAGGGCTCTTGG + Intronic
1184810081 22:46825328-46825350 CTGTGCTGGTGAGGGGAGCTGGG - Intronic
1185110545 22:48897917-48897939 CTGTGCTTGGGCAGGGGTGGAGG - Intergenic
949706246 3:6820730-6820752 CTGTGCTTGTGTGTGTGTCTTGG - Intronic
949951245 3:9230541-9230563 CTGTGCTTGGGAACTGGTGTGGG + Intronic
950127290 3:10517727-10517749 CTGTGCATGTGCAAGGCTCTGGG - Intronic
952474001 3:33686457-33686479 CTGTGCATGCGAGGGGATCTAGG + Intronic
954097936 3:48345756-48345778 CTGTGGTTTTGAAGAAGTCTAGG + Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
956733982 3:72222498-72222520 CTGTGCATGCGAGGGGATCTAGG - Intergenic
960417215 3:117399254-117399276 CACTCCTTGTGAAGGGCTCTAGG + Intergenic
960936931 3:122910192-122910214 CTGTGTTTGTTCAGGGGGCTTGG + Exonic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
961450665 3:127000955-127000977 CTGTGTGTGTGAAGGGGTGGAGG + Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
964791939 3:160460702-160460724 CTGTGCTCTTGGAGGGGGCTGGG - Intronic
965541966 3:169879916-169879938 CTGTGCTCTTGGAGGGGGCTAGG + Intergenic
969347845 4:6580435-6580457 GTGGGCTTGTGAAGGGGTGTGGG - Intronic
969689265 4:8695158-8695180 CTCTGGTTGTGAAGTGGTCCAGG + Intergenic
970955579 4:21807095-21807117 CTGTGCATGTGAAGGGCTCTAGG - Intronic
973259527 4:48148078-48148100 CTGGGCTGGTGAAGGGGGATGGG + Intronic
978481485 4:109196058-109196080 CTTTGCTAGTGTAGTGGTCTTGG + Intronic
979011080 4:115369527-115369549 ATGTGCTTGTTAATGAGTCTTGG + Intergenic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
981920549 4:150079888-150079910 CTGTGGTTGTGAAATGCTCTAGG + Intronic
982109884 4:152044232-152044254 CTTTCCTTCTGAAGGGATCTTGG - Intergenic
985549785 5:527148-527170 GTGTGTGTGTGAGGGGGTCTTGG + Intergenic
987582465 5:19811809-19811831 CTGTGTGTGTGAAGGATTCTAGG - Intronic
988435369 5:31168144-31168166 CTGTGTGTGTGAAGGGGTGGGGG - Intergenic
988803098 5:34715128-34715150 TTGTGCGTGTGAGGGGGTTTGGG + Intronic
990427540 5:55701990-55702012 CTGTACTTGTTAAGTAGTCTGGG - Intronic
997516135 5:134491203-134491225 CTGTGGGTGAGAAGGGGGCTAGG - Intergenic
998252588 5:140562784-140562806 CTGTGCTTATCAAGTTGTCTAGG - Intronic
1002608483 5:180398079-180398101 CAGTGTTGGAGAAGGGGTCTAGG + Intergenic
1003076924 6:2990300-2990322 CTGTCTTTTTGAAGGGGTCACGG - Intronic
1003110752 6:3250380-3250402 CTGTGCTTGTGAAGGGTGAGTGG + Intronic
1003143990 6:3494288-3494310 CTGAGCCTGTGAAAGGGGCTGGG - Intergenic
1004430480 6:15538187-15538209 CTAGGCTTGTGAAGGGCACTGGG + Intronic
1006368071 6:33627694-33627716 CTGTGGTGGTGGAGGGGTATAGG + Intronic
1007177527 6:39906957-39906979 CTGGGCTAGAGGAGGGGTCTGGG + Exonic
1007418768 6:41706958-41706980 CTCTGCATGTGATGGGGTCGGGG + Intronic
1008449778 6:51637049-51637071 CTGTGATTTTGAACTGGTCTTGG - Intronic
1010022579 6:71177856-71177878 GTGTGCTTGTGTAGGGGTGGGGG - Intergenic
1011955042 6:93016079-93016101 CTTTGCATGTGAAGGGGTGGTGG - Intergenic
1013633208 6:112005157-112005179 CTGTACAAGTGAAGGGGCCTGGG - Intergenic
1017008333 6:150044203-150044225 CTGCGCTTCTCAAGGGCTCTGGG + Intergenic
1017013335 6:150079914-150079936 CTCTGGTTGTAAAGGAGTCTGGG + Intergenic
1019541037 7:1551102-1551124 CTGGGCTTGTGCAGGGGTACCGG - Intronic
1021804206 7:24339111-24339133 CTGAGCTTCTGCTGGGGTCTAGG + Intergenic
1022281801 7:28918530-28918552 CTGTGCCTGGGAGGGGGACTGGG + Intergenic
1024636360 7:51293850-51293872 CTATGCTTGGTAAGGGGTCCTGG + Intronic
1027302605 7:76856468-76856490 TGGGGCTTGGGAAGGGGTCTAGG + Intergenic
1028798907 7:94938226-94938248 CTCTGCATGTGGAGGGATCTAGG + Intronic
1033104647 7:138509921-138509943 CTTGGCTGGTGATGGGGTCTGGG + Intronic
1034411150 7:150942831-150942853 CTGTGCTCAGGATGGGGTCTGGG - Intergenic
1034430318 7:151038027-151038049 CTGTGATAGAGATGGGGTCTTGG + Intronic
1034430330 7:151038097-151038119 CTGTGATAGAGATGGGGTCTTGG + Intronic
1034586161 7:152094343-152094365 ATGTGCCCGTCAAGGGGTCTGGG + Exonic
1034892545 7:154854031-154854053 CAGCACTTGTGAAGGGGTGTGGG - Intronic
1035113366 7:156503613-156503635 CTGTGTTTGAGAAAGGGACTTGG - Intergenic
1039908014 8:41800173-41800195 GGGGGCTTGTGAAGGGGTTTGGG - Intronic
1040746238 8:50645681-50645703 GTGTGCTTATGAAGGGCTCGTGG + Intronic
1045350911 8:101338844-101338866 CTGTGCATGTGTAGGGGTAAGGG - Intergenic
1045650355 8:104336500-104336522 CCGTGCTTGAAAAGTGGTCTTGG + Intronic
1046918165 8:119699368-119699390 CTGTCCCTGTGGAGGGGTCCTGG - Intergenic
1048209625 8:132443957-132443979 CTGTGCTTGTCCAAGGGGCTTGG - Intronic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1048990986 8:139759985-139760007 GTGTGCTGGTGCAGGGGCCTGGG - Intronic
1049236875 8:141516701-141516723 CTCTGCTTGTAGAGGGGTCGAGG - Intronic
1049381277 8:142317497-142317519 CTGTGCTTATGAAGCGGGTTCGG + Intronic
1050024379 9:1319068-1319090 GTGTGTTTGTGATGGGGTGTGGG + Intergenic
1052913450 9:33905112-33905134 CTGGGATGGTGAAGTGGTCTTGG + Intronic
1053617271 9:39781351-39781373 CTGTGCTCTTGGAGGGGGCTGGG + Intergenic
1053875454 9:42540714-42540736 CTGTGCTCTTGGAGGGGGCTGGG + Intergenic
1053897191 9:42753919-42753941 CTGTGCTCTTGGAGGGGGCTGGG - Intergenic
1054236246 9:62561010-62561032 CTGTGCTCTTGGAGGGGGCTGGG - Intergenic
1054266895 9:62926086-62926108 CTGTGCTCTTGGAGGGGGCTGGG - Intergenic
1054550388 9:66595540-66595562 CTGTGCTCTTGGAGGGGGCTGGG - Intergenic
1055576190 9:77662167-77662189 CTGTGCTTGCCAGGGGGGCTGGG - Intergenic
1056135675 9:83627558-83627580 ATGTGCTAGTGAAAGGGGCTCGG - Intronic
1057508375 9:95655941-95655963 CTATGCATGTGTAGGGGTATGGG - Intergenic
1058762561 9:108149289-108149311 CTATGTTTATGAAGGGGGCTGGG - Intergenic
1060409575 9:123391078-123391100 CTGTGATGGTGGAGGGGGCTGGG + Intronic
1060872401 9:127053271-127053293 CTGTCCTTGGGAAGGTCTCTGGG + Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061258238 9:129465192-129465214 CTCTGCTGGTGAAGGGAGCTTGG - Intergenic
1061845626 9:133386569-133386591 CTGTGCTCCTGATGGGGCCTAGG + Intronic
1185785056 X:2883873-2883895 CTGTGCATGTGAGGGGATCTAGG - Intergenic
1186082888 X:5952486-5952508 CTGTGGCTGTGAATAGGTCTCGG + Intronic
1186451940 X:9681294-9681316 CTGTGCTTGTGGGTGGGTCTTGG + Intronic
1189675046 X:43453009-43453031 TCCTGCTTGTGAAGGGGTCAGGG - Intergenic
1189739301 X:44101979-44102001 ATGTACTAGTGAAGGGGTCCAGG + Intergenic
1189746050 X:44169990-44170012 TTCTTCTTGTGAATGGGTCTGGG + Intronic
1194374509 X:93114997-93115019 CTGTGCCTGAAAAGGGGCCTTGG + Intergenic
1194966938 X:100298891-100298913 CTGTTCTACTGAAGGGATCTTGG - Intronic
1195287750 X:103401762-103401784 GTATGCTGGTTAAGGGGTCTTGG - Intergenic
1198551028 X:137744739-137744761 CTGTTTTTCTGAGGGGGTCTTGG + Intergenic
1200682533 Y:6229051-6229073 CTGTGCCTGAAAAGGGGCCTTGG + Intergenic