ID: 1150586579

View in Genome Browser
Species Human (GRCh38)
Location 17:66523728-66523750
Sequence CTCAGATTGCCGGAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150586577_1150586579 7 Left 1150586577 17:66523698-66523720 CCGGCAGGAGGAGGGGACATTGT 0: 1
1: 0
2: 0
3: 24
4: 241
Right 1150586579 17:66523728-66523750 CTCAGATTGCCGGAAGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 90
1150586570_1150586579 26 Left 1150586570 17:66523679-66523701 CCTGACTATTTGGTGAGTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1150586579 17:66523728-66523750 CTCAGATTGCCGGAAGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150586579 Original CRISPR CTCAGATTGCCGGAAGATGC TGG Intronic
903830355 1:26170713-26170735 CTGACATGGCCTGAAGATGCAGG + Exonic
904373969 1:30068160-30068182 CTCAGATTGCAGGGAAATGCTGG + Intergenic
905803607 1:40861258-40861280 CTCAGATTGGGGGAAGAGGGCGG + Exonic
906764071 1:48410405-48410427 CTCAGAAAGCAGGAAGATGTGGG - Intronic
906938359 1:50234398-50234420 CTCAGAAGACAGGAAGATGCAGG + Intergenic
907350257 1:53823816-53823838 CTCAGATTGCAGGGAGGTGAGGG + Intronic
907857705 1:58320195-58320217 CTCAGAATGCAGGAAGACACAGG + Intronic
909660368 1:78075574-78075596 CTCAGCTGGCAGGAAGATGGTGG + Intronic
913476172 1:119240496-119240518 CTCAGATGGCCTCTAGATGCTGG + Intergenic
919823097 1:201485081-201485103 CTCAATTTGCCAGATGATGCTGG + Intronic
921582043 1:216906423-216906445 CCCAAATAGCCGGTAGATGCTGG - Intronic
922764342 1:228149635-228149657 CCCAGACTGCCGGAGGATACAGG + Intergenic
1072866583 10:99068169-99068191 CTCAGAAGACAGGAAGATGCGGG - Intronic
1087091658 11:94279877-94279899 CTCTGATAACTGGAAGATGCTGG + Intergenic
1088241540 11:107778396-107778418 TTAAGATTGCTGGAAGAGGCCGG + Intergenic
1090316815 11:125798289-125798311 CTCAGAAGGCAGGAAGATGTGGG - Intergenic
1093980691 12:25472066-25472088 CTCAGGAGGCCTGAAGATGCTGG - Intronic
1107930757 13:45305386-45305408 CTGAGACTGCCTGATGATGCTGG - Intergenic
1111203299 13:84968294-84968316 GTTAGATTGCTGCAAGATGCAGG + Intergenic
1111799162 13:92960890-92960912 CTCAGAAGGCAGGAAGATGCGGG - Intergenic
1114082000 14:19209353-19209375 CTCAGAATACAGGAAGATGAAGG + Intergenic
1118402495 14:65392765-65392787 CTCAGATTAGAGGAAGAAGCAGG - Intergenic
1128151607 15:65366721-65366743 CCCAGACTGCAGGGAGATGCAGG - Intronic
1131877910 15:96830428-96830450 CTGAGAATGCCTGAAGAAGCTGG + Intergenic
1145971921 17:28961144-28961166 CTCAGGCTGCCTGGAGATGCAGG - Intronic
1147332197 17:39705692-39705714 TTCAGATTGCTGGGAGAGGCTGG - Intronic
1147551243 17:41443559-41443581 CTCCTACTGCTGGAAGATGCAGG + Intergenic
1150586579 17:66523728-66523750 CTCAGATTGCCGGAAGATGCTGG + Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1154137195 18:11790310-11790332 CTCAGAGTGTCGGAAGCTGGGGG - Intronic
1159395719 18:67853470-67853492 CTCAGAAGGCAGGAAGATGTAGG - Intergenic
1167756167 19:51415091-51415113 CTCAGACTCCCCGAAGCTGCTGG - Exonic
1168513140 19:56989345-56989367 CTGTTATTGCCAGAAGATGCAGG - Intergenic
925155023 2:1642471-1642493 CACAGATTGCCGGGTGAGGCCGG + Intronic
925736639 2:6969492-6969514 CTCACACTTCTGGAAGATGCAGG - Intronic
926734702 2:16064121-16064143 CTCAGAAGACAGGAAGATGCAGG - Intergenic
926840071 2:17070447-17070469 CTCAGATGACAGGAAGATGTGGG + Intergenic
938494582 2:131787230-131787252 CTCAGAATACAGGAAGATGAAGG - Intergenic
1173340953 20:42152429-42152451 ATCAGATTGCAGCAAGATGGGGG + Intronic
1173790202 20:45823362-45823384 CTCAGAGTTCCTGAAGATGATGG - Exonic
1175345663 20:58272768-58272790 GTCAGATTGTCAGAAGATGCAGG - Intergenic
1176344068 21:5724942-5724964 CTCAGATTGCAGGGATATGGAGG - Intergenic
1176500759 21:7599514-7599536 CTCAGATTGCAGGGATATGGAGG + Intergenic
1176538389 21:8123011-8123033 CTCAGATTGCAGGGATATGGAGG - Intergenic
1176613348 21:9007041-9007063 CTCAGAATACAGGAAGATGAAGG + Intergenic
1177115365 21:17079024-17079046 CTCAGATGACAGGAAGATTCTGG - Intergenic
1179384548 21:40929855-40929877 CTCAGAAGGTAGGAAGATGCGGG - Intergenic
1180037377 21:45256762-45256784 CCCAGGTTGCCGGATGAGGCTGG - Intergenic
1180498773 22:15913317-15913339 CTCAGAATACAGGAAGATGAAGG - Intergenic
1203243336 22_KI270733v1_random:39367-39389 CTCAGATTGCAGGGATATGGAGG - Intergenic
950967325 3:17155316-17155338 CTCAGATTGCCGGGAGTGGCTGG - Intergenic
952589264 3:34931613-34931635 CTCAGAAGGCAGGAAGATGTGGG + Intergenic
956169633 3:66422630-66422652 CTCAGAAGGCAGGAAGATGTGGG - Intronic
956495436 3:69821024-69821046 CTCAAATTGCTGGAAAATGTGGG - Intronic
957757440 3:84509165-84509187 CTCAGAGTGCAGGAAAATGTGGG + Intergenic
957857067 3:85892888-85892910 CTCAGAAAGCAGGAAGATGTGGG + Intronic
959741509 3:109725804-109725826 CTCAGCTTGCCTGAAGATGCTGG - Intergenic
967295162 3:187957252-187957274 CTCAGATTTCTGGAAAATGTGGG + Intergenic
970581837 4:17480703-17480725 CTCAGCTTCCAGGAACATGCAGG + Intronic
972017469 4:34264218-34264240 CTCAGAAGGCAGGAAGATGTGGG - Intergenic
972748771 4:41968187-41968209 CTCAGAAGTCAGGAAGATGCTGG + Intergenic
975403252 4:73961652-73961674 CTCAGAATACAGGAAGATGTGGG + Intergenic
975728121 4:77312193-77312215 CTCTGTTTGCAGGAACATGCAGG + Intronic
976277073 4:83288875-83288897 CTCAGAAGGCAGGAAGATGTGGG + Intergenic
982659306 4:158187973-158187995 TATAGATTGCAGGAAGATGCTGG + Intergenic
982659424 4:158189252-158189274 TACAGATTGCAGGAAGATGCTGG + Intergenic
997539274 5:134648500-134648522 CTCAGATTGCCCCACGATCCTGG + Intronic
998020687 5:138767403-138767425 CTGTGGTTGCCGGAAGGTGCTGG + Intronic
998095555 5:139394041-139394063 CTCTGACTGAAGGAAGATGCTGG + Exonic
1002017210 5:176334478-176334500 CTCAGAGTGCTGAAAGATACTGG - Intronic
1002953931 6:1843267-1843289 CTCAGATTGGCAGTAGGTGCTGG + Intronic
1015519910 6:134119773-134119795 ATCAGAGTGCCAGCAGATGCAGG + Intergenic
1021399341 7:20191598-20191620 CTGAAATTGCCGGAGGATGCAGG + Intronic
1021910790 7:25384458-25384480 CTCAGATTGCTAGAAGAAGTAGG + Intergenic
1022029298 7:26477869-26477891 GTCAGATAGCAGGAAAATGCTGG - Intergenic
1022500462 7:30879381-30879403 CTCAGAGTTCCGGAAGCTGGAGG - Intronic
1024642431 7:51341246-51341268 CTCAGAATGCCTGTAAATGCGGG + Intergenic
1031356371 7:120792026-120792048 CTCAGATTGCCGCAAGACTTTGG - Intronic
1037080737 8:14782632-14782654 CTCAGATTGAGGGAAGATAAGGG + Intronic
1037858869 8:22390659-22390681 GTCAAATTGCTGGAAGATGGTGG + Intronic
1041823747 8:62068230-62068252 CTCAGAAGGCAGGAAGATGTGGG + Intergenic
1042989339 8:74621192-74621214 CTCAGATGACAGGAAGATGTGGG - Intronic
1050891967 9:10835944-10835966 CTCAGCTTGCAGGAAGGTGTTGG + Intergenic
1052176077 9:25464340-25464362 CTCAGATGACAGGAAGATGTGGG - Intergenic
1059069594 9:111121191-111121213 CTCAGAAAGCAGGAAGATGTGGG - Intergenic
1060540237 9:124424340-124424362 ATCAGAGTGCCCGGAGATGCAGG + Intergenic
1062471928 9:136709915-136709937 CTCACATTGACGGAAGGTGTGGG + Intergenic
1203459661 Un_GL000220v1:22449-22471 CTCAGATTGCAGGGATATGGAGG - Intergenic
1185542824 X:917117-917139 CTCAGGTTGCCCAAGGATGCTGG + Intergenic
1187097442 X:16163042-16163064 CTCAGAAGGCAGGAAGATGTGGG - Intergenic
1192504260 X:71671361-71671383 CTCATCTTGTAGGAAGATGCTGG - Intergenic
1192523652 X:71823570-71823592 CTCATCTTGTAGGAAGATGCTGG - Intergenic
1194506971 X:94745226-94745248 CTCAGAAGACCGGAAGATGTGGG + Intergenic
1195335065 X:103844759-103844781 GTCAGACAGCCTGAAGATGCTGG + Intergenic
1198318869 X:135498610-135498632 CTCTGATTGCCTGAATCTGCTGG + Intergenic
1198605437 X:138332247-138332269 CTCAGATGACCGGCTGATGCGGG - Intergenic
1199607657 X:149588633-149588655 CTCAGATTGCGCGATGATGTGGG + Intergenic
1199631466 X:149780734-149780756 CTCAGATTGCGCGATGATGTGGG - Intergenic