ID: 1150571322

View in Genome Browser
Species Human (GRCh38)
Location 17:66389503-66389525
Sequence AAAAATATGCCGGAAGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150571319_1150571322 17 Left 1150571319 17:66389463-66389485 CCTTTGCAGGGATATCGTAAGGA 0: 1
1: 0
2: 1
3: 14
4: 89
Right 1150571322 17:66389503-66389525 AAAAATATGCCGGAAGTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150571322 Original CRISPR AAAAATATGCCGGAAGTATC TGG Intronic