ID: 1150587072

View in Genome Browser
Species Human (GRCh38)
Location 17:66528507-66528529
Sequence ATGCAGAAGCAGAGTTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150587063_1150587072 30 Left 1150587063 17:66528454-66528476 CCCAGTGTAATCACAAAGGACCT 0: 1
1: 9
2: 80
3: 297
4: 724
Right 1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 445
1150587064_1150587072 29 Left 1150587064 17:66528455-66528477 CCAGTGTAATCACAAAGGACCTT 0: 1
1: 6
2: 97
3: 333
4: 785
Right 1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 445
1150587067_1150587072 10 Left 1150587067 17:66528474-66528496 CCTTCTAAGAGTGAGGGATGAAC 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150587072 Original CRISPR ATGCAGAAGCAGAGTTGGGA GGG Intronic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900365911 1:2311931-2311953 ATGCAGAGGTAGGGTGGGGAGGG - Intergenic
900500238 1:3000908-3000930 ATGGTGAAGCAGAGTAGGGGAGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901742592 1:11352133-11352155 ATTCAGAAGCATAGTTGGCGGGG - Intergenic
902284036 1:15394837-15394859 TTGCAGGAACAGAGTTGGCAAGG + Intronic
902777633 1:18684819-18684841 GCGCAGAAGCAGGGGTGGGAGGG + Intronic
902793579 1:18785469-18785491 CTTCAGAGGCAGAGCTGGGATGG + Intergenic
903299076 1:22365261-22365283 ATTCAGAAATAGAGTTGAGATGG - Intergenic
904377150 1:30088913-30088935 ATGCAAAAGCTGAGTTGGAAAGG + Intergenic
904433088 1:30477765-30477787 AGGCAGCACCAGAGCTGGGACGG + Intergenic
904481055 1:30793576-30793598 AGGCAGCAGCAGCGGTGGGAGGG + Intergenic
904904109 1:33881607-33881629 ATGAAGGAGCTGAGTTGGGATGG + Intronic
904948954 1:34220524-34220546 ATACAAAAGCAGAAATGGGATGG + Intergenic
905678034 1:39843686-39843708 AAGCAGAAGCATAGCTGGGAGGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906569541 1:46824982-46825004 AAGCAGAAGCAGCCATGGGAAGG + Intergenic
906866978 1:49432401-49432423 ATGCAGAGGAAGAGATGGGGAGG - Intronic
908629063 1:66082030-66082052 ATACAAAAGGAGAGTTGGAAGGG + Intronic
908693734 1:66812716-66812738 CTGCAGAAGCAGGGATGAGAAGG + Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909444531 1:75733941-75733963 ATTCAGGAGCAGGATTGGGATGG + Intronic
911304786 1:96220270-96220292 ATGCAGAAGCAAACCTGGGCTGG + Intergenic
912024448 1:105149905-105149927 AAGCAGAAGCAGGGTTTGAAAGG + Intergenic
912032855 1:105271774-105271796 AAGCAGAAGCAGAGTTTGAGAGG + Intergenic
912550623 1:110483203-110483225 AGGCAGGTGCAGGGTTGGGATGG - Intergenic
912563386 1:110566317-110566339 AAGCAGAGGCAGAGTAGTGAAGG + Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913168119 1:116208261-116208283 ATCCAGAAGCTCAGCTGGGAAGG - Intergenic
914424965 1:147567159-147567181 CAGCAGAAGGAGGGTTGGGAAGG - Intronic
915001655 1:152599953-152599975 ATGAACAAGCAGAGGTGGGCAGG + Intronic
915841299 1:159215596-159215618 ATTCAGCAGCAGATCTGGGATGG - Intergenic
916740899 1:167646225-167646247 ATTCAGAAGTGGAGTTTGGAGGG + Intronic
918062976 1:181078100-181078122 AAACAGCAGCAGAGTTGGGAGGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918107532 1:181426999-181427021 GTGAAGAAGCTGAGGTGGGAAGG - Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918955512 1:191201705-191201727 ATGCAAAAGCAGTGTTAAGAGGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919799018 1:201339975-201339997 CTGCTGAAGCAGTGTTGAGAGGG - Intergenic
919892675 1:201987129-201987151 CTCCAGATGCAGAGTTGGGGAGG - Intronic
920059893 1:203219917-203219939 ATCCAGAGGCAGAGCTAGGAGGG + Intronic
920113776 1:203605185-203605207 ATGCAGGAGCAGAGAAGGCAGGG - Intergenic
920189126 1:204181137-204181159 CAGCAGAAGCATAGCTGGGATGG + Intergenic
920696283 1:208183487-208183509 ATGAAGGGGCAGAGATGGGAGGG + Intronic
921443051 1:215211464-215211486 ATGAAAATGCAGAGCTGGGAAGG - Intronic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922895758 1:229098843-229098865 ATTCAGAGTGAGAGTTGGGAGGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923097741 1:230788865-230788887 ATGGAGATCCAGAGTTTGGAAGG + Intronic
923521115 1:234735580-234735602 TTGCAGAAGCAAGGCTGGGAGGG - Intergenic
924420305 1:243903250-243903272 CAGCGGAAGGAGAGTTGGGAGGG + Intergenic
1062818794 10:518961-518983 GTGCAGATGCAGAGCTGGCATGG - Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063533303 10:6857185-6857207 ACGATGAGGCAGAGTTGGGATGG + Intergenic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067352040 10:45485157-45485179 CTGCAGAACCAGTGATGGGATGG - Intronic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071387201 10:85133429-85133451 ATGCAGAAGGAAAGATGGAATGG - Intergenic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1072764190 10:98082745-98082767 ATGCACAAGCAGTGTTCTGACGG + Intergenic
1072819108 10:98538627-98538649 CAGCAAAAGCAGAGTTGGCAGGG - Intronic
1073143960 10:101266916-101266938 ATGACTAATCAGAGTTGGGAGGG + Intergenic
1074365054 10:112851039-112851061 ATGTGAAAGCAGAGTTCGGAAGG - Intergenic
1074744487 10:116517997-116518019 ATGCAGCAGCAGAGTTTGAGAGG + Intergenic
1075265602 10:120997858-120997880 TTGAAGAAGCACAGCTGGGAAGG - Intergenic
1075455362 10:122581512-122581534 ATGCATCAGCAGATGTGGGATGG + Intronic
1075457485 10:122594215-122594237 ATGCATCAGCAGATGTGGGATGG + Intronic
1075458556 10:122600711-122600733 ATGCATCAGCAGATGTGGGATGG + Intronic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1076809932 10:132881229-132881251 TTTCACAAGCAGAGGTGGGAAGG + Intronic
1077190406 11:1253707-1253729 AGGCAGAGGCAGAGATCGGAGGG - Intronic
1077310148 11:1884825-1884847 ATGCAGAAGCATTGATAGGATGG - Intronic
1078001838 11:7503032-7503054 AGGCAGAAAGAGAGTTTGGAGGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078367559 11:10719324-10719346 ATGAAAGAGCAAAGTTGGGAAGG - Intergenic
1078767578 11:14313661-14313683 AGGCAGAGGCAGAGATTGGAGGG + Intronic
1080263524 11:30376431-30376453 AATCGGAAGCTGAGTTGGGACGG + Intergenic
1080382102 11:31782662-31782684 CTGCAGAAAAACAGTTGGGATGG + Intronic
1080866315 11:36198574-36198596 ATGCAGAGGCAGGAGTGGGATGG - Intronic
1081225450 11:40516708-40516730 ATGCAGAAGAAAAATTGGGTTGG - Intronic
1081426266 11:42929604-42929626 AGGGAAAAGCAGAGCTGGGATGG - Intergenic
1082311720 11:50657793-50657815 CTGCAAAAGCATATTTGGGAGGG + Intergenic
1084179839 11:67440766-67440788 ATGCAGAAGCAGAGAGGGCTGGG + Intronic
1085027265 11:73243512-73243534 ATCCAGAAGCAGAGGTAAGATGG + Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1086114672 11:83235777-83235799 ACACATAAGCAGAGTTGTGAAGG + Intronic
1087360604 11:97154383-97154405 ATACAGGATCAGATTTGGGATGG - Intergenic
1087819957 11:102700679-102700701 CTACAGATGCAGTGTTGGGAAGG - Intronic
1088220718 11:107567319-107567341 GTGCAGAAGCAGAATTGCAATGG - Intergenic
1088625491 11:111727466-111727488 CTCCAGCACCAGAGTTGGGAAGG - Exonic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1089334361 11:117712968-117712990 CTGCAAAAGGGGAGTTGGGAAGG - Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1090036879 11:123256858-123256880 ATGAAAAAGCAGAGTTGAAAGGG - Intergenic
1090290112 11:125535943-125535965 AAGCAGAAGCAGTGGTGGGGTGG - Intergenic
1090434777 11:126677633-126677655 GTGCTGAAGCAGGGCTGGGATGG + Intronic
1090812241 11:130255394-130255416 ATGCTAAAGCACAGTTGAGAGGG + Intronic
1091822810 12:3489341-3489363 AAGCAGAAGCAGTGTTGGGTGGG + Intronic
1092096475 12:5846743-5846765 AGGCAGAAGGAGATTTGAGAGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093380616 12:18487716-18487738 AGACAGAAGCTGACTTGGGAAGG + Intronic
1093713163 12:22350916-22350938 AACCAGAAGCAGAATTGGAATGG - Intronic
1095403912 12:41846224-41846246 AGGCAAAAGCAGAGATTGGAGGG - Intergenic
1095825227 12:46524181-46524203 AGACAGAGGCAGAGATGGGAAGG - Intergenic
1097395067 12:59063442-59063464 ATTAAGAAGCAGAGATGGGGAGG + Intergenic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1097921524 12:65079641-65079663 AAGCGGAAGGAGAGTTGTGATGG + Intronic
1099060233 12:77899226-77899248 AAGCAGCAGCAGAGTTTGAAAGG + Intronic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1101455355 12:104825565-104825587 TATCAGAAACAGAGTTGGGAGGG - Intronic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1101835210 12:108290242-108290264 ATGAGGCTGCAGAGTTGGGAAGG - Exonic
1102087759 12:110157792-110157814 ATTCAAAGGCAGATTTGGGAAGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102868604 12:116394334-116394356 AGACAGAAGCAGAGATGGGAGGG - Intergenic
1103041771 12:117701753-117701775 AGACAGAAGCAGAGATTGGAAGG + Intronic
1104915892 12:132264357-132264379 ATGAAGAAGCCGAGCCGGGATGG + Intronic
1105574629 13:21638737-21638759 ATGCAGAAGCATATTTTGGAGGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108462148 13:50677335-50677357 AAGCAGAAGCGAAGATGGGAAGG + Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108579868 13:51819169-51819191 ATGCACAAGGAGAGGTGCGAGGG + Intergenic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1108793280 13:53999049-53999071 ATATAAAAGCAGAGTTGGGAGGG - Intergenic
1108853817 13:54768622-54768644 ATGGAGGTGCTGAGTTGGGAGGG + Intergenic
1110010670 13:70329109-70329131 AAGCTAAAGCAGAGTTGAGAGGG - Intergenic
1110495642 13:76164392-76164414 ATGCAGTAGCAGAGTTTGGCTGG + Intergenic
1111233782 13:85380891-85380913 AAGCAGCAGCAGGGTTTGGAAGG + Intergenic
1111559485 13:89926304-89926326 ATGTAGAATCAAAGTTGAGAGGG - Intergenic
1112742643 13:102492616-102492638 AGGCAGCAGCAGCATTGGGAGGG + Intergenic
1112759458 13:102677529-102677551 TGGCAGAAGCAGAGTTTGTATGG - Intronic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1118526843 14:66653941-66653963 GTGCAATAGCAGAGTTGGCATGG + Intronic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1119765485 14:77185019-77185041 ATGCAGAGGCAGAGTGGGCGGGG + Intronic
1120398964 14:84003940-84003962 ATGCACAAGAAGAGTTGAAAAGG + Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121375366 14:93404989-93405011 ATCCACAAGAAGAGTCGGGAGGG + Intronic
1121576287 14:94990794-94990816 ATCCAGAATCACAGTTAGGAAGG - Intergenic
1121639419 14:95475305-95475327 AGGCAGAAGCAGAGAAGGGGTGG + Intronic
1122651609 14:103229773-103229795 ATCCAGAAGCATTGGTGGGAGGG + Intergenic
1125423223 15:39525423-39525445 ATGCCCAAACAGAGGTGGGAAGG + Intergenic
1125870499 15:43096589-43096611 AAGCAGCCGCAGAGTTGGCAAGG - Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1127062310 15:55199443-55199465 AGGAACAAACAGAGTTGGGAAGG - Intergenic
1127159198 15:56163595-56163617 ATGAAGAAAAAGTGTTGGGAGGG + Intronic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127948714 15:63783111-63783133 ATGCAGTAGCAGAGTTAGAGAGG + Intronic
1128589081 15:68878599-68878621 ATGCAGGAGGAAGGTTGGGAGGG - Intronic
1128760455 15:70213105-70213127 ATGTAAAAGAAGAGGTGGGAGGG + Intergenic
1129098960 15:73240333-73240355 ATACAGAAGTTGAGTTGGCAGGG + Intronic
1129297872 15:74609713-74609735 ATCCAAGAGCAGAGCTGGGATGG - Intronic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132150080 15:99452929-99452951 ATGCAGAAGCGGAGTCCGGCTGG + Intergenic
1132735353 16:1383356-1383378 AAGCAGATGCAGGGATGGGACGG + Intronic
1133271079 16:4611087-4611109 AGCCAGAAGCAGAGCTGGGTGGG - Intronic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1135494369 16:22938647-22938669 ATCAAGAAGCAGAGTTTGGCTGG - Intergenic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136412953 16:30087473-30087495 ATGCAAAAGCAGAACTGTGACGG - Intronic
1136926026 16:34375189-34375211 TTCTAGAAGCAGGGTTGGGAAGG - Intergenic
1136978548 16:35036617-35036639 TTCTAGAAGCAGGGTTGGGAAGG + Intergenic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1137961643 16:52887305-52887327 ATGCAGTAGCATATTTGGGATGG - Intergenic
1138268949 16:55680943-55680965 ATGAATGAGCAGAGTTGGGTGGG - Intronic
1138533767 16:57649005-57649027 ATGCAGATGCAGGGGTGGGATGG + Intronic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1139282822 16:65784810-65784832 AGGCAGAAGCAGAGTGGAAAGGG + Intergenic
1140746439 16:77984614-77984636 ATGAAGATGCAAAGTAGGGAGGG + Intergenic
1141019312 16:80480024-80480046 AGACAGAGGCAGAGATGGGAGGG + Intergenic
1141513334 16:84526595-84526617 ATGCAGAAAGTGAGTTGTGAGGG - Intronic
1141606589 16:85157475-85157497 ATGCATGAGGAGAGCTGGGAGGG - Intergenic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1142246654 16:88973269-88973291 AGGCAGAGGAAGATTTGGGAGGG + Intronic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143328671 17:6118490-6118512 GGGCAGAAGCAGAGATGGAAAGG - Intronic
1143613837 17:8037957-8037979 AGTGAGAAGCAGAGGTGGGAAGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144123174 17:12176590-12176612 AGGCAAAACCAAAGTTGGGAAGG + Intergenic
1144734995 17:17550372-17550394 TTGCAGATGCACAGCTGGGACGG + Intronic
1144796404 17:17894288-17894310 TTGCAGAAGCAGGGTTGAGTGGG - Intronic
1144838330 17:18170079-18170101 CTGCAGAAGCAGATCTGGGAAGG - Intronic
1145019249 17:19416749-19416771 CTGCTGGAGCAGATTTGGGAAGG - Exonic
1146919737 17:36702681-36702703 ATGGAGCAGCAGGGTTGGGCAGG + Intergenic
1147447000 17:40480564-40480586 ATGCAGAAACAAAGCTGAGATGG + Intronic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1149585261 17:57782271-57782293 ACCCAGAAGCAGAGATGTGAGGG - Intergenic
1149685900 17:58534552-58534574 ATGCTGAAGCAGAGTTGGCCAGG - Intronic
1150020439 17:61607116-61607138 TTGCAGAAAAAGAGGTGGGAGGG + Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151385871 17:73754962-73754984 AGGCAGAGGGAGATTTGGGAGGG + Intergenic
1151668110 17:75557242-75557264 ATCCACAAGCAGAGATGGGGTGG + Intronic
1151859582 17:76749956-76749978 TTGCAGTTACAGAGTTGGGAAGG + Intronic
1152456411 17:80419280-80419302 ATTCTGAAGCAGAGCTGGGCTGG + Intronic
1153582988 18:6594152-6594174 ATACAGAAGCACAGTTGGGGAGG + Intergenic
1154126196 18:11694518-11694540 AAGCAGGTGCAGAGGTGGGATGG + Intronic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1158355051 18:56608698-56608720 ATGCAGAAGCAGATATGAGAAGG + Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159535389 18:69708334-69708356 ATGCAGAAGCGGAGTCGGAGCGG - Intronic
1160271113 18:77384441-77384463 CTGCAGAGGCTGAGGTGGGAGGG - Intergenic
1160437345 18:78861874-78861896 ATGCAGCAGCAGAGACGGGCGGG + Intergenic
1160761816 19:789291-789313 CAGCAGAGGCAGAATTGGGAGGG - Intergenic
1161011249 19:1960271-1960293 GTGCAGAAGCCGGGTAGGGAGGG - Intronic
1161541008 19:4851621-4851643 ATGCAGGAGCGGAGTGGCGAAGG + Intronic
1161613093 19:5254568-5254590 AAGCAGAGGGAGAGTTGGGGAGG + Intronic
1162558064 19:11399961-11399983 ATGCAGAGGCTGAGGTGGGGTGG + Exonic
1162742887 19:12783308-12783330 ATTCAGAGGCGGAGTTGGGGGGG - Intronic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163079478 19:14926868-14926890 ATTCCTAAGCAGAGATGGGATGG + Intergenic
1163247731 19:16107647-16107669 AGGCAGAGGCAGAGGTGGTAGGG + Intergenic
1165291506 19:34889780-34889802 CTGCAGAAGCAGTGATGGGTTGG - Intergenic
1165337367 19:35180819-35180841 ATACAGAACCAGAGCTGGGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166300656 19:41910361-41910383 ATCCAGAGGTGGAGTTGGGAGGG + Intronic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1167148647 19:47696583-47696605 CTCCAGAAGCAGAGTTGGGCAGG + Intronic
1167607942 19:50491460-50491482 ATGGAGAGGCGGAGCTGGGAAGG + Intergenic
1167632079 19:50631639-50631661 AGGCTGAGGGAGAGTTGGGAAGG - Intronic
1168041609 19:53763457-53763479 CTGCAGAAGCCGGGGTGGGAGGG + Intergenic
1168336828 19:55601833-55601855 ATCCAGAAGGAGAGTTAGGGAGG + Intronic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
926335184 2:11857525-11857547 TGGCAGGAGCAGAGTTGGGCAGG + Intergenic
926339593 2:11894208-11894230 TGACAGAAGCAGAGGTGGGAGGG - Intergenic
926656563 2:15413807-15413829 ATACAGAAGCTGGGTTGGAAAGG + Intronic
927676532 2:25110422-25110444 CTGAAGAAGCTGATTTGGGAGGG - Intronic
928261607 2:29772475-29772497 ATGCAGATGCAGGGGTGGGGTGG + Intronic
928320919 2:30282321-30282343 AAGCAGAAGCAGACCTGGGCAGG + Intronic
928940118 2:36718776-36718798 TTGTAGAGGCAGTGTTGGGATGG - Intronic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929836549 2:45406229-45406251 ATGGAGGAGCAGTGTAGGGAAGG + Intronic
930583257 2:53238249-53238271 AAGCAGCAGCAGAGTTTGAAAGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
932175820 2:69600703-69600725 AAGCAGCAGCAGAGTTTGGGAGG + Intronic
932440337 2:71730898-71730920 AGGCAGAAGCAGTGCTGGGGTGG + Intergenic
932446734 2:71786195-71786217 AGGCAGAGGCAGAGTAGGGTTGG + Intergenic
932666475 2:73702456-73702478 ATGGAGAAGCCTAGCTGGGAAGG - Intergenic
932890184 2:75588172-75588194 AGGCACAAGCAGATTTGTGAAGG + Intergenic
934989723 2:98912757-98912779 GTCCAGAAGCAGGGATGGGAAGG + Intronic
935633015 2:105227449-105227471 AGGCAGAGGCAGAGATGGGTGGG + Intergenic
935712053 2:105908228-105908250 ATGGAGAAACAAAGTTGTGATGG + Intergenic
938575522 2:132599593-132599615 ATGAAGTATCAGAGTTGGAAGGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
940278235 2:151962012-151962034 GTGCAATAGCAGAGTGGGGAAGG - Intronic
942116176 2:172731321-172731343 TTCCAGAATCAGAGTAGGGAAGG - Intergenic
942153224 2:173099530-173099552 ATGCAGAAGAACAGTTGGACAGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
946047087 2:216830171-216830193 ATGAAGAGGCATATTTGGGAAGG - Intergenic
946747046 2:222856603-222856625 ATGAAGAAGAAGAGTTGGCCGGG + Intergenic
948068060 2:235096893-235096915 AGGCAGAGGCAGAGATTGGAGGG - Intergenic
948670959 2:239568333-239568355 ATGGAGAAACAAAGTTGGGGTGG + Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948962396 2:241350121-241350143 ATGCAGATGCAGGGCGGGGATGG + Exonic
949032103 2:241802150-241802172 GTGCAGAAGGCGGGTTGGGAGGG + Intronic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
1169459254 20:5780328-5780350 ATCCAGACACAGAGTTGGCAAGG + Intronic
1169608398 20:7350124-7350146 ATGCAATAGCAGAAGTGGGAAGG + Intergenic
1169668559 20:8068303-8068325 AGGCAGAAAGAGAGTAGGGAAGG + Intergenic
1170404445 20:16021414-16021436 ATGAAGCAGCAGAGTTGTGCAGG + Intronic
1170617094 20:17962497-17962519 CTGTAAAAGCAGAGTTGGGCTGG - Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1173859555 20:46273908-46273930 ATGCAGAAGCCAAGTTGGGCTGG + Intronic
1173927853 20:46794018-46794040 ATGAAGAAGCAAAGTAGGGTGGG - Intergenic
1174332742 20:49832650-49832672 TTGCAGAAGACGAGGTGGGAGGG + Intronic
1174745930 20:53062851-53062873 ATGACTAAGCTGAGTTGGGAAGG - Intronic
1175604089 20:60298369-60298391 AGGCAGAGGCAGAGATGGGAGGG - Intergenic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1176366793 21:6038075-6038097 GTGCAGGAGCAGAGATGGAAGGG - Intergenic
1177418847 21:20828741-20828763 AAACAGAAGCAAAGTTAGGAAGG + Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1179086155 21:38219658-38219680 ATGCAAAGGCAAAGTTGGCAGGG - Intronic
1179756725 21:43500469-43500491 GTGCAGGAGCAGAGATGGAAGGG + Intergenic
1179917617 21:44487965-44487987 CATCAGAAACAGAGTTGGGAGGG - Intergenic
1180843072 22:18968231-18968253 GTGCAGAGGCAGAGTTGAGCAGG - Intergenic
1180952025 22:19724732-19724754 ATTCAGCACCAGAGTTTGGAAGG - Exonic
1181058400 22:20270501-20270523 GTGCAGAGGCAGAGTTGAGCAGG + Intronic
1181179564 22:21057319-21057341 TGGCAGAAGCAGAGTTGCAACGG + Intronic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183172727 22:36199682-36199704 ACGCAGAAATAGAGATGGGAAGG + Intronic
1183242215 22:36666489-36666511 ATGCAGAAGCATGGTTGCCAGGG + Intronic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1183762312 22:39832973-39832995 GTGCAGAAGCCGAGTGGGCAAGG + Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
949810108 3:7998175-7998197 AGGCAGAAGCAGAGTTTATAAGG - Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950170532 3:10835824-10835846 AAGCAGAAACAGGGTTGGGAGGG + Intronic
950426680 3:12928143-12928165 ATGCTGCAGCAGAGGTGGGAGGG + Intronic
951353799 3:21639676-21639698 ATGCATAGGCAGTGTTAGGATGG - Intronic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952551468 3:34483606-34483628 TTGCAGAACCAGATTTGAGAGGG + Intergenic
952807620 3:37371646-37371668 ATACAGAAGCAGATCTGGTAGGG - Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
953692210 3:45129135-45129157 ATGCAACAGAAGAGTTTGGATGG - Intronic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
955609854 3:60745408-60745430 ATGAAGATGGAGAGTTGGTAGGG + Intronic
956257435 3:67298587-67298609 ATACATAAGAAGAGTAGGGAAGG + Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
958094566 3:88927040-88927062 CTGCAGAAGCACAGTTGATAAGG - Intergenic
960172176 3:114474658-114474680 AAGCAGGAGAAGGGTTGGGAGGG - Intronic
960262950 3:115588926-115588948 ATGCAGCAGAGGAGATGGGAGGG + Intergenic
961001522 3:123377329-123377351 ATGCAGAAGCCCTGTTAGGATGG - Intronic
961049261 3:123733218-123733240 AAGCAGACTCAGAGGTGGGAGGG - Intronic
961805713 3:129487933-129487955 TTCCAGAGGCAGAGTGGGGAGGG + Intronic
962930563 3:140032042-140032064 AAGCACAAGTAGAGGTGGGAAGG + Intronic
964620513 3:158716168-158716190 AGGAAGAAGCTGAGTTGGGAGGG + Intronic
964690535 3:159444697-159444719 ATGCAGAATGAGAGGTGGCAGGG + Intronic
964835136 3:160929866-160929888 AAGCTGAAGGAGAGGTGGGAAGG - Intronic
965870800 3:173262472-173262494 AAGCAGAGGTAGAGTTGGAAGGG + Intergenic
966026927 3:175295559-175295581 AAACAGAAGCACAGTTGGAAAGG - Intronic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966584181 3:181603341-181603363 ATGCAGGAGAAGGGTTGTGAAGG - Intergenic
968027080 3:195451497-195451519 AGGCAAAAGCAGAGTTGGTGAGG + Intergenic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
970882306 4:20946426-20946448 ATGCAGAAGACGAGTTAGCAAGG + Intronic
972108946 4:35530778-35530800 AGGCAGATTCAGTGTTGGGAAGG + Intergenic
972163638 4:36256276-36256298 GTTCAGAAGCACAGTTTGGAAGG - Intergenic
972328893 4:38045401-38045423 TTACAAAACCAGAGTTGGGAGGG + Intronic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972659227 4:41098290-41098312 ATCCAGAGGCTGAGATGGGAGGG - Intronic
972865352 4:43225566-43225588 TTGCAGAAGGCGAGTTGGGTGGG + Intergenic
972879700 4:43408235-43408257 ATTCAAAAGCAGATTTGGGTGGG - Intergenic
975259129 4:72275530-72275552 ATGCTGAAGTACAGTTGTGACGG + Intergenic
975311577 4:72909701-72909723 TTGCAGGTGCAGAGCTGGGAGGG + Intergenic
975612051 4:76213358-76213380 ATGTAGCAGCAGGGATGGGAGGG + Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
975931905 4:79534667-79534689 ATGCAGAATCAGAGATCTGAGGG + Intergenic
976621798 4:87135885-87135907 ATGCAGAAGCAGAGATGAGGAGG + Exonic
977779935 4:100969121-100969143 AAACAGAGGCAGAGGTGGGAAGG - Intergenic
977780826 4:100978691-100978713 ATACACAAGTAGAGTAGGGAGGG - Intergenic
978371262 4:108031526-108031548 ATGCAGAGGCAGGAATGGGAAGG - Intronic
978523293 4:109638722-109638744 AAGCAGTGGCAGAGTTTGGAGGG - Intronic
978884459 4:113750443-113750465 ATGCAGAAACAGGCTTGGGGAGG - Intronic
981439224 4:144763870-144763892 AAGCAGCAGCAGGGTTGGAAAGG - Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982822818 4:159965735-159965757 ATGCAGGAGAAGAAATGGGAAGG - Intergenic
983008080 4:162510085-162510107 ATGAAGAATCAGTGTTGGGCAGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984825229 4:183918544-183918566 TTGCAGAAGCACAGTTGAGAGGG + Intronic
985546686 5:513468-513490 CTGCGGATGCAGAGTTGGGCGGG + Intronic
986990811 5:13550971-13550993 AAGAAGAAGAAGAGATGGGATGG + Intergenic
987251510 5:16105848-16105870 TTGCAAAACCAGAGATGGGAGGG - Intronic
988543818 5:32137709-32137731 ATCCAGAGGGAGAGATGGGAGGG + Intronic
988722779 5:33894631-33894653 AAGCAGAAGCAAAGTTGAGGAGG - Intergenic
989833483 5:45951693-45951715 CTGCAGAGGGAAAGTTGGGAGGG + Intergenic
990378054 5:55192916-55192938 GTCCAGAAGCAGAGGTGGGAGGG - Intergenic
991772070 5:70049819-70049841 CTGCGGAAGGAGAGTTGGGCCGG - Intronic
991851363 5:70925237-70925259 CTGCGGAAGGAGAGTTGGGCCGG - Intronic
992697074 5:79300147-79300169 ATGCAGATGCAGAGTTTGCGGGG + Exonic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
994504720 5:100628287-100628309 ATGAAGAAGCACACTTTGGATGG - Intergenic
995246378 5:109939839-109939861 ATGTAGAAGGGGCGTTGGGAAGG - Intergenic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
997671365 5:135676610-135676632 CTGCAAAAGCAGTGTTGAGAAGG - Intergenic
998003905 5:138644661-138644683 ATGAAGAAGCTGATTTGCGATGG - Intronic
998522967 5:142817281-142817303 GAGCAGGAGCAGAGTTGGCAAGG + Intronic
999528161 5:152431053-152431075 ATCCAGTAGAAGAGCTGGGAGGG + Intronic
1000224603 5:159248343-159248365 ATGCAAAAGTAGAGTTCTGATGG - Intergenic
1000264314 5:159620019-159620041 ATGCAGAGGCAGACTTGGACTGG + Intergenic
1001252434 5:170157113-170157135 ATGAAGAAGAAAAGTTGGGTTGG - Intergenic
1001583859 5:172819617-172819639 ACCCAGATCCAGAGTTGGGAGGG + Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001866759 5:175112994-175113016 AGGAAGAAACAGTGTTGGGAAGG + Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002652387 5:180708988-180709010 TTTCTGAGGCAGAGTTGGGATGG - Intergenic
1003334704 6:5159442-5159464 ATGCAGAAGAAGGGATGGAAAGG + Intronic
1004403503 6:15310644-15310666 CTGCAGGTGCAGAGATGGGATGG + Intronic
1004406430 6:15337742-15337764 TATCAGAAACAGAGTTGGGAGGG - Intronic
1005357270 6:24996560-24996582 AAGCAGAAACAGTGGTGGGAGGG - Intronic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006215889 6:32442411-32442433 ATGGAGAAAGAGAGTTGGGTGGG - Intronic
1006514284 6:34537500-34537522 ATGCAGGACCGGAGTGGGGAAGG - Intergenic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1007070182 6:39031038-39031060 CTGCAGAATTGGAGTTGGGAGGG - Intergenic
1007141216 6:39576452-39576474 ATGCAGAGTCAAAGATGGGAAGG - Intronic
1007867150 6:44984665-44984687 ATGCTGAAGCAAAGTTGCGATGG - Intronic
1007918097 6:45579816-45579838 CTGCAGAAGCAGAGTAGAGCAGG + Intronic
1008617032 6:53236559-53236581 AGGCAGAAGCACAGATGGGTAGG + Intergenic
1009828673 6:68900866-68900888 TTGCAGAAGCATTGTAGGGAGGG - Intronic
1010484825 6:76397621-76397643 TTGGAGAAGCTGAGTTGAGAGGG + Intergenic
1010485344 6:76405217-76405239 ATGAAAAAGAAGTGTTGGGAAGG - Intergenic
1010638017 6:78283947-78283969 GTGCAGAAACAGAGTTGGGGAGG - Intergenic
1012216855 6:96597751-96597773 ATGCAGCAGCAGAACTGGGAAGG - Intronic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013806796 6:114005381-114005403 ATGGAGTCTCAGAGTTGGGAGGG + Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014286783 6:119508012-119508034 AAGCAGAAGCAAAGTAGAGATGG - Intergenic
1014555505 6:122840132-122840154 ATGCAAAGGCAGAGAAGGGAAGG + Intergenic
1014620837 6:123665160-123665182 AAGCAGAAGCAGGGTTGGGGTGG - Intergenic
1014730273 6:125024229-125024251 AAGCAGAAGAAAAGTCGGGAGGG + Intronic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015697280 6:135995059-135995081 AAGAGGATGCAGAGTTGGGAGGG - Intronic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1023837516 7:44077052-44077074 ATTTAGGAGCAGAGTTGGCAGGG + Intronic
1024250196 7:47500642-47500664 ATGAAGAAGCTGAGTTCAGAGGG + Intronic
1024969705 7:55057269-55057291 TTGCTTAAGCAAAGTTGGGACGG + Intronic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026195164 7:68166730-68166752 ATGCATAAGCAGAGTCTGGGAGG - Intergenic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1027929212 7:84509677-84509699 ATGCAGCAGGAGAGTTGGACAGG - Intergenic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028449486 7:90965163-90965185 ATGCAGAGACAAAGTGGGGATGG - Intronic
1028854899 7:95579520-95579542 ATGAAGTGGCAGAGCTGGGATGG + Intergenic
1029275702 7:99402949-99402971 ATGCAGGAGGAGAATTGGCAAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030641600 7:112012415-112012437 ATGCTAAGGCAGAGTTAGGAAGG + Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031597942 7:123669391-123669413 CAGCAGAAGCAGGTTTGGGAGGG + Intergenic
1031698401 7:124890432-124890454 ATGCAGCAGCAGGGTTGACAAGG + Intronic
1032180760 7:129675013-129675035 AAGCAGCAGCAGAGTTGGAGGGG - Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032793336 7:135258492-135258514 ATGCAGAAGAGGAGCTGCGAGGG + Exonic
1033462053 7:141555585-141555607 CTGCAGATGCAAAGGTGGGATGG - Intronic
1033483161 7:141761545-141761567 ATGTGGGAGCAGAGTTGAGAGGG + Intronic
1033588145 7:142789379-142789401 ATGCAGAAGTGGAGTTAGAATGG - Intergenic
1033784246 7:144711767-144711789 AGGCAAAAAAAGAGTTGGGATGG - Intronic
1035355263 7:158272812-158272834 CGGCAGAAGGAGAGGTGGGAAGG + Intronic
1036096895 8:5734165-5734187 CTGCAGAAGCAGGCTTGGGCTGG - Intergenic
1036165650 8:6430288-6430310 ATGCAGAGGCAGATATGAGAAGG - Intronic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1038863758 8:31416049-31416071 TTGTAGAAGCATAGTTGGGAAGG + Intergenic
1039233195 8:35472213-35472235 ATGGTGAAGCAGAGTTGTGTAGG + Intronic
1039706034 8:40008382-40008404 AGGCAGAAGGAGAGGTGAGAAGG - Intronic
1040509145 8:48078057-48078079 ACCCAGAAGCAGAGTTTGCAGGG - Intergenic
1041388740 8:57330502-57330524 ATTGTGAAGGAGAGTTGGGAAGG - Intergenic
1043928733 8:86066863-86066885 ATAGAAAAGCAGAGTTGGAAAGG - Intronic
1044083335 8:87912286-87912308 ATGTAGAAGCTGAATTGGAAAGG + Intergenic
1044505549 8:93013455-93013477 ATGCAGAAGAGAGGTTGGGAGGG + Intronic
1044595568 8:93955223-93955245 AAGGAGAAGCAGAGGTGAGAGGG - Intergenic
1045034919 8:98169455-98169477 ATGCTGAAGGAAAGCTGGGAAGG - Intergenic
1045559925 8:103251411-103251433 ATGCAGATACAGTGATGGGAGGG - Intergenic
1047049129 8:121090422-121090444 ATGTAGCAGCAGAGTTTGGGAGG - Intergenic
1047302700 8:123627752-123627774 ATCCAGCTGCAGTGTTGGGAGGG + Intergenic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1047723607 8:127665713-127665735 ATGCAAAAACAGAGTTGTGGAGG + Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048843817 8:138587988-138588010 ATGCAGGATCACAGTGGGGAGGG - Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049277541 8:141727394-141727416 CTGCAGAAGGAGAGCTGGGTGGG + Intergenic
1049834227 8:144723517-144723539 ATTCAGAAGTAAAGATGGGATGG + Intronic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1051628852 9:19124485-19124507 AGGAAGTAGCAGAGTTGGAATGG + Intronic
1053069222 9:35091334-35091356 ATGCAACAGCAGAAGTGGGAAGG + Exonic
1053287202 9:36857523-36857545 ATTCAGAAGCAGAGTAGAAATGG + Intronic
1053341293 9:37336472-37336494 TGGAATAAGCAGAGTTGGGATGG + Intronic
1053395172 9:37766960-37766982 CTACGGGAGCAGAGTTGGGAGGG + Intronic
1055218772 9:73901772-73901794 AGGCAGTAGCATAGTTGGAAGGG + Intergenic
1055593608 9:77843553-77843575 GTGCAGAAGCATGGGTGGGATGG + Intronic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056487329 9:87072387-87072409 ATGGAGAGGCAGAGTTGGTGTGG - Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058292213 9:103256838-103256860 CTGCAGAAGCAGAGTTCTCATGG - Intergenic
1058846721 9:108967803-108967825 ATGGAGAAGCATAGATGGTAAGG + Intronic
1059016227 9:110518974-110518996 TTGCAGCTGCAGAGGTGGGAAGG - Intronic
1059731086 9:117057944-117057966 ATGAAGAAAGAGAGGTGGGAGGG - Intronic
1060520068 9:124289319-124289341 CTGCAGAGGCAGAGCTTGGATGG - Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1062298433 9:135848188-135848210 CCACAGAAGAAGAGTTGGGAAGG + Intronic
1062447103 9:136599656-136599678 GTACAGGAGCAGAGTTGGGGTGG - Intergenic
1188156698 X:26749529-26749551 ATGCTGCAGCAGAGCTGGCAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189012816 X:37063447-37063469 ATGCAGAAGGAGAGATGAGTGGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189908202 X:45783388-45783410 GGACAGAAGCTGAGTTGGGATGG - Intergenic
1192433369 X:71127309-71127331 ATGAAGAAGCAAGGTTGGGAGGG - Intronic
1192668488 X:73113533-73113555 AAGCAGCAGCAGAGTTTGGGAGG - Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1195085235 X:101407581-101407603 AAGCAGCAGCAGAGTCGGGTGGG + Intronic
1195198229 X:102519731-102519753 AAGCAAGAGAAGAGTTGGGATGG - Intergenic
1195674793 X:107499863-107499885 AGGCAGGCCCAGAGTTGGGAGGG - Intergenic
1196206492 X:112946033-112946055 AGGCAGAAGCATGGTTGGGTAGG + Intergenic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1199288744 X:146082886-146082908 ATTCAGCAGGAGAGATGGGATGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200769304 Y:7108808-7108830 ATGCAAATGCCTAGTTGGGATGG + Intergenic
1201894870 Y:18982535-18982557 ATGCAGTAGGAGAGCAGGGATGG - Intergenic