ID: 1150580877

View in Genome Browser
Species Human (GRCh38)
Location 17:66472882-66472904
Sequence CTCATTCACCTCCACAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150580877_1150580881 24 Left 1150580877 17:66472882-66472904 CCTAATTTGTGGAGGTGAATGAG 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1150580881 17:66472929-66472951 TTAGTCAGAGCCCTTAAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150580877 Original CRISPR CTCATTCACCTCCACAAATT AGG (reversed) Intronic
901464662 1:9413520-9413542 CTCATTCACCCCCACAAGCAAGG - Intergenic
903340254 1:22649430-22649452 CACAGTGCCCTCCACAAATTTGG + Intergenic
911977997 1:104526449-104526471 GTCATTCATCACCACAAATGTGG + Intergenic
913372842 1:118119586-118119608 GTTATTCACCTCCCCAAAATAGG - Intronic
914763382 1:150617161-150617183 TTCCTCCACCTCCTCAAATTGGG + Intronic
916365215 1:164018629-164018651 TTCATTTACCTCTCCAAATTTGG - Intergenic
917092423 1:171366786-171366808 CACATTCACCTCTATGAATTGGG + Intergenic
917561585 1:176163320-176163342 CTCATTTGCCTCCATAATTTGGG + Intronic
917715984 1:177738304-177738326 CTCATTCACATCTGCAAAATGGG + Intergenic
919106722 1:193162756-193162778 ATCATTTACCTCCCCAAATTTGG + Intronic
920329546 1:205196091-205196113 CTCACTCACCTCACCAAAGTGGG + Intronic
924108998 1:240679129-240679151 CTGATTCACCTCGATAAAGTAGG + Intergenic
924131480 1:240913667-240913689 GTCCATCACTTCCACAAATTAGG + Intronic
1063076754 10:2724341-2724363 CACATTCACATGCACACATTGGG - Intergenic
1063758058 10:9038718-9038740 CTCTTTATCCTCCTCAAATTAGG + Intergenic
1071513755 10:86283354-86283376 CTCATTCAGCTCCCCACATGTGG + Intronic
1079867419 11:25754530-25754552 CTCATTAAGCTAGACAAATTTGG + Intergenic
1080568397 11:33533571-33533593 CTTAATAACTTCCACAAATTAGG - Intergenic
1080836064 11:35942415-35942437 CTCATTTGCCTCCAAACATTAGG - Intergenic
1085376670 11:76068954-76068976 TTCATCCACCTCCACTAATGTGG - Intronic
1086999780 11:93404669-93404691 CTCATTTACTTCAACAGATTAGG - Intronic
1088190153 11:107219661-107219683 CTGATTCACCTCTCCAAATGAGG - Intergenic
1090083325 11:123629076-123629098 CTCATGCATATCCACAGATTGGG + Intergenic
1091984062 12:4893499-4893521 CTAATTCACTTTCACACATTTGG - Intergenic
1096224649 12:49858901-49858923 CCAATTCACATCCACAAATAGGG + Intergenic
1098442668 12:70534784-70534806 CTCATTCATCTCCCCAAGCTCGG + Intronic
1100957100 12:99921016-99921038 CTCAATCCTCTACACAAATTTGG + Intronic
1101043795 12:100783951-100783973 CTCCATGGCCTCCACAAATTAGG - Intronic
1104635225 12:130434387-130434409 CTCATTCACCTCCGTTAACTGGG - Intronic
1105211271 13:18258483-18258505 CTCAGTCACATTCACAAACTTGG + Intergenic
1108304308 13:49115869-49115891 CTCTTTGACCTCTAAAAATTTGG + Intronic
1108624876 13:52218060-52218082 ATCCTTCACCTCCTCAAATCTGG + Intergenic
1112790939 13:103001651-103001673 CTCTTCCACCTCCACAGATGTGG + Intergenic
1114282561 14:21206680-21206702 CCTATTAAACTCCACAAATTTGG + Intergenic
1116408248 14:44592986-44593008 CACATTCACCATCACAGATTGGG - Intergenic
1118838354 14:69492667-69492689 CTCATTCAACTCCTCACATGAGG - Intronic
1118886720 14:69873401-69873423 TGCATTCACATCCAAAAATTTGG - Intronic
1128267601 15:66280300-66280322 CTCATTAATCTCCACAATTGGGG + Intergenic
1129223201 15:74146853-74146875 CTCATTCCCCTCATCAAAGTGGG + Intergenic
1131078125 15:89511525-89511547 CTCATTCACCTTTCCAAATAAGG - Intergenic
1136537322 16:30907675-30907697 TTCATTCATCTCCACAACTCCGG + Intergenic
1138952316 16:61928194-61928216 CTGATTCACATCAAGAAATTTGG - Intronic
1141243753 16:82287520-82287542 CCCCCTCACCTCCACAAATGGGG + Intergenic
1143621765 17:8084859-8084881 CTCATGCAGCACCACAAATTAGG + Intronic
1146852220 17:36232254-36232276 CACATTTACCACCACAACTTAGG + Intronic
1146868129 17:36356125-36356147 CACATTTACCACCACAACTTAGG + Intronic
1147071003 17:37956743-37956765 CACATTTACCACCACAACTTAGG + Intergenic
1147082529 17:38036269-38036291 CACATTTACCACCACAACTTAGG + Intronic
1147098473 17:38160237-38160259 CACATTTACCACCACAACTTAGG + Intergenic
1147837092 17:43341247-43341269 CTCATTTAACTCCACCAACTTGG - Intergenic
1148549920 17:48544209-48544231 CTCATTCCCCTACACAGATACGG + Intronic
1150080012 17:62229262-62229284 CACATTTACCACCACAACTTAGG + Intergenic
1150169666 17:62979969-62979991 CTTATTCTCCTCCACTAGTTTGG + Intergenic
1150580877 17:66472882-66472904 CTCATTCACCTCCACAAATTAGG - Intronic
1150970576 17:70022448-70022470 CTCATTCAGCTACAGACATTTGG - Intergenic
1153758393 18:8306339-8306361 CACATGCATCTGCACAAATTTGG - Intronic
1159369280 18:67510904-67510926 CTGATTCATATCCACAAAGTGGG + Exonic
1163243321 19:16077078-16077100 CTCATTCTCCCCCACAAGTCCGG - Intronic
1163912137 19:20205647-20205669 TTCATTTACCTGCACTAATTAGG - Intergenic
1164261607 19:23572642-23572664 CTCTCTCACCTCCACACATGGGG + Intronic
1164941453 19:32254597-32254619 CTCATTCACTTGCACATATGGGG + Intergenic
1168070106 19:53944627-53944649 CTCCTTCACCTGCAAAAATGGGG - Intergenic
1168254117 19:55156795-55156817 CTCATTCCCATCCACCAATCTGG + Intronic
931101404 2:59005719-59005741 TTGATTCACATCCACAAATTCGG + Intergenic
931582769 2:63795208-63795230 CTCATCCAACTCCACAATTTTGG - Intronic
933411208 2:81927190-81927212 CTTAATCACCTCCACAAAACAGG + Intergenic
935030949 2:99322134-99322156 CACATTCAGCTTCAAAAATTTGG + Exonic
935410179 2:102753374-102753396 CTCATTCACCTCATTAATTTAGG - Intronic
937770196 2:125711857-125711879 CTTATTCACTGCCACAAATTGGG - Intergenic
938728539 2:134127984-134128006 CTCATGCAGGTCAACAAATTGGG + Intronic
939509040 2:143083982-143084004 ATCATCCACCTACACAATTTAGG - Intergenic
940357178 2:152755825-152755847 CTCTCTCATCTCCACAAATGGGG + Intronic
941052582 2:160751228-160751250 CTCATTCACTTCCACTCTTTGGG + Intergenic
946701301 2:222417022-222417044 CTCATTCACCACTAGAAGTTAGG - Intergenic
947960758 2:234235186-234235208 CACAGTCTCCTCCAAAAATTAGG - Intergenic
1168842472 20:918264-918286 TTCATTGAGTTCCACAAATTAGG + Intergenic
1168884538 20:1238469-1238491 CTCTCTCCCCTCCAAAAATTAGG - Intronic
1171078594 20:22154960-22154982 CTTGTTCACCACCACAAACTCGG - Intergenic
1171367800 20:24638075-24638097 CTCATTCACCTCCACTTTTTAGG - Intronic
1179074028 21:38101089-38101111 ATCCTTCATCTCCACAAATTGGG - Intronic
1179227790 21:39470650-39470672 CTCATCCTGCTTCACAAATTAGG + Intronic
1179292736 21:40032903-40032925 CACATTCATTCCCACAAATTTGG + Intronic
1180563102 22:16637914-16637936 CTAATTCACCTTCATAGATTAGG + Intergenic
1180764967 22:18340954-18340976 CTCAGTCACATCCACAAACTTGG - Intergenic
1180814064 22:18778730-18778752 CTCAGTCACATCCACAAACTTGG + Intergenic
1181200247 22:21213065-21213087 CTCAGTCACATCCACAAACTTGG + Exonic
1181701490 22:24623894-24623916 CTCAGTCACATCCACAAACTTGG - Exonic
1183532025 22:38362212-38362234 CTAATTCACCTTCATAGATTAGG - Intronic
1203226588 22_KI270731v1_random:81859-81881 CTCAGTCACATCCACAAACTTGG - Intergenic
1203264161 22_KI270734v1_random:4417-4439 CTCAGTCACATCCACAAACTTGG + Intergenic
950187456 3:10953887-10953909 CTCATTCACCCCCACGACATGGG + Intergenic
952114430 3:30161959-30161981 CTCCTTCACATCCACTATTTTGG + Intergenic
952696419 3:36269674-36269696 CACATACACCTCAACAACTTAGG - Intergenic
955885657 3:63595545-63595567 TTCATTTACCTCCAGAAACTGGG + Intronic
956063699 3:65374911-65374933 TTCATTCACATCCAAAAATTAGG + Intronic
956086118 3:65612601-65612623 CTCATTCCCCAACACAAACTAGG + Intronic
956376431 3:68618114-68618136 CTCAATCACCTCCTGGAATTAGG + Intergenic
957622278 3:82609154-82609176 ATCATTCATCACCACCAATTGGG + Intergenic
959596090 3:108129952-108129974 CTCATTGACCTTAACAAATAGGG + Intergenic
960438064 3:117651855-117651877 CTCATTCACCTCCTAAGGTTAGG - Intergenic
963204243 3:142616095-142616117 CTCACTCTCCTCCATAAAATGGG - Intronic
963545503 3:146652761-146652783 CTGATTTACCTACACAAATAAGG + Intergenic
965013535 3:163126993-163127015 CTAATTCACTTCCACATTTTTGG + Intergenic
965013538 3:163127037-163127059 CTAATTCACGTCCACATTTTTGG + Intergenic
965801452 3:172498051-172498073 CACATCCAGCTGCACAAATTTGG + Intergenic
967282322 3:187834122-187834144 CTCCCTCACATCCACAAATGTGG - Intergenic
968322969 3:197787827-197787849 CTCAGTCATCTCCATAAAGTAGG - Intergenic
969900858 4:10348017-10348039 CTCAGTCACCTCCACAAAGGAGG - Intergenic
974029212 4:56761102-56761124 CACATTCAGCTTCAAAAATTTGG + Intergenic
975779942 4:77827884-77827906 CTAATTCATCTCCACAAACGGGG - Intergenic
975939210 4:79621146-79621168 TTCATTCAACTCCTCATATTTGG - Intergenic
976819955 4:89194929-89194951 GTCATTAACCACCACAAATATGG - Intergenic
981603638 4:146520467-146520489 ATCCTTCATCTCCACAATTTTGG + Intronic
982614256 4:157620746-157620768 ATCATTAAATTCCACAAATTTGG - Intergenic
984763719 4:183383907-183383929 CTCAGTCACCTCCAGACTTTGGG + Intergenic
986891668 5:12316637-12316659 CTCATGCACTTGCACAAATATGG - Intergenic
986957927 5:13177884-13177906 CTCATTCTGCTCCCCAAAATAGG - Intergenic
988102977 5:26706581-26706603 TTCATTCACCACTACAAAGTGGG + Intergenic
989520428 5:42394338-42394360 CGCATTCAACTCCAGAATTTAGG + Intergenic
990233245 5:53738559-53738581 TTCATTTCCCTCCCCAAATTTGG - Intergenic
991034498 5:62114604-62114626 CTGTTTAGCCTCCACAAATTAGG + Intergenic
991240523 5:64453643-64453665 CTCATTAACCTCTAAAGATTGGG - Intergenic
991527156 5:67573362-67573384 TTCATTTCCCTCCACAGATTTGG + Intergenic
994251865 5:97545128-97545150 CTCATATATCCCCACAAATTAGG + Intergenic
995219657 5:109633606-109633628 CTCAATAAGCTCCACAAAGTGGG - Intergenic
998890481 5:146740521-146740543 CTCTTTCTTTTCCACAAATTTGG + Intronic
1000625342 5:163531931-163531953 CACCTTCTCCTCCAAAAATTGGG + Intergenic
1001710995 5:173777892-173777914 GTCACTCCCCTCCACAAAGTTGG - Intergenic
1006202715 6:32310911-32310933 CTCCTTCACCTCCTCCATTTAGG + Intronic
1006305582 6:33216330-33216352 CTCATTCCTCTCCACATATGAGG - Intergenic
1007898727 6:45390033-45390055 CTCATTTACCTCCACAGAATTGG - Intronic
1008897164 6:56569348-56569370 CACACACACATCCACAAATTTGG + Intronic
1012224914 6:96693330-96693352 CTCATTCACCATGACAAAGTGGG + Intergenic
1013171769 6:107642652-107642674 CTCATTCCCATCCAGATATTTGG + Intronic
1014254270 6:119145661-119145683 CACATTCCTCTCCACAAATAAGG + Intronic
1015484145 6:133749243-133749265 CTCATTGACCTTCACTATTTGGG - Intergenic
1016540485 6:145158859-145158881 CAAATTCACCTCCACATTTTTGG - Intergenic
1018221569 6:161585868-161585890 CTCACTGACCTCTACATATTTGG + Intronic
1018329252 6:162710003-162710025 CTCATTCTCCTCCACGGGTTGGG + Intronic
1018552983 6:165019910-165019932 GACATCCCCCTCCACAAATTTGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020837315 7:13169223-13169245 CTCAGTCACTTCCACATTTTTGG + Intergenic
1023486529 7:40693293-40693315 ATCATTCTCATCCACAAATAAGG - Intronic
1027832759 7:83201190-83201212 CTCATTTAACTCCAACAATTTGG - Intergenic
1029157295 7:98526293-98526315 CTCATTCACCTTCTCCACTTAGG + Intergenic
1029504866 7:100957074-100957096 TTCAATCACCTCCACATATACGG + Exonic
1031844663 7:126790760-126790782 CTCATTCACCTTCACTTGTTTGG - Intronic
1032670453 7:134077574-134077596 CTGACTCACCTCCAAAAAATTGG + Intergenic
1034343119 7:150370373-150370395 CTCTTCCACCCACACAAATTAGG - Intronic
1037107637 8:15128930-15128952 CTCACCCACCTCCCCAAACTTGG + Intronic
1037502097 8:19496061-19496083 CTGATTCAACACCACCAATTTGG + Intronic
1037859756 8:22396782-22396804 CTCACTCACATCCCCAAATGTGG - Intronic
1039665634 8:39523806-39523828 ATCATTCACCTCCAAAACTTTGG + Intergenic
1040828535 8:51650689-51650711 CTAATTTATCTCCACAAACTTGG - Intronic
1046974247 8:120255884-120255906 CTCATGTACATCCACAATTTGGG + Intronic
1048965638 8:139612529-139612551 CTCATTCCCCTACACAACTGTGG - Intronic
1051733110 9:20168492-20168514 CTCATTCAACTCAACAAAAAAGG + Intergenic
1058745258 9:107984115-107984137 CTCATTCAGTTTCACAATTTGGG + Intergenic
1058975178 9:110119568-110119590 CTCATCCAACTCCATAAAGTTGG - Intronic
1059512519 9:114862660-114862682 CTCTGTCACCTCCCCAAAGTTGG - Intergenic
1185535517 X:858491-858513 CTCCTTCACCTCCCCACCTTGGG + Intergenic
1188033798 X:25294326-25294348 CTCATTCAGATCCACAAATTTGG - Intergenic
1193976162 X:88121572-88121594 CTAATTCACCACAATAAATTAGG + Intergenic