ID: 1150591141

View in Genome Browser
Species Human (GRCh38)
Location 17:66563782-66563804
Sequence ACAGTACAAACATCTCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150591141_1150591143 -4 Left 1150591141 17:66563782-66563804 CCAAATGGAGATGTTTGTACTGT 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150591141 Original CRISPR ACAGTACAAACATCTCCATT TGG (reversed) Intronic
900324021 1:2098979-2099001 GCAGTAAAAACATCACTATTGGG - Intronic
908582126 1:65526529-65526551 TCAGTATAAAGAACTCCATTAGG - Intronic
908900006 1:68945786-68945808 ACAAGACAAACATCATCATTAGG + Intergenic
909134539 1:71781512-71781534 ACAGTGCATACAAATCCATTTGG + Intronic
911436265 1:97862888-97862910 ACAGGAAAAACATGCCCATTTGG + Intronic
919131267 1:193453523-193453545 ACAGTACAAGCATCTTTTTTGGG - Intergenic
922471677 1:225881071-225881093 AAAGTACAAACTTCTCCTTATGG + Intronic
922880077 1:228974199-228974221 TCAGTACTAATATTTCCATTAGG + Intergenic
1064506404 10:16034987-16035009 TCAGTTCTAAAATCTCCATTGGG - Intergenic
1064796034 10:19012246-19012268 GTAGTACAAAAATTTCCATTTGG + Intergenic
1065428091 10:25626629-25626651 AGAGTATAAACATTCCCATTGGG - Intergenic
1065572435 10:27084933-27084955 AAAGTACAAAAATGTCCAATGGG - Intronic
1067778836 10:49183233-49183255 ACAGTACAATCATCAACTTTAGG - Intronic
1068803467 10:61168274-61168296 TCAGTTCTAACATGTCCATTTGG + Intergenic
1070608735 10:77918578-77918600 ACGCTCCAAACATCTCTATTTGG + Intronic
1073325205 10:102640307-102640329 CCAGGACAAACATCCCCACTGGG + Intergenic
1073519343 10:104112064-104112086 ACAGAACACAGATCTCCCTTGGG - Intergenic
1074257781 10:111820495-111820517 ACAGTAGAAAAATGTCCATTTGG + Intergenic
1076064209 10:127436096-127436118 ACAATACATCCATATCCATTAGG - Intronic
1076302631 10:129439710-129439732 ACAATAGATTCATCTCCATTTGG - Intergenic
1077830316 11:5861228-5861250 ACAGTATAAATATCTCCTATTGG - Intronic
1078649390 11:13173655-13173677 ACAGTAAAAACAAATCCAGTTGG + Intergenic
1078808193 11:14728318-14728340 GCAGTAGAAACATTTTCATTAGG - Intronic
1080813127 11:35725935-35725957 GCTGTATAAACATCTTCATTTGG - Exonic
1081281426 11:41213221-41213243 ACAGTATAAACATTTCTAATAGG + Intronic
1086452038 11:86926680-86926702 CAAGTACAAAAACCTCCATTAGG + Intronic
1086517674 11:87631788-87631810 TCATTAAAAACTTCTCCATTTGG - Intergenic
1087119800 11:94561536-94561558 ACAGTACAATTATCTACATCAGG - Intronic
1087854118 11:103070164-103070186 ACAGTTCAAAAATTTCCATTTGG - Intronic
1092648664 12:10608622-10608644 ACACTAGGAACATCTACATTAGG - Intronic
1093084808 12:14855106-14855128 CCAGTAAAAAAATCTCCTTTGGG - Intronic
1094240963 12:28224292-28224314 ACAGTAGAAACATGCCCTTTGGG - Intronic
1094255713 12:28423664-28423686 ACAGTAAAAACTTCTGCATCAGG + Intronic
1097974288 12:65667896-65667918 ACAGCACATCCATTTCCATTTGG - Intergenic
1098865901 12:75763059-75763081 AAAGAACCAACATCTCCAGTTGG - Intergenic
1099370734 12:81826583-81826605 GCATTCCCAACATCTCCATTTGG + Intergenic
1101044905 12:100794832-100794854 ACAGCACAAACAACTGCATACGG + Intronic
1101244115 12:102869020-102869042 ACAGAACTAGCACCTCCATTTGG + Intronic
1105354273 13:19644514-19644536 ACTGGACAAACATCACCATAAGG - Intronic
1106068106 13:26378379-26378401 GCAATACAAACATCTGCTTTAGG + Intronic
1107235467 13:38163700-38163722 ATAGCACATACAGCTCCATTTGG + Intergenic
1107328669 13:39273123-39273145 TCAGTAGAAACATTTCCATATGG - Intergenic
1109374558 13:61474318-61474340 ACAGTACAGACATTTCCACTTGG - Intergenic
1110061605 13:71046654-71046676 ACTGTACAAACATGTAAATTTGG + Intergenic
1110421819 13:75319051-75319073 GCAGAACTAACATTTCCATTAGG + Intronic
1110959134 13:81598385-81598407 ATAGCACAAACATCTGCATCTGG - Intergenic
1112196633 13:97232996-97233018 ACAGCACAAACATTTCACTTTGG - Intronic
1113684147 13:112269247-112269269 TCAGTTCTAACATTTCCATTTGG + Intergenic
1113694789 13:112337049-112337071 TCAGTTCTAACATTTCCATTTGG - Intergenic
1114345855 14:21794073-21794095 AAAGTAAAAAAATCTCCAATTGG - Intergenic
1117961676 14:61169628-61169650 ACAGAAAAAAAATTTCCATTTGG - Intergenic
1122647074 14:103201952-103201974 AGAGTACAAACAGCCCCATGTGG - Intergenic
1123887934 15:24746502-24746524 ACTGTACATACATCTCCAGGTGG + Intergenic
1124162184 15:27282538-27282560 TCAGTTCTAACATTTCCATTTGG + Intronic
1124919649 15:34013718-34013740 ACAGAAAAAACATCACCAATGGG + Intronic
1131805309 15:96115787-96115809 ACACTGCAAACATCTCCCTGGGG + Intergenic
1131855760 15:96592172-96592194 CCAATACAAACTTCCCCATTGGG + Intergenic
1131856083 15:96596396-96596418 ACAGTACCAAAATTTTCATTTGG - Intergenic
1131911334 15:97207629-97207651 ACAGTCCTAAAATTTCCATTTGG + Intergenic
1140301863 16:73765814-73765836 TCAGAACATACATCTCCATCCGG - Intergenic
1143056048 17:4162564-4162586 ACAGTCCTAACCTCCCCATTGGG - Intronic
1143144657 17:4766895-4766917 ACAGTTAAAACATCTGCACTAGG - Intergenic
1143254667 17:5546866-5546888 ACAATAAAAACATCTCCATATGG - Intronic
1144167365 17:12625571-12625593 ACAGAGGAAAAATCTCCATTTGG + Intergenic
1145061222 17:19735495-19735517 CCAATACAAAAATCTCCATTAGG - Intergenic
1146669171 17:34724997-34725019 CCAGCTCAAACACCTCCATTAGG - Intergenic
1147043875 17:37738784-37738806 ACAGGAAAAGCATCTGCATTTGG - Intronic
1148402335 17:47376624-47376646 ATAGTACAAACATTTCCATTAGG + Intronic
1150591141 17:66563782-66563804 ACAGTACAAACATCTCCATTTGG - Intronic
1151618333 17:75229367-75229389 ACAGGACAAACAGCTCATTTGGG + Intronic
1153538455 18:6128946-6128968 AAAATACAAACTTCTCCATTTGG - Intronic
1154558599 18:15795041-15795063 TGAGTACACACATCTCCAATAGG - Intergenic
1154565484 18:15890170-15890192 TGAGTACACACATCTCCAATAGG - Intergenic
1154763016 18:18596610-18596632 TGAGTACACACATCTCCAATAGG - Intergenic
1157010051 18:43636591-43636613 ACAGTAAATAAATTTCCATTGGG + Intergenic
1158012674 18:52747376-52747398 ACAAAATAAACTTCTCCATTAGG + Intronic
1159188588 18:65012411-65012433 CTAGTACAAATATTTCCATTTGG + Intergenic
1159696726 18:71567148-71567170 AAAAAACAAACATCTCTATTAGG - Intergenic
1159924816 18:74258841-74258863 AGAGTAAAAACATCTACTTTAGG + Intronic
1161502100 19:4622000-4622022 CCAGTAGAAACGTCTCCAGTTGG - Intergenic
1164568199 19:29346687-29346709 GAAGTAAAAACATCTCTATTTGG + Intergenic
1168479565 19:56707728-56707750 TCAGGAGAATCATCTCCATTAGG + Intergenic
929005122 2:37386488-37386510 AAACTCCAAACATCTCCACTGGG + Intergenic
930760715 2:55032494-55032516 ACAATTCTAGCATCTCCATTTGG - Intronic
932873083 2:75423404-75423426 ACAGTTCAAACATGTAAATTGGG + Intergenic
936272628 2:111060836-111060858 TCAGTTCTAACATTTCCATTTGG - Intronic
936507834 2:113122215-113122237 TCAGTACAAACATTTTCATTTGG - Intronic
941960815 2:171251479-171251501 TCAGTACAAATATCTCCTTTGGG - Intergenic
943736577 2:191363146-191363168 ACTGTATAAACATCTTCATATGG + Intronic
946049983 2:216854599-216854621 AGAGTACATACATCTCCCTGGGG - Intergenic
946097406 2:217287386-217287408 ACAGGACATACATGCCCATTTGG + Intronic
1168873864 20:1156089-1156111 TCAGTGCTAAAATCTCCATTTGG - Intronic
1175540479 20:59744730-59744752 ACAGAACAAGCATCATCATTCGG + Intronic
1177574768 21:22938287-22938309 ACAGTACAAACACCTCACTAAGG - Intergenic
1178549146 21:33520573-33520595 ACAATATAAACATCCACATTAGG + Intronic
1180117209 21:45717276-45717298 AAAATACAAATATCTCTATTTGG - Intronic
1182824392 22:33251912-33251934 CCAGTCCATACATCTCCATCTGG + Intronic
1184314744 22:43676941-43676963 TCAGTAGAAACATCACCTTTAGG + Intronic
949342274 3:3042919-3042941 ACATTGCAAATATCCCCATTGGG + Intronic
949698789 3:6731250-6731272 AGAGTTCACACATCACCATTGGG + Intergenic
950342001 3:12255677-12255699 ACAGTTCAAACTCCTCAATTCGG + Intergenic
950991555 3:17443728-17443750 ACAGTTCTAAGATTTCCATTTGG - Intronic
953471983 3:43175562-43175584 ACAGTGGAAACAGCTCCTTTAGG - Intergenic
955941850 3:64153501-64153523 ACAGAATAAACATATCCATATGG - Intronic
958900708 3:99882933-99882955 AAAGTTCAGACATCTCCATTAGG - Intronic
959775655 3:110159210-110159232 ACATAACAAGCCTCTCCATTAGG - Intergenic
960642017 3:119834216-119834238 ACAGTAGAAGCATTTCCACTTGG - Intronic
961155074 3:124672629-124672651 ACAATTCAAACATCACCATAAGG + Intronic
962273584 3:133995989-133996011 CCAATACAACCATCTCCATTTGG + Intronic
965772696 3:172197451-172197473 ACAATACAACCATCAACATTAGG + Intronic
966111706 3:176410132-176410154 ACAGTAAAAACATCTGCAGTTGG - Intergenic
966970387 3:185040149-185040171 ATAGCACAAACACCTCCATTAGG + Intronic
970009551 4:11444124-11444146 AAAGTATAAAGATCTACATTTGG - Intergenic
973276514 4:48315472-48315494 ACAGTACAGGCATCTGCATCGGG - Intergenic
974168307 4:58232351-58232373 ATACTACAAACAGCTTCATTTGG - Intergenic
975235121 4:71985669-71985691 ACAGTATAGACTTCTGCATTGGG - Intergenic
976088435 4:81429964-81429986 AGTGTAAAAACATCTCCCTTTGG + Intronic
978196434 4:105977840-105977862 ACTGTAAAACCATCTACATTTGG - Intronic
979252757 4:118582586-118582608 ATAGGAAAAACAGCTCCATTTGG + Intergenic
980550921 4:134334229-134334251 ACAGTAAAAAAATTTACATTTGG - Intergenic
982418188 4:155161838-155161860 ATAGATTAAACATCTCCATTTGG + Intergenic
983076205 4:163330689-163330711 ACATTACATACATCACCAGTTGG + Intronic
984146651 4:176069829-176069851 ACAATACAAACAGCTCCACATGG + Intronic
986855804 5:11867460-11867482 ACAGAACTGACATCTCCATGTGG - Intronic
987007938 5:13730155-13730177 CCACAACAAACATTTCCATTTGG + Intronic
987224467 5:15825356-15825378 ACAGTAAAACCATCTTTATTTGG + Intronic
987495799 5:18642894-18642916 ACAGTGCCAGCATCTGCATTTGG - Intergenic
989711094 5:44398248-44398270 GCAGAACAAACCTCTACATTTGG - Intergenic
994064008 5:95514368-95514390 GCAGTACAAAAATCTGAATTTGG + Intronic
994981038 5:106875425-106875447 ACAGAAAAAACATTTCCATCTGG + Intergenic
995402105 5:111754957-111754979 AGAGTATAAACATCTGCAGTAGG + Intronic
996699139 5:126431912-126431934 ACAAAACAAAAATCCCCATTAGG - Intronic
997424548 5:133794326-133794348 ACACTACAAGCATATCCATCAGG + Intergenic
998223265 5:140305520-140305542 ACAGTCCATACATCTCTATGAGG - Intergenic
1001201019 5:169716839-169716861 ACACAAGAAACATCTGCATTAGG + Intronic
1001324109 5:170707666-170707688 ACATTAAAAACATACCCATTTGG + Intronic
1002083527 5:176752406-176752428 ACATTACAAACATATCCACGTGG + Intergenic
1003307853 6:4945650-4945672 ACAGTACAAAGACCTCTATCTGG - Intronic
1004334539 6:14752469-14752491 CCAGTACTTACATCTCCATGGGG - Intergenic
1007161664 6:39796081-39796103 TCATTGCAAACATCTCCAGTGGG + Intronic
1007874111 6:45076442-45076464 ACAGGAAGAACATCTCCATCTGG - Intronic
1009796525 6:68476185-68476207 ACAGTACTATCATCTAAATTAGG - Intergenic
1009833043 6:68963633-68963655 ACAGTGCAAACAGCACCATAAGG - Intronic
1010358133 6:74959862-74959884 AAAGTGAAAACATCTTCATTAGG - Intergenic
1011013437 6:82727617-82727639 ACATTACAAACATATCCATAAGG + Intergenic
1012920230 6:105214648-105214670 ACAGTATAAACAACTGCATTTGG - Intergenic
1014583823 6:123172399-123172421 TCAGTTCTAACATTTCCATTTGG - Intergenic
1016603495 6:145890710-145890732 ACAGAATAGAAATCTCCATTTGG + Intronic
1017424769 6:154308963-154308985 AAAGTGTAAACATCTACATTTGG + Intronic
1018886913 6:167947113-167947135 ACATTAATAACATCTCTATTTGG + Intronic
1019112476 6:169727072-169727094 ACCTTACTAACTTCTCCATTAGG - Intergenic
1021339136 7:19441424-19441446 ACAGAACAAGCATCTTCACTGGG - Intergenic
1021934809 7:25619530-25619552 ACAGTGCAAAAATCTCTATTTGG + Intergenic
1022753721 7:33261013-33261035 AGACTACAAATATTTCCATTTGG - Intronic
1024137613 7:46426688-46426710 TCAGTTCTAACATTTCCATTTGG - Intergenic
1024439647 7:49401648-49401670 AAAGCTAAAACATCTCCATTTGG + Intergenic
1027047726 7:75002240-75002262 TCAGTTCAAACATCTCCTCTGGG - Intronic
1027362473 7:77423614-77423636 ACAGTACAAACATCAAAATCAGG - Intergenic
1027611356 7:80365227-80365249 ACATTACAAATATATCCCTTTGG - Intergenic
1029385271 7:100239408-100239430 CCAGTTCAAACATCTCCTCTGGG + Intronic
1030371216 7:108701489-108701511 ACATGACAAAAATCTTCATTAGG + Intergenic
1031945655 7:127837272-127837294 ACTTTACAAACATCTCAATTTGG - Intronic
1032081039 7:128858632-128858654 ACACTACAAACACCTGCCTTGGG + Exonic
1032091210 7:128912525-128912547 ACACTACAAACACCTGCCTTGGG - Intergenic
1034447690 7:151121951-151121973 ACAGCACAACCATGTCCAGTAGG - Intronic
1035955926 8:4079723-4079745 TCACTACAAAAATATCCATTGGG - Intronic
1036171070 8:6485364-6485386 AGTGCTCAAACATCTCCATTTGG - Intronic
1037004413 8:13759551-13759573 ACAGTACAGACTCCTCCTTTAGG - Intergenic
1037589710 8:20302880-20302902 ACAGTTCAAACCTTTCCACTTGG + Intronic
1042477822 8:69268894-69268916 ACACTATAAACATAGCCATTTGG - Intergenic
1045572467 8:103382532-103382554 CCAGTAGAAGCATCTCCTTTTGG - Exonic
1051161236 9:14210153-14210175 ACACTACAAACATTTTCCTTTGG + Intronic
1052361418 9:27564605-27564627 AAAGTACAAACATAACAATTTGG + Intronic
1055876639 9:80951138-80951160 ACAGTACAATAATCTAAATTAGG - Intergenic
1057146404 9:92762085-92762107 GAAGTACAAGCAACTCCATTTGG + Intronic
1058473828 9:105309540-105309562 ACAGTACAAAGAAGTCCATAGGG - Intronic
1058839750 9:108894879-108894901 ACAGGAAACACCTCTCCATTAGG - Intronic
1059528996 9:115018479-115018501 ACAGTCAAAATATCTCTATTGGG - Intergenic
1061192667 9:129090816-129090838 CCAGGATAAACATCTCCACTTGG + Intergenic
1191806153 X:65135864-65135886 TCAGTTCTAAAATCTCCATTTGG + Intergenic
1192372652 X:70527682-70527704 ACAGTACAACCATCAAAATTAGG - Intergenic
1194202211 X:90966629-90966651 ACAGTACAACTATCAACATTGGG + Intergenic
1194869773 X:99114950-99114972 ACAGGACAAACATATCAGTTAGG - Intergenic
1195604500 X:106787927-106787949 ACAGCACAACTATCTCCATCAGG - Exonic
1200548048 Y:4542083-4542105 ACAGTACAACTATCAACATTGGG + Intergenic