ID: 1150571322

View in Genome Browser
Species Human (GRCh38)
Location 17:66389503-66389525
Sequence AAAAATATGCCGGAAGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150571319_1150571322 17 Left 1150571319 17:66389463-66389485 CCTTTGCAGGGATATCGTAAGGA 0: 1
1: 0
2: 1
3: 14
4: 89
Right 1150571322 17:66389503-66389525 AAAAATATGCCGGAAGTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150571322 Original CRISPR AAAAATATGCCGGAAGTATC TGG Intronic
903698096 1:25224415-25224437 AAAAATATACAGGAATTAGCTGG - Intronic
909176185 1:72363226-72363248 AAAAATGTACAGGAAGTAGCAGG + Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
918696099 1:187548590-187548612 AATAACATGCCAGAAGTATTAGG - Intergenic
919561911 1:199131702-199131724 AAAAAAATCCCAGAAGTATTTGG - Intergenic
923602810 1:235418492-235418514 AAATGGCTGCCGGAAGTATCTGG + Intronic
1064125488 10:12656328-12656350 AAAAATATGCCAAAATTAGCTGG + Intronic
1066380017 10:34893190-34893212 AAAAATATGCAGGAAGAGCCAGG - Intergenic
1068116414 10:52741578-52741600 AAAAATATGTGGGAGGTATGGGG + Intergenic
1073518674 10:104103365-104103387 AAGAATATGCCTCAAGTCTCTGG - Intergenic
1073560667 10:104493779-104493801 AAAAAAATGCCTGATGTTTCTGG - Intergenic
1074463862 10:113665173-113665195 GAAAATATTCCGGAAAAATCAGG - Intergenic
1077858598 11:6154860-6154882 AAAAATATGACTCTAGTATCAGG + Intergenic
1079823458 11:25160648-25160670 AAAAATATACTGGAAGGAGCTGG - Intergenic
1081561007 11:44216597-44216619 AAAAACATGCTGGAAGTCTAGGG - Intronic
1095448994 12:42309741-42309763 AAAAATATGCCTCAAGTGACAGG - Intronic
1095896467 12:47285039-47285061 GCAAATATACGGGAAGTATCAGG + Intergenic
1096339958 12:50789604-50789626 AAAAATTAGCCGGAAGTAGTGGG + Intronic
1096884266 12:54700774-54700796 AGAAATATGCAGGAAGTAGAGGG + Intergenic
1098554458 12:71803001-71803023 AAATATGTGCCTGAGGTATCGGG - Intergenic
1098897574 12:76081646-76081668 ACAAATATGCAGGAAGTAAAAGG + Intronic
1100169674 12:91959836-91959858 AAAGATATGAGGGAAGGATCAGG + Intergenic
1102487996 12:113271106-113271128 AAAAATATACAGGAATTAGCTGG + Intronic
1104472829 12:129044390-129044412 CTAAACATGCCTGAAGTATCTGG - Intergenic
1104616169 12:130271099-130271121 GAAAATAAGCTGCAAGTATCTGG - Intergenic
1108873874 13:55020393-55020415 AAGAATATGACACAAGTATCTGG - Intergenic
1110265259 13:73530198-73530220 AACAATATTCCTGAAGTAACTGG - Intergenic
1110850225 13:80237159-80237181 AATAATATGCTGCAAGAATCAGG + Intergenic
1116039901 14:39673417-39673439 AAAAATATGCCTGAATTTTGTGG + Intergenic
1123498791 15:20859852-20859874 AAAAATTTTCCTGAAGTAACTGG + Intronic
1123592267 15:21870814-21870836 AAAAATTTTCCTGAAGTAACTGG + Intergenic
1126442178 15:48701388-48701410 AATAATAGCCAGGAAGTATCTGG + Intergenic
1133988390 16:10685667-10685689 TCAGATATGCCAGAAGTATCTGG - Intronic
1135238665 16:20782965-20782987 AAAAAAATCCCTGAAGTATGAGG - Intronic
1137706943 16:50542132-50542154 AAAAATAAGCAGGAAGAAGCAGG - Intergenic
1143049354 17:4111007-4111029 AAAAATATGCCGTAATTGGCTGG - Intronic
1145046281 17:19619395-19619417 AAAAGTATGCTGGAAGGATTAGG - Intergenic
1145720567 17:27067885-27067907 AAAAATATACCAGAAGTATGTGG + Intergenic
1150503144 17:65670325-65670347 AAAAATATACAGAAAGTAACAGG - Intronic
1150571322 17:66389503-66389525 AAAAATATGCCGGAAGTATCTGG + Intronic
1154235194 18:12598938-12598960 AAAAATATACAGAAATTATCAGG + Intronic
1155055711 18:22181066-22181088 AAAAAGATACCAGTAGTATCTGG + Intronic
1155922366 18:31616173-31616195 AAAAACATGCTGTAAGTATAAGG + Intergenic
1156005657 18:32438215-32438237 AAAAATAAACCGGATTTATCTGG + Intronic
1157693379 18:49701426-49701448 AAGAAGCTGCTGGAAGTATCAGG - Intergenic
1160255113 18:77241811-77241833 GAAAATAGACCAGAAGTATCTGG + Intergenic
927981187 2:27376158-27376180 AGAAATCTGGCGGCAGTATCAGG + Exonic
928963792 2:36956971-36956993 AAAAATAGGAAGGAATTATCTGG + Intronic
932947953 2:76259502-76259524 TAAAATATGCCTGAAGTAACAGG + Intergenic
935515420 2:104030525-104030547 CAAAATATGCCAGAGGAATCAGG - Intergenic
937967429 2:127524843-127524865 AAAACTATTCTGAAAGTATCAGG + Intronic
939934003 2:148267072-148267094 AAAAACATGCAGGAGGTATGAGG + Intronic
943488475 2:188519053-188519075 AAAAAAATACAGGAAGTATAAGG + Intronic
943897041 2:193377631-193377653 AAAGATATATCGGAAGTATCCGG - Intergenic
945175108 2:207036245-207036267 AAAAATGTCCTGGAAGTCTCTGG - Intergenic
946657171 2:221960941-221960963 AAAGATATGCCTGGATTATCCGG - Intergenic
1177653073 21:23982890-23982912 AGAAGCATGCCGGAAGTATCAGG + Intergenic
953040561 3:39251929-39251951 AAAAAGAAGCAGGAGGTATCTGG - Intergenic
957547254 3:81655676-81655698 AAAAAAATACAGAAAGTATCTGG - Intronic
962560856 3:136605159-136605181 ACAAATATGCTGAACGTATCTGG + Intronic
962814109 3:138983185-138983207 AATAATATACAGGAAGTATTTGG - Intergenic
963554045 3:146763369-146763391 AAAAATAAGTTGAAAGTATCAGG + Intergenic
963924675 3:150938827-150938849 AAATATATGCAGGAATGATCAGG - Intronic
964726600 3:159820035-159820057 AAAAAACTGCCAGAAATATCTGG - Intronic
970181598 4:13402953-13402975 AAAAATATACAGAAATTATCCGG - Intronic
970747299 4:19314620-19314642 AAAAATTTGCAGAAAGTTTCTGG + Intergenic
970946175 4:21694519-21694541 AAAAATATGTAGGAAGTTTCAGG + Intronic
973119155 4:46497048-46497070 AAAAATAGGCTGGAAATTTCTGG + Intergenic
973241663 4:47962375-47962397 AATAATATGTTGGAAGTACCAGG + Intronic
973300032 4:48571263-48571285 AAAAATATGACAGAAGTATAGGG + Intronic
975099307 4:70494190-70494212 AAAAATGTGCTTGATGTATCAGG + Intergenic
978058891 4:104311517-104311539 AAAAATATGCGGGAGGTAGATGG + Intergenic
978419508 4:108515228-108515250 AAAAATATTGCAGAAGTGTCAGG - Intergenic
979484145 4:121251701-121251723 AAAAATAAGCTGGAAGTGTGGGG + Intergenic
981599066 4:146464145-146464167 AAAAAAAAGCTGGAACTATCAGG + Intronic
982441946 4:155446633-155446655 AAAAATAATCTGGAATTATCAGG - Intergenic
989300323 5:39884004-39884026 AAAGATATGCCAGAAGAATTTGG - Intergenic
990354364 5:54951332-54951354 AACAGAATGCCGGAAGTAACAGG + Intergenic
992616900 5:78553747-78553769 AAAAATCTGACGGAAGTCTGTGG - Intronic
993878941 5:93341016-93341038 AAAAATGTGCATGAAATATCTGG - Intergenic
995039282 5:107569984-107570006 AAAAGTAGGCCAGAATTATCTGG + Intronic
997146225 5:131436682-131436704 AAAAATATGACAAAAATATCAGG + Intronic
997942541 5:138171326-138171348 AGAAATATGGCTGAAGTACCTGG + Intronic
997985029 5:138494622-138494644 AAAAAAATGCAGGAAATAACAGG - Intergenic
999672100 5:153966850-153966872 AAAAATAAGTGGGAAGTCTCAGG - Intergenic
1001372646 5:171221250-171221272 TGAAATATGCCTGAAGTGTCAGG + Intronic
1002902954 6:1425068-1425090 AAAAATATGACATACGTATCTGG - Intergenic
1004141960 6:13026468-13026490 GAAAATATGTAGGAGGTATCTGG + Intronic
1004150595 6:13116071-13116093 AAAATTATACTGGAACTATCTGG + Intronic
1005411137 6:25548149-25548171 ATAAAAATCCCTGAAGTATCTGG - Intronic
1015075680 6:129154062-129154084 AAACATATCCAGAAAGTATCTGG - Intronic
1017701390 6:157075974-157075996 AAAAATATGAATGAAGTCTCTGG + Intronic
1017711765 6:157175697-157175719 AAAAATGTCACGGATGTATCAGG + Intronic
1020769790 7:12375616-12375638 AGAAATATTACAGAAGTATCTGG - Intronic
1021593300 7:22288324-22288346 AGAAATATGCAGGAAACATCTGG - Intronic
1022365595 7:29712611-29712633 AAAAATATGCCTTATGTATTAGG + Intergenic
1022695923 7:32705540-32705562 AAAAATATGCCTTATGTATTAGG - Intergenic
1023371703 7:39518438-39518460 AAAAATATGCAAAAATTATCTGG - Intergenic
1025862106 7:65339908-65339930 TTAAATAGGCCGAAAGTATCAGG - Intergenic
1028900632 7:96096541-96096563 AAAAATATAATGCAAGTATCTGG - Intronic
1029387838 7:100255489-100255511 AAAAATATACAAGAAGTAGCTGG - Intronic
1039121102 8:34147131-34147153 AAAAATATGTTAGAATTATCTGG + Intergenic
1041882591 8:62769281-62769303 AATAATATGCCCCAATTATCCGG + Intronic
1046438078 8:114220827-114220849 AAAAATATTACGGAAAAATCTGG + Intergenic
1050602425 9:7266377-7266399 AAAAATATGACTGAAGGATTGGG - Intergenic
1050666096 9:7938248-7938270 AAGAATATGCCAGTAGGATCTGG + Intergenic
1051480045 9:17549855-17549877 AAAAATATGCCCCAACTCTCTGG + Intergenic
1052295251 9:26890522-26890544 AAATATTTGTCAGAAGTATCTGG - Intronic
1055419546 9:76124448-76124470 AAAAATATGCAAGAAGTGGCCGG + Intronic
1055814329 9:80186512-80186534 AATAATATGCCGAAAGAATGGGG + Intergenic
1056426607 9:86483834-86483856 AATAACATGCTGGCAGTATCTGG - Intergenic
1060143036 9:121226917-121226939 ATAAATATCCCTGAAGTATGAGG + Intronic
1060189747 9:121584618-121584640 AAACATATGACGGAATGATCAGG + Intronic
1060239802 9:121893103-121893125 AATAATATGCATTAAGTATCAGG - Intronic
1186322165 X:8439801-8439823 AAAAATATGACGGAATTTTTTGG - Intergenic
1187953842 X:24496551-24496573 AAAAAGATGGGGGTAGTATCAGG - Intronic
1188617037 X:32170135-32170157 AAAAATATGTCAAAAGTAACAGG - Intronic
1190794678 X:53729970-53729992 AAAAATATGCAAGAACTATGAGG - Intergenic
1195901353 X:109800888-109800910 AAAAAGAAGCATGAAGTATCAGG + Intergenic
1199443432 X:147895112-147895134 AAAAATATTCAGTAACTATCTGG + Intergenic
1200920403 Y:8607930-8607952 AAAAATCTGCAGGATGTTTCAGG + Intergenic
1201186751 Y:11412474-11412496 AATAATATGCCAGAATTAACAGG - Intergenic