ID: 1150590395

View in Genome Browser
Species Human (GRCh38)
Location 17:66557221-66557243
Sequence TTTTTTAAGGGCCTTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150590395 Original CRISPR TTTTTTAAGGGCCTTGGGGA AGG Intronic
900056320 1:633643-633665 ATTTTTATGGGCTTTGGTGAGGG - Intergenic
900497656 1:2983376-2983398 TTTTTTAACTGCCTCGGTGAGGG + Intergenic
901148703 1:7085966-7085988 CTTGTTTGGGGCCTTGGGGAAGG + Intronic
902297398 1:15477072-15477094 TTGTTTATGGGCAGTGGGGAGGG - Intronic
902757180 1:18556674-18556696 TTTTTTCAGGGACTAGGAGATGG + Intergenic
903246049 1:22016330-22016352 TTTTTTGCGGGGGTTGGGGACGG + Intergenic
903457874 1:23500780-23500802 TTATTTAAGGTTGTTGGGGAGGG - Intergenic
906089887 1:43169993-43170015 TTTTTTCATGAACTTGGGGAGGG - Intronic
906539403 1:46573530-46573552 TTTTTTAGGGGGGATGGGGAGGG + Intronic
906976966 1:50586191-50586213 TTTTGTTTGGGCCTAGGGGAGGG - Intronic
907131637 1:52102560-52102582 GGTTTCCAGGGCCTTGGGGAGGG - Intergenic
908080636 1:60574354-60574376 TTTTTTGATGGCCATGGAGAAGG - Intergenic
908558190 1:65278977-65278999 TTTTTAAACTGCCATGGGGAAGG - Intronic
910106751 1:83639551-83639573 TTCTTTAAGTGACATGGGGATGG - Intergenic
911672054 1:100618660-100618682 TGTTTTAAGATGCTTGGGGAAGG - Intergenic
911883093 1:103266536-103266558 ATTTTAAAGGGCTTTAGGGAGGG - Intergenic
913483484 1:119312069-119312091 CGTTTTAACGGTCTTGGGGAGGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914407838 1:147393861-147393883 TTTTTTTTGGGCAGTGGGGATGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915080716 1:153349883-153349905 TTTTTGGAGCGGCTTGGGGAGGG + Intergenic
915437160 1:155916098-155916120 TTTATAAAGGGGCTGGGGGAAGG - Intronic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
915713502 1:157923212-157923234 TTTTTAAAGTGGCTGGGGGAGGG + Intergenic
917725455 1:177823448-177823470 TTCTGAAAGGGCCCTGGGGAAGG + Intergenic
918371750 1:183868048-183868070 TTTTTAGAAGGGCTTGGGGAAGG + Intronic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
918869329 1:189948517-189948539 TTTTTTAAGAGACATGGGGGTGG + Intergenic
920075425 1:203332931-203332953 TGTTTCCAGGGCCTTGGGAATGG - Intergenic
920839194 1:209539628-209539650 TTTTTTCTGGGCACTGGGGATGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
922470981 1:225877072-225877094 ATCTTTAAGGCCCTTGGGAAGGG - Intronic
924302800 1:242656892-242656914 TTATTTAATGGCATTTGGGAGGG + Intergenic
1063604526 10:7510611-7510633 GTATTTAAGGGCTTTAGGGAGGG + Intergenic
1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1065142345 10:22730346-22730368 TTATTTCAGGGGTTTGGGGATGG + Intergenic
1065825161 10:29564067-29564089 TTTTTGCAGGGCCGTGTGGAGGG - Intronic
1066370023 10:34812833-34812855 TTTTTTAAGGGTGTCTGGGAAGG - Intronic
1068561712 10:58522113-58522135 TGTTGTAAGGGACTTGGGGGAGG + Intronic
1068656570 10:59582086-59582108 TATTTTAAGTGCCATGGGGTAGG + Intergenic
1070831439 10:79420283-79420305 TTTCTCAGGGGTCTTGGGGAGGG - Intronic
1071134611 10:82438507-82438529 TGGTTTAAGCTCCTTGGGGAAGG - Intronic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1075281442 10:121142264-121142286 TTATTTAAGGCACTTGGGGAAGG + Intergenic
1076252831 10:128997097-128997119 CATCTTTAGGGCCTTGGGGAGGG + Intergenic
1078674111 11:13393390-13393412 CTTTTTAAGGGACTTGGGATTGG + Intronic
1078674995 11:13402446-13402468 ATTTTTAAGTGCCTTGGCCAAGG + Intronic
1079590334 11:22175846-22175868 TTTATCAAAGGGCTTGGGGAAGG - Intergenic
1079763085 11:24355756-24355778 CTTTTAAAGGGTCTTGGAGATGG - Intergenic
1080438844 11:32271682-32271704 TTTATAAATGGCTTTGGGGAAGG - Intergenic
1081043569 11:38242432-38242454 ATTTTGAAGGACCTTTGGGAAGG - Intergenic
1081633588 11:44705719-44705741 TTTATTGAGTGCCTTGGGGTAGG - Intergenic
1081747081 11:45480901-45480923 TTCTCTGAGGGCCTTGGGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084632082 11:70359472-70359494 TTTTTTATGGGTTTTGGAGAGGG + Intronic
1086289460 11:85291071-85291093 ATTTTTAAGGTCCTTGGAAATGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087245942 11:95837036-95837058 TTTTTTGAGAGCCTTGGGGTAGG - Intronic
1087364462 11:97201540-97201562 TCTGTCAAGGGCCTTGGAGAAGG - Intergenic
1090244974 11:125209770-125209792 TATTTTCAGGGCCTTGGGAGAGG - Intronic
1090277523 11:125430276-125430298 CTTCTTTAGGGCTTTGGGGAGGG - Intronic
1092968925 12:13672737-13672759 TTTTTGTAGGGCATTTGGGAGGG - Intronic
1093190908 12:16074056-16074078 TTATTTAAGGTCCCTGGGGAAGG + Intergenic
1093350192 12:18090439-18090461 TTTTTTTAGGTCCTAGGAGAAGG - Intronic
1094783850 12:33822753-33822775 TTTTATAAAGCCCTTGGGCATGG + Intergenic
1095434508 12:42172507-42172529 TTTTTTAAGCGACTAGGGCAGGG + Intronic
1095880713 12:47133362-47133384 TTTTTTCAGGGCCCTGGACAAGG - Intronic
1096281163 12:50255102-50255124 TTTTATTAGTGGCTTGGGGAGGG - Intronic
1096767536 12:53905136-53905158 GTTGCTAAGGGCCGTGGGGAGGG + Intergenic
1096982389 12:55735955-55735977 TTTTTTGAGGTCTTTGGAGAAGG - Intergenic
1099823316 12:87743133-87743155 TTTTTTTAGGGGGGTGGGGATGG - Intergenic
1100624295 12:96314971-96314993 TTTTATAAGATCCTTGGGGATGG + Intronic
1100705265 12:97193967-97193989 ATTTTTAAGGGTTTTGGAGAGGG + Intergenic
1101961071 12:109250590-109250612 TTTTGGAAAGGCCATGGGGATGG - Intronic
1103246073 12:119458634-119458656 TTTCTTTAGGGCCCTTGGGAGGG + Intronic
1103536663 12:121638192-121638214 TTTTTTATGGGTGTTGAGGAGGG + Intronic
1104110454 12:125699596-125699618 TATTTTTAGGGCACTGGGGAAGG + Intergenic
1104247440 12:127057137-127057159 TTTTTAAAGATTCTTGGGGAAGG + Intergenic
1104501100 12:129286369-129286391 TTTTTTAAGGACACTGGGCATGG + Intronic
1105780867 13:23704373-23704395 TTTTTTAAAATCCTTGGGGTGGG - Intergenic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1108055200 13:46478406-46478428 TTTTGTAAGGGCCTTGATGAGGG - Intergenic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1110220382 13:73066115-73066137 TCTTTCAAATGCCTTGGGGAGGG + Intronic
1112880772 13:104104066-104104088 TTTTTTGAGGGGGTGGGGGATGG + Intergenic
1113424343 13:110195768-110195790 TTCTTCAAGGATCTTGGGGAAGG - Intronic
1117031400 14:51674702-51674724 TTTTTAAAGGGTGTGGGGGAAGG - Intronic
1118702967 14:68452083-68452105 TTTCTTATGGGTCTTGTGGATGG + Intronic
1119715978 14:76859678-76859700 TTTTTTTTGGGTGTTGGGGATGG + Intronic
1119876378 14:78063181-78063203 TTTGTTAAGCACCTTGGGCAAGG + Intergenic
1120114441 14:80596997-80597019 TTTTTTAAGGTTCTTGAGGTGGG - Intronic
1121556948 14:94845335-94845357 ATTTTGAATGGCCCTGGGGAAGG + Intergenic
1121683221 14:95811679-95811701 TTTTTTATGTGAATTGGGGATGG + Intergenic
1124067698 15:26361378-26361400 CATTTTATTGGCCTTGGGGAAGG + Intergenic
1124660386 15:31545335-31545357 TATTTTCAGGACCTTGGGGTAGG + Intronic
1125397500 15:39265331-39265353 TTTCATAAGGGCCTTTGGGGAGG + Intergenic
1127921430 15:63497539-63497561 TTTTTTCAGGTCCTGGGAGAGGG - Intergenic
1128020892 15:64389342-64389364 TTTTTTGAGGCCCTAGGAGATGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128442928 15:67730217-67730239 TTTTTTGAGGGCATAAGGGAGGG - Intronic
1128884183 15:71270840-71270862 TTTTTTAATGGCCATGTAGAAGG + Intronic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1130605006 15:85307744-85307766 TTTGTGAAGGGCCTTGGAGAGGG + Intergenic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1134333436 16:13271338-13271360 TGATTTAATGGGCTTGGGGATGG - Intergenic
1134610034 16:15600606-15600628 TTTTTTAAGGGGGGAGGGGATGG + Intronic
1134685312 16:16154548-16154570 TTCCTGAAGGCCCTTGGGGAGGG + Intronic
1135661167 16:24297861-24297883 TTTTTTAGTGGCCTTGAGAAAGG + Intronic
1137674713 16:50298655-50298677 GTTCCTAAGGGCCTCGGGGAGGG - Intronic
1137797165 16:51231445-51231467 TTTTTTAAGTGCCTGGTGGCAGG + Intergenic
1139473400 16:67190179-67190201 TCTGTTGATGGCCTTGGGGAGGG - Exonic
1139611194 16:68060164-68060186 TTTTTTAAGGGCTTGGGAGATGG + Intronic
1140301586 16:73763227-73763249 TGTATTAAAGGCCTTGGAGAAGG + Intergenic
1140951275 16:79820209-79820231 TTTTTTAAGGACATTAGGAAAGG + Intergenic
1141735807 16:85851880-85851902 CTTTCTAAAGGCCTTGGGAAAGG - Intergenic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1142734062 17:1883471-1883493 TTTTTTAATGGGCCTGGGCATGG + Intronic
1142868364 17:2804964-2804986 TTTTCTCAGGACCTTGGTGATGG + Intronic
1146358162 17:32152630-32152652 AGTTTTAAGGGCCATGGTGAGGG + Intronic
1146476463 17:33166612-33166634 TTATTTGAGGCCCTAGGGGAGGG - Intronic
1146876671 17:36418938-36418960 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1147062713 17:37893923-37893945 TTTTTGAAGGGCATTGTGGTTGG - Intergenic
1147124441 17:38356380-38356402 TTTTTTTGGGGCCGGGGGGATGG + Intronic
1147702091 17:42402722-42402744 TGTTTTAAGGGATTGGGGGAGGG - Exonic
1147999914 17:44381618-44381640 TTTTAAAAGGGGCTTGGGCACGG - Intronic
1148203515 17:45765564-45765586 TTCCTCATGGGCCTTGGGGAGGG + Intergenic
1148934976 17:51157935-51157957 TTTTTTAAGGGCTTGGGGGTTGG - Intronic
1149127160 17:53248746-53248768 TGTTTTAGGTGCCTTAGGGAAGG + Intergenic
1149431025 17:56595766-56595788 TTTTTTGAGGGCGTTGGGGGGGG + Intergenic
1150292121 17:63988108-63988130 GATTTTAGGGGGCTTGGGGAAGG - Intergenic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150801672 17:68287999-68288021 TTTTTTTTGGGGGTTGGGGATGG + Intronic
1150985379 17:70190724-70190746 ATTTTTAAGGAACTTGGGGAAGG - Intergenic
1151272310 17:73006427-73006449 TTTTTAAAGGGTCTTGGAGAAGG + Intronic
1153177084 18:2388690-2388712 TTTATTTAGGGTCTTAGGGATGG - Intergenic
1153993078 18:10417241-10417263 ATTTTTTGGGGCCTTTGGGATGG - Intergenic
1155148419 18:23103394-23103416 TTTTTTAAGAGCCTAGGAGGAGG + Intergenic
1156125356 18:33898448-33898470 TTTTTCAAGGGCTATGTGGAAGG - Intronic
1156311445 18:35926100-35926122 TCTTTTATGGACCTTTGGGAAGG - Intergenic
1161566830 19:5007076-5007098 TTCTAGAAGGGCCTTGGGGGAGG + Intronic
1162176082 19:8831772-8831794 TTTTTTAAGGCCCTAGAGCAGGG + Intronic
1165341680 19:35216912-35216934 TTTTGGAAGGCCCTTGGGCAAGG - Intergenic
1165586344 19:36919426-36919448 TTTTTCCAGGGACTGGGGGATGG + Intronic
1165994042 19:39832369-39832391 TGTGTTAGGGGCCCTGGGGAGGG - Intronic
1166017735 19:39995673-39995695 ATTTTTAAGGGATTTGGGGGGGG + Intronic
1166554078 19:43686554-43686576 TTATTCAAGGGCCTTGGCCAGGG - Intergenic
1167584508 19:50366006-50366028 TCTGTGAAGGGCCTGGGGGAAGG + Intronic
1168157062 19:54480395-54480417 TTTTTTAAGGGTTATTGGGATGG + Intergenic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
926426413 2:12742595-12742617 TTTTTTAAGTACCTTGGAGGAGG + Exonic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
932613824 2:73219377-73219399 TTTTTTTGGGGTCTGGGGGAGGG + Intronic
934011503 2:87825050-87825072 ATTTTTATGGGCTTTGGTGAGGG - Intronic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
935844758 2:107153575-107153597 CTCTTTTAGGGCCTTGGGTAAGG + Intergenic
935938568 2:108214295-108214317 TTTCTTATAGGCATTGGGGATGG - Intergenic
935951083 2:108329442-108329464 GTTTTCAGGGTCCTTGGGGAAGG - Intergenic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
936707356 2:115090438-115090460 TTTTGTCAGGGATTTGGGGAGGG + Intronic
937686081 2:124698812-124698834 TTTTCTAATGGCCTAGGGGGTGG - Intronic
937858646 2:126691177-126691199 TTATTTGGAGGCCTTGGGGAGGG - Intronic
937859147 2:126694764-126694786 TTATTTGGAGGCCTTGGGGAGGG - Intronic
938106288 2:128532630-128532652 TGTTTTCAGGGACTGGGGGATGG + Intergenic
939064308 2:137464223-137464245 TGTTTTGAGGGTTTTGGGGAGGG - Intronic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
940832979 2:158488963-158488985 TATTTTAACAACCTTGGGGAAGG + Intronic
941794088 2:169581257-169581279 TGTTTTAAGGCCCTGGGGAAGGG - Intergenic
941822819 2:169859369-169859391 TTTTTTAAGAGCCATGCTGAGGG - Intronic
942058256 2:172205213-172205235 TTTTTTATGAGGCTTTGGGATGG + Intergenic
942739087 2:179153343-179153365 TTTCTTAAGGTTGTTGGGGATGG - Intronic
943107801 2:183568603-183568625 TTTTTTATGGGCCATGTTGAAGG + Intergenic
943290183 2:186061072-186061094 TTTATTAAGGACCTTTGTGAAGG - Intergenic
943999545 2:194815148-194815170 TTCTTTTAGGGAGTTGGGGATGG - Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944333044 2:198494837-198494859 TTTATTTGGGGCCTTGGAGAAGG + Intronic
945185345 2:207134248-207134270 TTTTTTATGGGGGTAGGGGAAGG - Intronic
945307241 2:208269820-208269842 TTTCTCAGGGGCCTGGGGGATGG + Intronic
945895807 2:215480264-215480286 TGTTTTCAGGTCCTTGGGTAAGG + Intergenic
947061146 2:226167495-226167517 TTTTTTAAGATCCATGGGAAAGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
948317277 2:237037868-237037890 TTTCTAAAAGGCCTTGCGGAGGG - Intergenic
1169051907 20:2586093-2586115 ATTTTTAGAGGCCTTGAGGAGGG - Intronic
1169800828 20:9509609-9509631 TATATTAATGGCCTTTGGGAAGG - Intergenic
1169936943 20:10893720-10893742 GTTTATAAAGGCCTTGGGAAAGG - Intergenic
1170683593 20:18548244-18548266 TTTTTAAAGGGCCTTTGGCCAGG - Intronic
1172411104 20:34723697-34723719 TTTTTAAGGGGTGTTGGGGATGG - Intronic
1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG + Intronic
1174374891 20:50119955-50119977 TTTTTTAAATGGCTGGGGGAGGG - Intronic
1174479848 20:50823333-50823355 TTTTTTTTGGGCCGGGGGGACGG - Intronic
1174881949 20:54289494-54289516 TTTCTGTGGGGCCTTGGGGAAGG + Intergenic
1175143703 20:56880266-56880288 TGTTCTAAGGGCCTGGGGGTTGG - Intergenic
1177455327 21:21330775-21330797 TTATTTAAGGGCTTTAAGGATGG + Intronic
1177486771 21:21768317-21768339 TTTATCAAAGGCCTTGGTGAAGG + Intergenic
1177831818 21:26147854-26147876 TTTTTTGGGGGGGTTGGGGAGGG - Intronic
1178297968 21:31426882-31426904 GTTTTTGAGGGGCTTGGGGTGGG + Intronic
1180001241 21:44996516-44996538 TTTTTAAAGTGCCTTGGAGAAGG + Intergenic
1182457159 22:30459134-30459156 TCCATAAAGGGCCTTGGGGATGG + Intronic
949392416 3:3577727-3577749 TTTTTTAAAGGCCTGTGAGAAGG + Intergenic
949417219 3:3827963-3827985 CTCTTTAAGGCCCTTGGGCATGG - Intronic
949708757 3:6849956-6849978 TTTTCTAAGAGTCTTGAGGATGG + Intronic
949789194 3:7774176-7774198 TTTTTTAAGGCTATTGGAGAGGG - Intergenic
949981399 3:9504019-9504041 TTTTTTAAGAGATTGGGGGAGGG - Intronic
950633820 3:14301417-14301439 TTTTTGAAAGGCATGGGGGAAGG - Intergenic
951523030 3:23626910-23626932 TTCTCTAAGGCCCTTGGGTATGG + Intergenic
951562205 3:23980336-23980358 TTTTTTTAGGGGTTGGGGGAGGG + Exonic
952249524 3:31637853-31637875 TTTTGGAAGGGATTTGGGGAGGG + Intergenic
952969203 3:38640469-38640491 TTTTTTAAGGGCTTAGGGCCTGG - Intronic
953125699 3:40089755-40089777 TATTTTAATGGCCTTGGCAATGG + Intronic
953636406 3:44668850-44668872 TTTTTTCAGTGTCTTGGAGATGG + Intergenic
954322193 3:49839849-49839871 CTTTTTCAGGCTCTTGGGGAGGG + Exonic
954446588 3:50550197-50550219 TTTTTTAGGGGCCTGGGGTCTGG - Intergenic
955210512 3:56936110-56936132 TTTTCTTAGGGATTTGGGGATGG + Intronic
956260325 3:67332406-67332428 ATTTTTGAGAGCCTTGGAGAAGG + Intergenic
956726640 3:72162048-72162070 TTTTCTCTGGGCGTTGGGGAGGG - Intergenic
956754968 3:72376202-72376224 TTTATTAAGGGTCTCAGGGAGGG - Exonic
957964686 3:87307039-87307061 TTTTTTAAGGGACACAGGGAGGG - Intergenic
958113432 3:89181907-89181929 TTTTTTAAGGGTCGCTGGGAAGG + Intronic
959021849 3:101196044-101196066 TTTTCTAGGAGCTTTGGGGATGG - Intergenic
960379385 3:116940347-116940369 CTTGTAAAGGGCCTTGGAGAAGG + Intronic
960744357 3:120870251-120870273 TTTTTTAATGGGCTTGTGGCAGG - Intergenic
964565834 3:158051494-158051516 TTTTTCAGTGGCCTTGGGCAAGG + Intergenic
964627360 3:158772335-158772357 GTTTTTTATGGCCTTGGGGTAGG + Intronic
965717227 3:171618095-171618117 TTCTCTAAGGCACTTGGGGAAGG + Intronic
965916761 3:173857751-173857773 TTTTTTAAGTGGCCTTGGGATGG - Intronic
965916780 3:173857970-173857992 TTTTTTAAGTGGCCTTGGGATGG - Intronic
966130315 3:176630156-176630178 TTTTTCAATGGTTTTGGGGAAGG - Intergenic
966434710 3:179870408-179870430 GTTTTTAAGGGTCTTGGAGTGGG - Intronic
967098236 3:186194472-186194494 TTTCTGAAGGGCCTTAGGGAAGG + Intronic
967246515 3:187492146-187492168 ATTGTGAAGGGCCTTGGAGAAGG + Intergenic
969524789 4:7698857-7698879 TTTTTTAAGTTTCTTGGGGTGGG + Intronic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
970676022 4:18451417-18451439 TTGTTTAATGGCCCTGGTGAAGG + Intergenic
971387010 4:26150148-26150170 TTTTGGAACAGCCTTGGGGATGG - Intergenic
971685679 4:29763893-29763915 TTTTTTAAGTTCCTTGAGAATGG - Intergenic
972093012 4:35312042-35312064 ATTTTGAAGGGTCTTGGGGCAGG + Intergenic
972167465 4:36305054-36305076 TTTCTTCAGGGCCTTTGGGTGGG + Intronic
973656778 4:53056137-53056159 TTTTTTCAGGTCATAGGGGAAGG + Intronic
975491380 4:74992553-74992575 TTTTTTAAGGCCAATGGGGCAGG + Intronic
976779696 4:88745456-88745478 GCTCTTAAGGGCCTTGGGCATGG + Intronic
980301998 4:131007632-131007654 GTTTTTGAGGACCTTGGGTAAGG - Intergenic
980580711 4:134746658-134746680 ATGATTAAGTGCCTTGGGGATGG - Intergenic
981737913 4:147971964-147971986 TTTGTAAGGGGTCTTGGGGAAGG + Intronic
982886113 4:160784591-160784613 TTTTATAAAGCCCTTGGGCACGG + Intergenic
983643160 4:169962688-169962710 TATTTTAAGGGCATTGGGTGGGG + Intergenic
983959071 4:173730539-173730561 TTTTTTAGGGGGGGTGGGGATGG - Intergenic
987076798 5:14390479-14390501 TTTTTTATTGGCCCTGGTGATGG + Intronic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
988403690 5:30796530-30796552 TTTTATAAAGGCCTAGGAGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990376737 5:55177886-55177908 TTTTTCAAGGGACTTGGGGCAGG - Intergenic
990425142 5:55680454-55680476 TTTTGTAAGGGCCTTAATGAGGG - Intronic
991074176 5:62516883-62516905 TTTTTTAAGTGCTTTAGTGATGG - Intronic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
991341485 5:65615511-65615533 TTTTTTAAGAGCCAGGAGGAAGG - Intronic
991435572 5:66594961-66594983 GTTTTTAAGGACCTTTGGCAAGG + Intergenic
991581592 5:68161298-68161320 TTTTGGAAAGGCCTTGGGGAAGG - Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
995277301 5:110291707-110291729 TTTAGGAAGGGCCTTGGGAAAGG - Intronic
995594251 5:113731185-113731207 CTGTTTAAGCTCCTTGGGGAAGG - Intergenic
996466693 5:123810955-123810977 TTTTCTAAGGTCCTTGGGAAAGG + Intergenic
997628086 5:135344965-135344987 GTTTTAAAGGGCCTGGGGAAAGG + Intronic
997935736 5:138109025-138109047 TTTTTTGTGGGCCGGGGGGACGG - Intergenic
1000330893 5:160204491-160204513 TTTTTTAGGGGGGGTGGGGATGG + Intronic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1001259034 5:170210855-170210877 TTTGTTGAGGGAATTGGGGAAGG + Intergenic
1001413896 5:171529539-171529561 CTTTTCAGGGGCCATGGGGAGGG - Intergenic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1001928136 5:175654062-175654084 TTGTTTAAGATACTTGGGGAAGG - Intergenic
1002025763 5:176395321-176395343 TATGATAAGGGCCTTGTGGAAGG - Intronic
1003350032 6:5308011-5308033 TTTTTTAAGGACAGTAGGGAAGG + Intronic
1003856021 6:10276535-10276557 TTTTTCAAGGTTCTTGGGGTGGG - Intergenic
1004677359 6:17856089-17856111 GTTTTCAAGTGCCTTGGGGAAGG - Exonic
1009461354 6:63917878-63917900 TTTGTTAAGGGCTTTGGAGCCGG - Intronic
1011098328 6:83692695-83692717 TTAATTAAGGACCTTGGGGGTGG - Intronic
1011104478 6:83764447-83764469 ATATTTAATGGCCATGGGGAAGG - Intergenic
1013862299 6:114650332-114650354 TTGTATAAGGACCTTGGGGTTGG + Intergenic
1015320086 6:131862919-131862941 TTTTTTCTGGGCGGTGGGGAAGG + Intronic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1020799871 7:12720244-12720266 TTTTTTTAGGGTCTTGCGGCGGG - Intergenic
1020950276 7:14667225-14667247 TTTTTTAATGACCCTGGAGAAGG + Intronic
1022208914 7:28189306-28189328 TATTTTCAGGGGGTTGGGGATGG - Intergenic
1024099462 7:46015583-46015605 TTTTTTTAGCTCCTTGGGGGAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027865378 7:83639529-83639551 TTTTGTAAGACCCTTGGGGATGG - Intronic
1028944140 7:96557901-96557923 TTTTTTAAGGCCGTTGGAAAAGG + Intronic
1029436140 7:100565074-100565096 ATTTCTATGGGCCTTGGGGATGG + Exonic
1030729228 7:112965176-112965198 TTTGTTAAGGGACATAGGGAAGG + Intergenic
1030765548 7:113404799-113404821 TGTTCTAAGGGCCCTGGGTAGGG + Intergenic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1032637801 7:133729443-133729465 CTTTTTGAGGGCACTGGGGAAGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034383290 7:150717817-150717839 TTTATTGAAGGCTTTGGGGAGGG + Intronic
1035486652 7:159231342-159231364 TCTGTGAAGGGACTTGGGGAAGG + Intergenic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1037592797 8:20327662-20327684 TTTCTTAAGGCGCTTGGGGAAGG + Intergenic
1037986859 8:23295660-23295682 CTTTTTAGGGTCCTTTGGGAGGG - Intronic
1039422103 8:37451822-37451844 TTTATTGAGGAACTTGGGGAGGG - Intergenic
1039603998 8:38866091-38866113 TCTCTAAAGGGCCTTGGGGGAGG - Intergenic
1040920688 8:52613090-52613112 CTTTTTATGGGATTTGGGGATGG + Intergenic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045952193 8:107865044-107865066 ATTGTGAAGGGCCTTGGAGAAGG - Intergenic
1046070954 8:109252550-109252572 TTCTTTATGGACCTTGGCGAGGG - Intronic
1047161581 8:122386533-122386555 TCTTTCAAGGGCTCTGGGGAGGG + Intergenic
1047174739 8:122529601-122529623 TTTTTCCTGGGCCTTGGGAAAGG - Intergenic
1047307323 8:123663353-123663375 TTTTCAAAGGTCCTTGGGGCCGG - Intergenic
1048224872 8:132575607-132575629 TTCTTTCCGGGCCTTGGTGATGG - Intronic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1049129726 8:140827536-140827558 TTTTTTTAGGGGGGTGGGGATGG + Intronic
1049137749 8:140919721-140919743 ATTTTAAAGGGCTTTGGGAATGG - Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1051038461 9:12776944-12776966 TTTTTCAAAGGACTTAGGGAGGG - Intronic
1051341308 9:16113396-16113418 TGTTTTAAAGGGCTTAGGGAGGG - Intergenic
1051391667 9:16571918-16571940 TTTTTTAAGGGGCCTTGTGATGG + Intronic
1052569406 9:30200620-30200642 ACCTTTAAGGGCCTTGGGGCAGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053063075 9:35046405-35046427 TGTTTTCATGGCCTTGGAGATGG - Intergenic
1054754922 9:68947973-68947995 TTTTGTAAGGGCATGGGTGATGG - Intronic
1054853721 9:69875217-69875239 TTTTTTAAGGGGGTGAGGGAAGG + Intronic
1055672669 9:78623198-78623220 TTATTTGAAGGCCTTGGGGGAGG + Intergenic
1056143490 9:83707407-83707429 TTTTGGAAGGGCCTGGGAGAGGG - Intronic
1056254526 9:84785228-84785250 TTGTTTAAGGGCCTGTGTGATGG - Intronic
1056541916 9:87579011-87579033 TTTATTAAGGGCCTTTATGAGGG - Intronic
1057537493 9:95927189-95927211 TTTTTTGAGGGACTAGGGGGAGG + Intronic
1057572438 9:96214853-96214875 TCTTTGCAGTGCCTTGGGGAAGG - Intergenic
1057617594 9:96605705-96605727 TATTTTAAGGGCCAGGGGCAGGG + Intronic
1057719648 9:97521545-97521567 TTTTCTGAGGGCCTTCAGGAAGG + Intronic
1057923498 9:99120395-99120417 TCTTTTCAGGGCCTGGGGTAAGG + Intronic
1058001974 9:99875313-99875335 TATTTTAAGAGAGTTGGGGAGGG - Intergenic
1059761421 9:117341115-117341137 TTTTTTAAAGCCCTTGAGCAAGG + Intronic
1060830319 9:126709809-126709831 TGTTTTATGTTCCTTGGGGAAGG + Intergenic
1061910377 9:133719241-133719263 TATTTTATGGGATTTGGGGAAGG - Intronic
1202629977 M:8474-8496 ATTTTTATGGGCTTTGGTGAGGG - Intergenic
1185830165 X:3294067-3294089 TCTTTTAAGGGCATTTAGGAAGG - Intergenic
1185992088 X:4902561-4902583 TTGTTTCAGGGACCTGGGGAAGG - Intergenic
1186860351 X:13666770-13666792 TTTATTATGGGCCATGGGTAGGG - Intronic
1187151287 X:16684152-16684174 TTTTCTAAGGTGTTTGGGGAAGG - Intronic
1187346901 X:18473829-18473851 TTTTTTAAAGACCTGGGGGTGGG + Intronic
1187762250 X:22600588-22600610 CTTTTTAATGTCCTTGGGGAAGG + Intergenic
1189727850 X:43986487-43986509 TTTCTTAAGGAACTTGGTGATGG + Intergenic
1190384845 X:49875076-49875098 TTTTTTAACGGCGGTTGGGAAGG - Intergenic
1190624214 X:52320785-52320807 TTTTTTATGGGGGTGGGGGAGGG + Intergenic
1191827094 X:65377452-65377474 ATTATTAAGTGCCTTGGGGTAGG - Intronic
1192329721 X:70165508-70165530 TTTGTTTAGGGGCTTGGGGGGGG + Intronic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1193645072 X:84057670-84057692 TTTATTAAGGGGCTGGGAGATGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195012967 X:100751621-100751643 TTTTCTAAATGCCTTGGTGAAGG - Intergenic
1196495292 X:116317723-116317745 TTTTGTCTGGGCCTGGGGGAGGG - Intergenic
1196977762 X:121179216-121179238 ATTATGAAGGGCCTTGGAGAAGG - Intergenic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1198364747 X:135929241-135929263 GCTTTTAGGGGCCTTGGTGAGGG - Intergenic
1200375397 X:155774707-155774729 CTTTTCCTGGGCCTTGGGGAAGG - Exonic