ID: 1150591143

View in Genome Browser
Species Human (GRCh38)
Location 17:66563801-66563823
Sequence CTGTCTGTGCAGAGGTACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150591141_1150591143 -4 Left 1150591141 17:66563782-66563804 CCAAATGGAGATGTTTGTACTGT 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150591143 Original CRISPR CTGTCTGTGCAGAGGTACGT TGG Intronic
900493555 1:2965546-2965568 CTGTCTGTTCAGAGATATGGTGG + Intergenic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
901042537 1:6374200-6374222 CTGTTTGGGCTGAGGGACGTGGG - Intronic
901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG + Intronic
904354721 1:29931494-29931516 CTCTCTGTGCAGAGACACTTCGG - Intergenic
904824431 1:33265367-33265389 CTGTCTGTGCCCAGGTCAGTGGG - Intronic
906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG + Intergenic
908657475 1:66403394-66403416 TGGTCTGTGCAGAGATACGAAGG - Intergenic
910723617 1:90314665-90314687 CAGGCTGTGCAGAGGAACATGGG + Intergenic
911263466 1:95715357-95715379 CTGTCTGTCCAAAGCTAGGTGGG - Intergenic
912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG + Intronic
922097511 1:222454962-222454984 GTGTCAGTACAGAGGAACGTCGG + Intergenic
924165428 1:241276960-241276982 GTCTCTGGGCAGAGGTACGAAGG - Intronic
1063374299 10:5544835-5544857 GTGTGTGTGCACATGTACGTGGG - Intergenic
1071561883 10:86651682-86651704 CTATCAGTGCAGAGGTCCCTGGG + Intergenic
1072115499 10:92366736-92366758 CTGTGTGTGCAGAGACACCTGGG + Intergenic
1073839485 10:107482152-107482174 CTGTCTTTGCAGATGAACGGAGG - Intergenic
1073941390 10:108702822-108702844 ATGTGTGTGCTGATGTACGTAGG + Intergenic
1074060173 10:109958190-109958212 GTTTCTGAGCAGAGGTATGTAGG + Intergenic
1074347192 10:112698803-112698825 CTGACTTTCCAGAGGTTCGTTGG + Intronic
1076299240 10:129412150-129412172 ATAACTGTGGAGAGGTACGTGGG + Intergenic
1076573118 10:131445451-131445473 CTGTCTGTGCAGTGGTCCTGTGG - Intergenic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1082592122 11:55024877-55024899 GTGTCTGTGAAGAGATACTTGGG - Intergenic
1083270730 11:61571201-61571223 GTGTCTGTGCAGAGGCACATGGG - Intronic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1085053571 11:73391902-73391924 ATGTCTGGGCACAGGGACGTGGG - Intronic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1086071390 11:82803476-82803498 CTTTCTGTTCAGAGGTCCCTTGG - Intergenic
1090816087 11:130297419-130297441 CTGCTTGTGCAGAGGTAAGTTGG - Intronic
1095584681 12:43836511-43836533 GTGTGTGTGCAGAGATACGGCGG + Intronic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1100799031 12:98212215-98212237 CTGGCTGTGCAGCGGTGTGTGGG - Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1107490523 13:40876766-40876788 CTTTCTGGGCTGAGGTACCTTGG + Intergenic
1108505484 13:51108863-51108885 ATGGCTGTGCAGAGGCACATGGG - Intergenic
1110123545 13:71913017-71913039 CTTTGAGTGGAGAGGTACGTGGG - Intergenic
1110507267 13:76301513-76301535 CTGTCTGAACATAGGTACATGGG - Intergenic
1112683874 13:101800023-101800045 GTGTCTGTGGAGAAGTAGGTAGG - Intronic
1116139251 14:40968567-40968589 CTGTCTGAGGAGGGGTATGTAGG + Intergenic
1119790880 14:77348814-77348836 TTGTCTGTCCTGAGGTAGGTTGG - Intronic
1120386099 14:83847819-83847841 CTGTTTGTTCAGAGGTACTATGG + Intergenic
1121518902 14:94572188-94572210 CTGTCCCTACAGAGGTACATGGG + Intronic
1125161302 15:36647645-36647667 CTGTCTGTGCTAAGGTAAATTGG + Intronic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1132064903 15:98722785-98722807 CTGCCTTTGCAGAGGTCTGTGGG + Intronic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG + Exonic
1141517031 16:84552365-84552387 CTGTCTGCACAGAGGTATTTGGG - Intronic
1142487801 17:258138-258160 TCGTCTGTTCATAGGTACGTGGG + Intronic
1143276009 17:5711395-5711417 GTGTCTTTCCAGAGGTAGGTGGG - Intergenic
1143465601 17:7134255-7134277 CTGTCCTTGCCGAGGTCCGTGGG + Intergenic
1143644971 17:8224094-8224116 CTGTCTGTCCAGGGGAACCTGGG - Intergenic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1153313952 18:3703910-3703932 CTGCCTGTGAAGGGGAACGTGGG - Intronic
1158102997 18:53851904-53851926 CTTTCTATGAAGAGGTACCTAGG + Intergenic
1160202721 18:76808779-76808801 CTCTCTCTGCAGGGGTGCGTTGG - Intronic
925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG + Intergenic
927430330 2:23021902-23021924 CTCTCTGTGCAGACTTAGGTGGG - Intergenic
930271285 2:49260549-49260571 GTTTCTGTGGAGAGGTAGGTAGG + Intergenic
932421205 2:71602528-71602550 ATGTCAGTGCAGAGGGACGCTGG - Intronic
933801098 2:85961077-85961099 CTGGCTGTGGAGAGGACCGTGGG - Intergenic
933993028 2:87647259-87647281 CTGTCTCTGCAGAGGCCCCTTGG - Intergenic
934158022 2:89221340-89221362 CTGACAGTGCAGAGGCAGGTGGG - Intergenic
934209243 2:89961084-89961106 CTGACAGTGCAGAGGCAGGTGGG + Intergenic
934946834 2:98548383-98548405 CTGGCTGTGCAGAGCTGCGGTGG - Intronic
935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG + Intergenic
936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG + Intergenic
937098815 2:119253045-119253067 TTCTCTGGGCAGAGGTACGGAGG + Intronic
937566049 2:123290241-123290263 CTGTGTGTGCAGAGTTAACTGGG - Intergenic
941232974 2:162934232-162934254 CTCTCTGTCCAGAGGAACTTTGG + Intergenic
942490032 2:176480791-176480813 ATGGCTGTGCAGAGGAAGGTTGG + Intergenic
943066194 2:183089299-183089321 CTGCCTGTCCAGAGGTATTTTGG - Intronic
947563160 2:231175812-231175834 CTGTTTGTGCAGAGATTCTTTGG + Intergenic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
949035589 2:241814493-241814515 CTGTCCGTGAAGGGGTACGAGGG - Exonic
1169119152 20:3084881-3084903 CTGTCTGTGCAGGGGATCATAGG + Intergenic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1177628967 21:23701890-23701912 GTGTCTGTGCAAAGGTAGGATGG - Intergenic
1179554207 21:42162302-42162324 ATGGCTGTGCAGGGGTAAGTTGG + Intergenic
1179554383 21:42163094-42163116 ATGTCTGTGCAGGGGTTAGTCGG + Intergenic
1181795000 22:25301473-25301495 CTGTCTGTGAAGAGGGTCTTTGG + Intergenic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG + Intronic
950523913 3:13512599-13512621 CTGTCTGTGCAAGGAGACGTTGG - Intergenic
952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG + Intergenic
952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG + Intergenic
953586630 3:44207064-44207086 CTGGCTGTGCAGCTGTGCGTGGG - Intergenic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
958854561 3:99368868-99368890 ATGTGTCTGCAGAGGTATGTTGG + Intergenic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
967829824 3:193909382-193909404 CTGTCTTTGCAGGGGTTCCTGGG + Intergenic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
969070473 4:4534096-4534118 CTGGCTGGGCATAGGTACATAGG + Intronic
969570579 4:8005967-8005989 CTGCCTGTGCAGATGCACGCAGG - Intronic
974827655 4:67151548-67151570 CTGGCTGTGCAGCTGTGCGTGGG - Intergenic
977306560 4:95330543-95330565 CTGTCTGTACATAGGAAAGTTGG + Intronic
978833150 4:113113758-113113780 TTGTCTGTGCAGAGGTCAGCTGG + Intronic
985923610 5:2998844-2998866 CTGTCTCTGCAGAACTAAGTAGG - Intergenic
986046751 5:4045177-4045199 CTGTCTGTGCTGAGCTGCCTGGG - Intergenic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
990514218 5:56517078-56517100 CTGACTGTGCAGAGCAACTTTGG + Intronic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
997414567 5:133715483-133715505 CTGTCTGTGCAAATGTTCTTGGG - Intergenic
997483269 5:134206054-134206076 CTGTCTGTGGAGATGTGCATGGG - Exonic
1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG + Intronic
1008514600 6:52307281-52307303 CTGTCTGTCCATCGGTCCGTGGG - Intergenic
1013165682 6:107589800-107589822 CTATCTATGAAGAGGTAGGTGGG - Intronic
1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG + Intronic
1017858461 6:158373018-158373040 CTGTCTGAGCAGTGTTAAGTTGG - Intronic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1020241700 7:6400175-6400197 ATGTCCGTGCAAAGGTAGGTGGG + Exonic
1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG + Intergenic
1031690569 7:124782703-124782725 CTGTCTGTGGAGGGGCCCGTGGG + Intronic
1032311591 7:130792435-130792457 ATGTATGTGCAGAGGTCTGTGGG - Intergenic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1038645099 8:29354396-29354418 CTTGATGGGCAGAGGTACGTAGG - Intergenic
1043442103 8:80285288-80285310 CTGTCTGTGCAGATGTCAGAAGG + Intergenic
1048005606 8:130417181-130417203 GTGTGTGTGCAGTTGTACGTGGG - Intronic
1049339041 8:142102089-142102111 GTGTCAGTGCACAGGTGCGTGGG + Intergenic
1062127237 9:134870314-134870336 GTGTGGGTGCAGAGGTCCGTGGG + Intergenic
1189995846 X:46636683-46636705 CTGTCTGTGCTGTGGCACTTTGG - Intronic
1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG + Intergenic
1190978725 X:55434578-55434600 CAGTTTGTGGAGAGGTACCTGGG + Intergenic
1194909613 X:99624903-99624925 CTGTCTGAGGAGAAGTACCTAGG + Intergenic
1195947269 X:110228608-110228630 CTGTCAGTGCTGAGTTATGTTGG - Intronic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG + Intergenic
1196487187 X:116225776-116225798 CTGCTTGTGGAGAGGTACATTGG + Intergenic
1196685650 X:118508228-118508250 CTGGCTCTGCAGAGGTACCTGGG + Intronic
1200083506 X:153591410-153591432 CTGGCTGTGCAGGGTTACCTGGG + Intronic