ID: 1150599653

View in Genome Browser
Species Human (GRCh38)
Location 17:66639699-66639721
Sequence ATTAATAAACAGAGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 522}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150599644_1150599653 30 Left 1150599644 17:66639646-66639668 CCAAAGTGCTGAGATTACAGGTG 0: 4646
1: 81750
2: 216607
3: 252973
4: 200794
Right 1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG 0: 1
1: 0
2: 4
3: 56
4: 522
1150599647_1150599653 -5 Left 1150599647 17:66639681-66639703 CCTGGCCTACCTTTATATATTAA 0: 1
1: 0
2: 2
3: 66
4: 638
Right 1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG 0: 1
1: 0
2: 4
3: 56
4: 522
1150599646_1150599653 3 Left 1150599646 17:66639673-66639695 CCACTGTGCCTGGCCTACCTTTA 0: 2
1: 24
2: 301
3: 2150
4: 9420
Right 1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG 0: 1
1: 0
2: 4
3: 56
4: 522
1150599648_1150599653 -10 Left 1150599648 17:66639686-66639708 CCTACCTTTATATATTAATAAAC 0: 1
1: 0
2: 1
3: 27
4: 421
Right 1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG 0: 1
1: 0
2: 4
3: 56
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150599653 Original CRISPR ATTAATAAACAGAGGAGGCT GGG Intronic
900300042 1:1972548-1972570 AATAATAAAATCAGGAGGCTGGG + Intronic
900907267 1:5568208-5568230 ATAAAGAAACACAGGAGGCTGGG - Intergenic
901104664 1:6745826-6745848 TTTAATTGATAGAGGAGGCTGGG + Intergenic
901111951 1:6804311-6804333 ATTAAAAAACAAATCAGGCTGGG - Intronic
901245534 1:7727415-7727437 ATTAATACAAAGCAGAGGCTGGG - Intronic
901313504 1:8288860-8288882 AATAAAAAACAGAGTAGGCTGGG - Intergenic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
901857024 1:12051154-12051176 ATTAATAAATAGAGCAGGCCGGG - Intergenic
901890488 1:12259302-12259324 AAAAATAAAAAGAGTAGGCTGGG - Intronic
902347237 1:15827393-15827415 ATTGATAAAAAGAGGAGGCAAGG - Intergenic
903547827 1:24137810-24137832 AAAAATAAACAGAATAGGCTGGG - Intronic
904250042 1:29216837-29216859 AGAAATCAACACAGGAGGCTGGG + Intronic
904572708 1:31478863-31478885 ATAAAATCACAGAGGAGGCTGGG + Intergenic
904746242 1:32713011-32713033 ATTTGAAAACAAAGGAGGCTGGG - Intergenic
904789568 1:33008883-33008905 AAGAATAAACAGAGAAGACTGGG - Intronic
904951567 1:34245303-34245325 TTTAAAAAACAGTGGGGGCTGGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
906692997 1:47805056-47805078 ATTAAAGAGGAGAGGAGGCTAGG + Intronic
906972799 1:50534567-50534589 AAAAATCAACAGAAGAGGCTGGG - Intronic
907169664 1:52450968-52450990 AATAATACAGAGAGTAGGCTGGG + Intronic
908640883 1:66222051-66222073 ACAAAAAGACAGAGGAGGCTGGG - Intronic
908744127 1:67359424-67359446 ATTAAAAATTAGTGGAGGCTGGG + Intronic
909145277 1:71922323-71922345 ACTAAAAAACATAGTAGGCTGGG + Intronic
910038454 1:82818151-82818173 ATTAATAAACAGGGTTGGCCGGG + Intergenic
910055458 1:83028427-83028449 ATTAATAAACTAAGGATACTAGG - Intergenic
911792195 1:102031715-102031737 ATGAACAAATAGAGCAGGCTTGG - Intergenic
913423704 1:118702970-118702992 ATTAATAACAAGAGGAACCTGGG - Intergenic
913973600 1:143436070-143436092 TCTAATGAACACAGGAGGCTTGG - Intergenic
914067988 1:144261677-144261699 TCTAATGAACACAGGAGGCTTGG - Intergenic
914111167 1:144704677-144704699 TCTAATGAACACAGGAGGCTTGG + Intergenic
914206509 1:145535048-145535070 TTTAATAAACAAAAGAGGCATGG + Intergenic
914423892 1:147556417-147556439 ATAAATAAATAAATGAGGCTGGG - Intronic
914802201 1:150969932-150969954 ATTAAGAGACAGGGTAGGCTGGG + Intronic
915172832 1:153990065-153990087 ATAAATAAACAGGGGAGACATGG - Intergenic
915235961 1:154482307-154482329 ATTAATAAAGAATGTAGGCTGGG - Exonic
916499544 1:165375244-165375266 AGTAATTAACAGTGGAGGTTGGG - Intergenic
916585054 1:166143192-166143214 ATTAATATATAGTAGAGGCTGGG + Intronic
916592847 1:166209756-166209778 ATAAATAAAAAGACAAGGCTGGG - Intergenic
916622704 1:166518049-166518071 ATTAATAAATAGAGAAGCCTTGG - Intergenic
916897266 1:169178132-169178154 ATTAAGAAAGAGGAGAGGCTGGG - Intronic
917573774 1:176297642-176297664 ATAAATAAAAAGAGGAGCTTTGG - Intergenic
917821903 1:178771132-178771154 ATTAATACATAAAGAAGGCTGGG - Intronic
919685006 1:200476180-200476202 ATAAATACACAGAGGAGGTGTGG + Intergenic
920057930 1:203206206-203206228 AATAATAAACTGATGAGGCCAGG - Intergenic
920106089 1:203554722-203554744 ATAAATAAACAAATAAGGCTGGG + Intergenic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
921720656 1:218467088-218467110 ATTAATTAACAGAGGAAGTTGGG + Intergenic
921742835 1:218706217-218706239 ATTCAAAAAAAGTGGAGGCTTGG + Intergenic
922009188 1:221564010-221564032 ACTCATAAACTGAGGAGGCCAGG + Intergenic
922660770 1:227428810-227428832 ATCTGTAAACAGAGGAGGTTGGG - Intergenic
923188552 1:231597575-231597597 ATTAAAAAAAAGAAGAGGCCGGG - Intronic
924326955 1:242905043-242905065 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
924353772 1:243147883-243147905 TTTAAAAAACAAAAGAGGCTGGG + Intronic
924560260 1:245153155-245153177 TTTAATCAACAGAGGGCGCTCGG + Intergenic
924563779 1:245179326-245179348 ATTCAAAAACAAAGGAGGCCGGG + Intronic
924745155 1:246825179-246825201 ATTAAAAGACTGAGAAGGCTGGG - Intergenic
1063122565 10:3115074-3115096 AGGCATAAACAGAGGAGGCAAGG + Intronic
1063150261 10:3330476-3330498 AATAATTCACTGAGGAGGCTGGG + Intergenic
1064407511 10:15077449-15077471 AATAATAGACACTGGAGGCTTGG + Intergenic
1064520945 10:16200185-16200207 ATTAAAAGAAAAAGGAGGCTGGG + Intergenic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1065021437 10:21504846-21504868 ATTAAGAAACAGAGAAGGCCGGG - Intergenic
1065333976 10:24635838-24635860 ATTAAGAAGCAGTAGAGGCTGGG - Intronic
1065348138 10:24769086-24769108 ATTAATTAATAAATGAGGCTGGG + Intergenic
1066748233 10:38624549-38624571 AATAAGAAACACATGAGGCTAGG + Intergenic
1067143230 10:43673625-43673647 ATCAATAAACAAAGCATGCTTGG - Intergenic
1067537901 10:47128695-47128717 AATAATAAAGAAAGGAGGCCGGG + Intergenic
1067669192 10:48304324-48304346 ATTAAACATAAGAGGAGGCTTGG - Intergenic
1069130714 10:64698625-64698647 ACTACTAGACAGAGGAGGATGGG + Intergenic
1069317982 10:67131525-67131547 ATTGGTGAACAAAGGAGGCTTGG + Intronic
1070208632 10:74291120-74291142 AAAAATAAACAAAAGAGGCTGGG + Intronic
1070348172 10:75565777-75565799 ATTAAAGGACAGAGGAGGCTGGG + Intronic
1070674523 10:78403203-78403225 ATAAATAAATAAAGGAGGGTGGG + Intergenic
1070745425 10:78930897-78930919 TTTAATGAACAGAGGTGGTTAGG - Intergenic
1071315700 10:84394926-84394948 GTTAATAAACAGAGTAGGCGGGG + Intronic
1071556656 10:86608680-86608702 GTTAAAACACTGAGGAGGCTCGG - Intergenic
1071959539 10:90796719-90796741 ATTAAAAAACAGACAAGGCTAGG + Intronic
1072011743 10:91307925-91307947 ATTAAGAATCAGAACAGGCTGGG + Intergenic
1072075079 10:91963033-91963055 ATTAATAATGAGAGGAGGAGAGG - Intronic
1073010836 10:100358297-100358319 TTTAATAAACATAGTAGGCCAGG - Intronic
1073167655 10:101471613-101471635 TTTAGAAAACAGAGGAGGATGGG - Intronic
1073266944 10:102233597-102233619 AATAATAAACAAAACAGGCTGGG - Intronic
1073524440 10:104166365-104166387 AAAAATACATAGAGGAGGCTGGG - Intronic
1073883632 10:108011888-108011910 ATTAAGGGACAGAGGAGGCTAGG - Intergenic
1074141728 10:110679514-110679536 ATTATTAACAAGAAGAGGCTGGG - Intronic
1074228945 10:111514716-111514738 ATAGATAGACAGAAGAGGCTGGG - Intergenic
1076436834 10:130452280-130452302 ATCAACAAACAGAGGAGGCGGGG - Intergenic
1078181219 11:9012813-9012835 AAAAATGGACAGAGGAGGCTGGG - Intergenic
1078798627 11:14620236-14620258 ATGAATAAACAGAGGAGTTCAGG - Intronic
1079072451 11:17359409-17359431 TTCAATAAACAGAGGATGGTGGG - Intronic
1079806748 11:24940464-24940486 AGTATTAAACACAGCAGGCTTGG - Intronic
1079959596 11:26906635-26906657 ATTAATAAAAAGAAGGGGCTTGG - Intergenic
1080492221 11:32778514-32778536 ATTAAGAATCAGAGAAGGCCGGG + Intronic
1080920422 11:36703422-36703444 ATTAAAAAACAGAGGACTCAAGG - Intergenic
1083908801 11:65692957-65692979 ATCAATAAATAGATGAGGCCGGG + Intergenic
1083914646 11:65733447-65733469 ATTATTAAAAAGATGAGGCTGGG + Intergenic
1084077502 11:66792103-66792125 ATTATTAGAGAGAGGAAGCTGGG - Intronic
1084387785 11:68854928-68854950 ATAAATAAAAAGAGGAGCCGAGG - Intergenic
1084887051 11:72217545-72217567 AGCAATGAACAGAGGAGGCGAGG + Intronic
1085596245 11:77813077-77813099 GTTAATAAACAGAAGAAGCAGGG - Intronic
1085893990 11:80614996-80615018 ATCAATAAAATGAGAAGGCTAGG - Intergenic
1085986541 11:81794231-81794253 ATTAAGAAACATCTGAGGCTGGG - Intergenic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1086656489 11:89363454-89363476 CTTAATAAACAGAGCTGCCTTGG - Intronic
1087763070 11:102122596-102122618 ATAAAGAAAAAGAGCAGGCTGGG + Intronic
1088120323 11:106361355-106361377 ATTAAGAACCAGAGGAGGCTGGG - Intergenic
1088844231 11:113651530-113651552 CTTAATAACCAGAGGAGCCTAGG + Intergenic
1089011303 11:115134224-115134246 ATTAAAAAACAAAGGTGGCTGGG + Intergenic
1089477710 11:118778882-118778904 ATTAATAAAAAAAGGGGGCCAGG + Intronic
1089916623 11:122163291-122163313 ATTTGTAAACAGAAAAGGCTGGG + Intergenic
1090069730 11:123533259-123533281 ATTAATAAACAGGCCAGGCGCGG - Intronic
1090955459 11:131509727-131509749 ATTAATCATGAGAGGAGGTTGGG + Intronic
1091152337 11:133340444-133340466 ATTAATAAAAAGAGGAGGTGGGG - Intronic
1091380135 12:52573-52595 AATAATAATAACAGGAGGCTGGG + Intergenic
1091701821 12:2668438-2668460 CCTAATACACAGAGGATGCTGGG - Intronic
1092087552 12:5775891-5775913 AGTAGTAAACAGAGGAGTGTGGG + Intronic
1092730913 12:11533592-11533614 ATTTATAAAGAAAGGAGGTTTGG + Intergenic
1092870097 12:12798513-12798535 ATAAATAAAAAGAAGAGGATTGG + Intronic
1093031441 12:14292801-14292823 ATTAAAAAACAGAGGAGACTTGG + Intergenic
1093145231 12:15557328-15557350 ATTAAAAAAAAGAAGAAGCTAGG - Intronic
1093343492 12:18009352-18009374 ATTAATAAAGAGATAAGTCTAGG - Intergenic
1094235676 12:28163126-28163148 ATGAAATAACAGAGGAGGCCAGG + Intronic
1094677712 12:32637294-32637316 ATTTATAAATAAAGGAGGCTTGG + Intronic
1095357161 12:41288845-41288867 ATTAATACATACAGAAGGCTTGG - Intronic
1095459339 12:42425680-42425702 TTTAAAAACCTGAGGAGGCTGGG - Intronic
1096074470 12:48794064-48794086 ATAAATGAATAGATGAGGCTGGG + Intergenic
1096319043 12:50594237-50594259 AAAAAGAAACAAAGGAGGCTGGG - Intronic
1096393947 12:51251283-51251305 AATAATATATGGAGGAGGCTGGG + Intronic
1096633592 12:52945031-52945053 ATTAATAAACATGGGGTGCTAGG - Intronic
1097008906 12:55938641-55938663 CTTAAGAAACAGAAGAGGATGGG + Intronic
1097354935 12:58590616-58590638 ATAAATAAATAAAGGAGGATTGG + Intronic
1097910052 12:64959781-64959803 TTTAATAAACAGAAGAGGCCGGG + Intergenic
1098220866 12:68268291-68268313 ACTTATAAACTGAGGAGGATTGG + Intergenic
1099269049 12:80484300-80484322 ATTAGAAAACAGACTAGGCTAGG - Intronic
1099319919 12:81133309-81133331 CACAATGAACAGAGGAGGCTTGG - Intronic
1100544374 12:95587331-95587353 ATTTATAAAATGGGGAGGCTGGG + Intergenic
1101615045 12:106328248-106328270 CTAAGTAAACAGTGGAGGCTGGG + Intronic
1102065916 12:109975507-109975529 ATTAAAAAACAAAAGGGGCTGGG - Intronic
1102402709 12:112644120-112644142 AATAATAAACACTGGAGACTTGG + Intronic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103259275 12:119572631-119572653 AAAGAAAAACAGAGGAGGCTGGG + Intergenic
1103302620 12:119939708-119939730 ATTAACAAAAAGAGGAGGGGGGG - Intergenic
1103653511 12:122452189-122452211 TTTAAAAAAATGAGGAGGCTGGG - Intergenic
1105020845 12:132815901-132815923 ATTAAAAAACAAAACAGGCTGGG + Intronic
1105213889 13:18273469-18273491 ATTAACAGACGGGGGAGGCTGGG - Intergenic
1106811685 13:33364592-33364614 ATTAAGAAAAAGAGGAGGCTGGG + Intergenic
1106972772 13:35163356-35163378 ATTAAAAAACAGTTCAGGCTAGG + Intronic
1108524444 13:51274179-51274201 ATTAATAAACAGAAAAGGGCTGG - Intronic
1111453185 13:88446077-88446099 ATTATGAAACTGATGAGGCTGGG - Intergenic
1111984075 13:95047776-95047798 ATTATTAAAAATAGGCGGCTGGG - Intronic
1115500580 14:34045992-34046014 ATTAAAAAATAGAATAGGCTGGG - Intronic
1115559595 14:34571022-34571044 CTTAATAAAAAGAGAAGGCTGGG - Intronic
1116004501 14:39277951-39277973 ATTAAAAAAAAGATGAAGCTGGG - Intronic
1116501689 14:45631872-45631894 ATTAAAAAGTAGAAGAGGCTGGG + Intergenic
1116864034 14:50017012-50017034 AATAAGACACACAGGAGGCTGGG - Intergenic
1117215646 14:53549135-53549157 TTTAAAAAAGAGAGCAGGCTTGG + Intergenic
1117415142 14:55487920-55487942 ATTAAAAAACAAAGCAGGCCAGG - Intergenic
1117741063 14:58819864-58819886 TTTCATCATCAGAGGAGGCTGGG + Intergenic
1118018455 14:61685539-61685561 ATTAATAAACAGAAAAGGATAGG - Intergenic
1118645857 14:67838739-67838761 ATTAATAAAAACAGAAGGCCAGG - Intronic
1118834058 14:69463523-69463545 ATTAAAAAACAGATCAGGCCGGG - Intergenic
1119249174 14:73137163-73137185 ATTAATCCATAGTGGAGGCTGGG + Intronic
1119868842 14:77995732-77995754 TTTAATAAACAGGGGTGGCTGGG + Intergenic
1119935692 14:78590462-78590484 TTTCATAAGCAGTGGAGGCTTGG + Intronic
1119984666 14:79123792-79123814 ATGAATAAGCAGAGCAGGCCAGG + Intronic
1120178100 14:81316718-81316740 ATTTATAAAGAAAGGAGGTTTGG + Intronic
1120394377 14:83950164-83950186 ATTAATAACAATAGGAGGTTTGG - Intergenic
1120445794 14:84593936-84593958 ATTAATAGAAAAAGGAGTCTAGG - Intergenic
1120592687 14:86394667-86394689 ATTTATAAACAAAAGAGGCTGGG + Intergenic
1120716335 14:87844913-87844935 AGCAATAATCAAAGGAGGCTGGG + Intronic
1120930820 14:89846576-89846598 ATTAATGTACAGAGAAGCCTGGG - Intronic
1122015486 14:98791795-98791817 ATCAATACACAGAGGAGGGCTGG + Intergenic
1123398300 15:19958867-19958889 ATAAATAAACAAAAGAGCCTGGG + Intergenic
1123431321 15:20219450-20219472 ATCAAGAAACAGAGCAGGCCGGG + Intergenic
1123693367 15:22858096-22858118 ATTAATAAATTGGAGAGGCTGGG + Intronic
1123752266 15:23365615-23365637 AGTAATAAACAGTGCACGCTTGG - Intronic
1124056755 15:26247449-26247471 AAAAATTAACAAAGGAGGCTGGG - Intergenic
1125843181 15:42824949-42824971 ATAAAAAAGCAGAGGAGGCCAGG + Intronic
1127053455 15:55108563-55108585 AGTAAGAAACTGAGGAAGCTAGG + Intergenic
1127684886 15:61333750-61333772 GTTAATAAACAAAGGAGTGTTGG + Intergenic
1128205538 15:65848532-65848554 AGAAATAAACAGAGCAGGCAAGG - Intronic
1128213870 15:65920951-65920973 CTTATTAAACACAGGAGACTAGG - Intronic
1128277493 15:66365838-66365860 ACTAATATGCAGAGCAGGCTGGG - Intronic
1128627840 15:69229912-69229934 AATAGTAAACAGCTGAGGCTGGG + Intronic
1128834621 15:70799207-70799229 ATTAACATCCAGAGAAGGCTTGG - Intergenic
1129013715 15:72446720-72446742 ATTTAAGACCAGAGGAGGCTGGG - Intergenic
1129341021 15:74886795-74886817 ATTTATAAAGAAAGGAGGTTTGG + Intergenic
1129572881 15:76708768-76708790 AAGAATGAAAAGAGGAGGCTGGG + Intronic
1129632412 15:77275420-77275442 TTTAAGAAACAAATGAGGCTGGG + Intronic
1130644499 15:85712127-85712149 ATTAAAACACAGACCAGGCTGGG - Intronic
1133746507 16:8691147-8691169 GATAATAAACAGAGGAGGTGTGG - Intronic
1134568615 16:15272738-15272760 CTTTATAATCAGAGCAGGCTGGG + Intergenic
1134610927 16:15607251-15607273 ATTAAAAAACAGTGGGGGCTGGG + Intronic
1134733818 16:16483624-16483646 CTTTATAATCAGAGCAGGCTGGG - Intergenic
1134909977 16:18016933-18016955 AATAATAAACATTGGAGACTTGG + Intergenic
1134933682 16:18228658-18228680 CTTTATAATCAGAGCAGGCTGGG + Intergenic
1135545954 16:23366817-23366839 ATTAAAAATAAGAGGAGGTTGGG - Intronic
1135990923 16:27218297-27218319 ATAAATAAATAAAGGAGGCCAGG + Intronic
1136006716 16:27335528-27335550 ATCAATAAATGGAGGAGGCCGGG - Intronic
1137832735 16:51559681-51559703 ATTAACAAATATAGGAAGCTTGG + Intergenic
1138196475 16:55055801-55055823 ATAAATAAAGGGAGGAGGTTGGG - Intergenic
1138447548 16:57073887-57073909 ATTAAGAAACAGAACTGGCTGGG - Intronic
1138701044 16:58863965-58863987 ATTAATGCATAGAGCAGGCTTGG - Intergenic
1138845798 16:60564207-60564229 ATGAATAATTAGAGGAGGCTAGG + Intergenic
1139445914 16:66998571-66998593 CTAAAGAAAGAGAGGAGGCTGGG + Intronic
1140715364 16:77721582-77721604 ATTAGGAGACAGAAGAGGCTTGG - Intergenic
1140974734 16:80048301-80048323 ATTAAAAAACAGTGGAGACAAGG + Intergenic
1141167995 16:81673218-81673240 ATTAATAAGCAGGTGAGGCTGGG + Intronic
1142406867 16:89894938-89894960 ATTTAAAACCAGCGGAGGCTGGG - Intronic
1142844538 17:2662698-2662720 ATAAAGAATCAGAGAAGGCTGGG - Intronic
1142886847 17:2918133-2918155 ATTTATAAAGAAAGGAGGTTTGG + Intronic
1143000120 17:3788593-3788615 ATCAAGAAACAGAACAGGCTGGG - Intronic
1143877494 17:10003208-10003230 AATGAGAAACAGAGGAGCCTGGG + Intronic
1147309120 17:39583844-39583866 ATTAATACCCAGAGGAAGCTAGG + Intergenic
1147406767 17:40218017-40218039 ATTATTAATCAGAGAAGGCAGGG - Intergenic
1148509782 17:48158663-48158685 ATTAAGAAACAGCAGAGGCCGGG + Intronic
1149151509 17:53570230-53570252 AAAAATAAACAGAGGAGGCCGGG + Intergenic
1149816707 17:59732536-59732558 ATTAACAAACAAATGAGGCCGGG - Intronic
1149822406 17:59792567-59792589 AATAATTATCAGATGAGGCTGGG + Intronic
1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG + Intronic
1151312284 17:73300566-73300588 AATAATAAACACTGGAGACTGGG + Intronic
1151350559 17:73529401-73529423 ATTATTAAACAAGGCAGGCTAGG + Intronic
1151410465 17:73923742-73923764 ATTATTAAACAGATGAGACGAGG + Intergenic
1151501442 17:74492241-74492263 ATAAATTATAAGAGGAGGCTGGG - Intergenic
1151664629 17:75538497-75538519 ATGAATGAACAGAGGAGGCGAGG - Intronic
1152043471 17:77920284-77920306 ATTAAAAAAAAGAAGAGGCTGGG + Intergenic
1152138634 17:78523149-78523171 ATAAATAGAAAAAGGAGGCTAGG - Intronic
1152425901 17:80218526-80218548 ATGGATGGACAGAGGAGGCTGGG + Intronic
1152814371 17:82398692-82398714 ATTAAAAAAAAAAAGAGGCTGGG - Intronic
1153650541 18:7236188-7236210 AGTAATAAAAAGAGGATGCAGGG + Intergenic
1155393265 18:25359885-25359907 AAAAATAAACAGAGAAGGATGGG - Intergenic
1155445100 18:25902871-25902893 ATTAAAAAATAGACAAGGCTGGG + Intergenic
1156143324 18:34143048-34143070 ATTAATAAAACGAGGAGGGAGGG + Intronic
1158738944 18:60117106-60117128 AATAATAGACACTGGAGGCTGGG + Intergenic
1158846442 18:61447839-61447861 GTTACTGAAAAGAGGAGGCTAGG - Intronic
1159798845 18:72871761-72871783 ATTAATTAACAAAGGAGCCCTGG - Intergenic
1159894085 18:73980307-73980329 ATCACTAACCAGAGGATGCTAGG - Intergenic
1161229526 19:3166307-3166329 AAAAAAAAAAAGAGGAGGCTGGG - Intergenic
1161754759 19:6124120-6124142 TTTAATAGACACAGGAGGCTGGG + Intronic
1161969224 19:7567279-7567301 ATTAAAAAAAATAAGAGGCTGGG + Intergenic
1162503953 19:11071393-11071415 AAAAATAAAGACAGGAGGCTGGG - Intergenic
1162507605 19:11095752-11095774 ATTAAAGAACAGAACAGGCTGGG - Intronic
1162547770 19:11340975-11340997 ATTAAAAAATAAATGAGGCTGGG + Intronic
1162749434 19:12819582-12819604 TTTAAGAAACAGAGTTGGCTGGG + Intronic
1162826335 19:13254655-13254677 ATTAATGAAATGAGGGGGCTGGG - Intronic
1162885407 19:13693382-13693404 AATAATAAAGACAGCAGGCTGGG - Intergenic
1162924143 19:13921319-13921341 ATTTAGCCACAGAGGAGGCTGGG + Intronic
1163494198 19:17635294-17635316 ATTAATAAACAGATGGGGTCAGG - Intronic
1165464947 19:35968463-35968485 ATTGATGAACAGAGAAGGATGGG - Intergenic
1165499462 19:36176409-36176431 GTAAAGAAACACAGGAGGCTGGG - Intergenic
1165534426 19:36431468-36431490 ATTAACACACAGAGGGGGTTGGG + Intergenic
1167412436 19:49352833-49352855 ATTAATAAGAAAAGGAGGCCAGG - Intronic
1167754945 19:51406643-51406665 ATCAAGAAACAGAGGAGGCTGGG + Intergenic
1168031764 19:53685540-53685562 ATTAAAAAAAATTGGAGGCTAGG - Intergenic
1168442449 19:56381555-56381577 ACTAAAAAACAGAGAAGGCAAGG + Intronic
925352014 2:3207760-3207782 ATTAAAAAACAAAAGTGGCTAGG - Intronic
925948443 2:8888730-8888752 ATTAAAAAACAGTTAAGGCTGGG + Intronic
925964491 2:9051416-9051438 AGTAATTAACACAGGAGGGTAGG + Intergenic
926617732 2:15014462-15014484 ATCAATAACAAGAGGAGCCTTGG + Intergenic
926714209 2:15911126-15911148 ATTACAATACTGAGGAGGCTGGG + Intergenic
926835276 2:17012321-17012343 ATTAATAAACTGTGTAGCCTTGG + Intergenic
926988982 2:18656423-18656445 ATTTATAAAATGAGGAGGCAGGG + Intergenic
927338253 2:21950355-21950377 ATAAAGAAAGGGAGGAGGCTGGG - Intergenic
928546412 2:32333098-32333120 AAAAATAAATAGAAGAGGCTGGG + Intergenic
929602857 2:43215473-43215495 TTTAAAAAACAGATGAGGCCAGG + Intergenic
929633515 2:43492015-43492037 TTTAAGATACAGAAGAGGCTGGG + Intronic
930464744 2:51733690-51733712 ATTAATGCCCAGTGGAGGCTGGG - Intergenic
930886321 2:56331203-56331225 AATAATAAACATTGGAGACTGGG + Intronic
931662125 2:64575333-64575355 AATATTTAACAGAGCAGGCTTGG + Intronic
932213481 2:69950544-69950566 GTTAAAAAATAGGGGAGGCTGGG + Intergenic
933490515 2:82980686-82980708 ATAAAGAAACATAGGTGGCTGGG + Intergenic
934178295 2:89597036-89597058 TCTAATGAACACAGGAGGCTTGG - Intergenic
934288589 2:91671328-91671350 TCTAATGAACACAGGAGGCTTGG - Intergenic
934300435 2:91773280-91773302 ATTAACAGACAGGGGAGGCTGGG + Intergenic
934311202 2:91866700-91866722 AATAAGAAACACATGAGGCTAGG + Intergenic
934551591 2:95266152-95266174 ATTTATAAAGAAAAGAGGCTGGG - Intergenic
934748338 2:96774666-96774688 GTTAAGAAAGAGAGCAGGCTGGG + Intronic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
935345479 2:102104002-102104024 AAAAAAAAAAAGAGGAGGCTTGG + Intronic
935712292 2:105909800-105909822 TTTGATGACCAGAGGAGGCTGGG + Intergenic
935817863 2:106864070-106864092 AGTAAAAGCCAGAGGAGGCTGGG + Intronic
936811774 2:116411564-116411586 ATTATGAAACAGAGAAGGATGGG - Intergenic
938402378 2:131004458-131004480 TTTAAAAAACAGAGAGGGCTGGG - Intronic
938728548 2:134128071-134128093 CTTAAGAAAAAGTGGAGGCTGGG + Intronic
939027638 2:137032999-137033021 CTTATTAAACAGAGGATACTGGG + Intronic
939035860 2:137130362-137130384 AATAATAAAAAGGTGAGGCTTGG - Intronic
939129458 2:138217011-138217033 ATTATTAATCAGAGAAGTCTTGG + Intergenic
939240096 2:139547044-139547066 ATTAAAAAACAGACGGGGCCGGG - Intergenic
939302760 2:140367168-140367190 ATTAATTAAGAGAGGCAGCTTGG + Intronic
940106890 2:150111164-150111186 ATCAATAAACACATGAGGCCAGG + Intergenic
940208360 2:151229774-151229796 ATAAATAAAATGAGGAGGCAAGG + Intergenic
940745317 2:157561179-157561201 ATTAATAAAAGGAGGGGGATTGG - Intronic
941095738 2:161238203-161238225 ATTAACAAACTGGGGAGTCTTGG - Intergenic
941705174 2:168650593-168650615 ATAAATAGACAAAGGGGGCTGGG - Intronic
942455571 2:176136212-176136234 AAAAAGAAACAGAGGAGGCGGGG + Intergenic
942586388 2:177483759-177483781 ATTATTAAGTAGAGGAGGATTGG + Intronic
943634921 2:190295990-190296012 ATTTATTAACAGTGTAGGCTGGG - Intronic
944617657 2:201478776-201478798 ATTCAAAATCAGAAGAGGCTGGG + Intronic
945822056 2:214676074-214676096 ATTAAAATACAGTGGGGGCTGGG + Intergenic
946102962 2:217342867-217342889 ATTAAGAAATAAATGAGGCTGGG + Intronic
946262344 2:218504733-218504755 ATAAATAAAATGAGCAGGCTAGG - Intronic
947535360 2:230937004-230937026 ATTAATAAACTTAGGAGACTAGG - Intronic
947556093 2:231094506-231094528 ATAAATAAACAGAGTAAGCAGGG + Intronic
947711296 2:232317730-232317752 ATTAAAAAATAGAAGAGGCTAGG - Intronic
947773786 2:232691619-232691641 AATAAAAAAGAGAGGGGGCTGGG + Intergenic
948823507 2:240562379-240562401 AGTAATAGAAAAAGGAGGCTGGG - Exonic
1169033299 20:2430070-2430092 CTCAATAAACAGAGAAGGATGGG + Intronic
1169482561 20:5997872-5997894 ATTGGAAAAGAGAGGAGGCTGGG - Intergenic
1169496923 20:6123709-6123731 TTAAATGAACAAAGGAGGCTTGG - Intergenic
1169667926 20:8059344-8059366 ATTAATCATCAAAGGAGGCCAGG - Intergenic
1171133589 20:22677286-22677308 CCTTATAAACAGGGGAGGCTGGG + Intergenic
1171814717 20:29775461-29775483 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1172470810 20:35193467-35193489 ATTAAGAAACAGGGCAGGCCAGG - Intergenic
1172475467 20:35234200-35234222 GTGAATGAACAGAAGAGGCTAGG - Intronic
1173442981 20:43094690-43094712 ATAAATAAAGAGAAGAGGCCGGG - Intronic
1173706353 20:45113228-45113250 TCTTATAAACAGAGGCGGCTGGG + Intronic
1173869958 20:46335136-46335158 ATTAAAACACAGAGGAGGGAAGG - Intergenic
1174036524 20:47672003-47672025 AGTAATAAACAGATAAGGCCAGG - Intronic
1174326220 20:49780997-49781019 AATAATAATCTGGGGAGGCTGGG - Intergenic
1174466302 20:50720251-50720273 ATTAAGAGACAGAGGAGGAGTGG - Intergenic
1174916237 20:54657025-54657047 ATTATTAAAAAGACAAGGCTGGG - Intergenic
1175790054 20:61735410-61735432 TATAAGAAACAGAGGAGGGTGGG - Intronic
1176744987 21:10643605-10643627 ATAAATAAACAAAAGAGCCTGGG + Intergenic
1176904453 21:14482985-14483007 ATAAATAAACATATGAGACTGGG + Intergenic
1178021635 21:28414960-28414982 TGTAATAAACATAGGAGGCTGGG - Intergenic
1178140744 21:29680837-29680859 AGAAATAAACATAGCAGGCTGGG + Intronic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178793783 21:35724245-35724267 ATTAAAACTCAGAGGAGGCTGGG - Intronic
1178874918 21:36406579-36406601 ATTAAAAAAAAAAGGAGGCCAGG - Intronic
1179018131 21:37612423-37612445 TTTAATCTACAGAGGAAGCTGGG - Exonic
1179411231 21:41165256-41165278 ATTAATCATGTGAGGAGGCTTGG + Intergenic
1181360198 22:22328246-22328268 TTTATTAAAAAGAGTAGGCTGGG - Intergenic
1181698790 22:24608413-24608435 ATTAACAGACAGGCGAGGCTGGG + Intronic
1182240852 22:28914924-28914946 ATTAATACACAGCAGAGCCTGGG - Intronic
1183682971 22:39344930-39344952 ATTAATAAATGAAGGAGGCTGGG + Intergenic
1184725051 22:46339465-46339487 ATTATTAAAAAGATGAGTCTGGG + Intronic
1185143362 22:49116322-49116344 ATTCATAAAATGAGAAGGCTGGG + Intergenic
1185290662 22:50025369-50025391 ATAAATACACAGAAGAGGCCGGG + Intronic
949622808 3:5834654-5834676 ATTAATAACGAGAGGAGCTTTGG - Intergenic
950397649 3:12746191-12746213 ATTTATAAAGAAAAGAGGCTGGG - Intronic
951919575 3:27839346-27839368 ATTAATAACAAGAGGAAGGTGGG + Intergenic
952273841 3:31858294-31858316 GTTAAAAAACATAGGGGGCTGGG - Intronic
952577547 3:34793531-34793553 AGTAAGACACAGAAGAGGCTGGG - Intergenic
952812541 3:37417395-37417417 AATAATAAACAGAGGAAGGCGGG + Exonic
952995939 3:38882370-38882392 ATTACTAAACCCAGGAGCCTTGG - Intronic
953087594 3:39686075-39686097 ATTAATAAAAAGAGGAATTTTGG + Intergenic
953396278 3:42573228-42573250 AAAAATAAACCGAGGAGGCCAGG + Intronic
953649705 3:44790974-44790996 ATTAAGAAACAGAAGGGGCCGGG - Intronic
954612082 3:51949959-51949981 ATTAAGACACAAAGGAGGCTGGG - Intergenic
954722871 3:52580660-52580682 ATTAAAAAACAGAGCATGTTTGG - Intronic
955068416 3:55552230-55552252 AGTTATAAACAGACGTGGCTGGG - Intronic
956212413 3:66815242-66815264 CTTAATAACAAAAGGAGGCTGGG + Intergenic
957861020 3:85949528-85949550 GTTATTAAACAGAGGAGTTTTGG - Intronic
958021224 3:87998839-87998861 ATTGTGAAACAGAGGGGGCTGGG - Intergenic
958430387 3:94033189-94033211 ATTAATAGACATTGGAGACTTGG + Intronic
958573937 3:95923219-95923241 ATTAAAAAACAGTGTAGGCGGGG - Intergenic
958796134 3:98708398-98708420 ATTAAAAAACACATGGGGCTAGG + Intergenic
959273128 3:104239928-104239950 TTTAAAAAACAAAGGTGGCTGGG - Intergenic
959751611 3:109843588-109843610 AATAATAGACAGTGGAGACTTGG + Intergenic
960437258 3:117642726-117642748 AATAAAAAACAGAGCAGACTGGG - Intergenic
961034506 3:123633085-123633107 ATAAATAAAAAGACAAGGCTGGG - Intronic
962958811 3:140291266-140291288 AGTAATAAAGTGAGGAGGCGGGG - Intronic
963416516 3:145001892-145001914 ATTAATAAATATCTGAGGCTGGG + Intergenic
964048312 3:152358903-152358925 TTTAAAAACCAGATGAGGCTGGG - Intronic
964089374 3:152856436-152856458 ATTAATAAACTGTGGGGGCAGGG + Intergenic
964520371 3:157560014-157560036 ATAAATAAATAAAGCAGGCTGGG - Intronic
965394294 3:168143348-168143370 AATAATAGACATTGGAGGCTGGG - Intergenic
965492118 3:169350350-169350372 ATTTATAAAATGAGTAGGCTGGG + Intronic
966251827 3:177874815-177874837 GTTAAAATAAAGAGGAGGCTGGG + Intergenic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
967058288 3:185849062-185849084 TCTAATAAAAAGAGGAGGCTGGG - Intergenic
967836617 3:193970184-193970206 TTTAATAAAATGAGGAGGTTTGG + Intergenic
968165122 3:196458696-196458718 TTTAATAGACAGATCAGGCTGGG + Intergenic
969010764 4:4060262-4060284 TTTAAAAAGAAGAGGAGGCTGGG - Intergenic
969830960 4:9796362-9796384 TCTAATGAACATAGGAGGCTTGG + Intronic
970434575 4:16021372-16021394 ATTAAGTAACAGTGAAGGCTGGG - Intronic
970513916 4:16808410-16808432 AGTAATGACCAGTGGAGGCTGGG + Intronic
970570327 4:17374799-17374821 TTTATTTAACAGAGGAGTCTTGG - Intergenic
972079558 4:35133674-35133696 ATAAATAAATAAATGAGGCTGGG + Intergenic
972623334 4:40770755-40770777 AAAAATAAACTGAGGTGGCTGGG + Intronic
973212093 4:47627276-47627298 AATAATAATCAGATGAGGCCAGG - Intronic
973677242 4:53277755-53277777 ATTAAAAAACAGTCCAGGCTCGG + Intronic
976316747 4:83666851-83666873 ATTCATAAACAGAGCAGACTGGG - Intergenic
976615622 4:87072825-87072847 TTAAATAAACACAAGAGGCTGGG - Intronic
976821376 4:89211085-89211107 AATAAACAACAGATGAGGCTGGG + Intergenic
977432426 4:96947313-96947335 ATTAATAGACATTGGAGACTTGG + Intergenic
977872546 4:102109578-102109600 ATCAATAATAAGAGAAGGCTTGG + Intergenic
977944360 4:102894659-102894681 AATAAGAAACACATGAGGCTAGG + Intronic
978069171 4:104445454-104445476 TTTAATATACAGAGTATGCTAGG - Intergenic
979092816 4:116508052-116508074 ATTGAGAAACAGAGGAGGCCAGG - Intergenic
979248034 4:118531755-118531777 TTTAAAAAACAAAAGAGGCTGGG - Intergenic
980095564 4:128486796-128486818 ATTAAAAAGCAAAGAAGGCTGGG + Intergenic
980164257 4:129205888-129205910 AATAATAGACAGTGGAGACTAGG - Intergenic
980721135 4:136697066-136697088 ATAAATAATCTGATGAGGCTGGG + Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
980948638 4:139348765-139348787 ATTAGTAAACAAAAGAGCCTAGG + Intronic
980953944 4:139409332-139409354 ATTCATAAGCAGTGGGGGCTGGG + Intronic
981277369 4:142916572-142916594 ATGAATATACAGAATAGGCTGGG + Intergenic
981851952 4:149241635-149241657 TTAAATAAACAGATGAGGCCGGG - Intergenic
982261930 4:153501799-153501821 ATTAGGAGACAGAGGAGGCATGG - Intronic
982816377 4:159890379-159890401 ATAAACAAAGAGAGAAGGCTAGG - Intergenic
983389188 4:167106315-167106337 ATCAATAATAAGAGGAGTCTTGG + Intronic
985125059 4:186684817-186684839 CATATTAAACAGAGGAGGCGTGG + Intronic
985250406 4:188018490-188018512 AGTTATATACAGAAGAGGCTGGG - Intergenic
985308534 4:188572010-188572032 AATAATAGACATTGGAGGCTTGG + Intergenic
985688145 5:1293041-1293063 AGCAGTGAACAGAGGAGGCTGGG - Intronic
986597366 5:9437645-9437667 ATTAAAAATAAGAGTAGGCTGGG - Intronic
987749391 5:22020018-22020040 ATAAAAAAGCATAGGAGGCTAGG + Intronic
988345456 5:30031937-30031959 GTTAATAAACAGATGAGGAGAGG - Intergenic
988433012 5:31141647-31141669 ATTAAGAAACAGGTGAGCCTTGG - Intergenic
989367969 5:40677361-40677383 ATTTATAAACAAAGGCCGCTTGG - Intergenic
989603092 5:43218304-43218326 AAAAATAGACAGAGGAGGCCGGG - Intronic
989798078 5:45499874-45499896 AATTATCAACAGAGTAGGCTGGG - Intronic
990369789 5:55105675-55105697 ATTAATAAAAAGAGTAGGCCGGG + Intronic
992066757 5:73116619-73116641 ATTACAAAATTGAGGAGGCTGGG - Intergenic
993573598 5:89573031-89573053 ATTTATCAACTGTGGAGGCTTGG - Intergenic
994428430 5:99624801-99624823 ATTAATAAGAAGAGGAGTTTTGG - Intergenic
995579276 5:113577663-113577685 ATTAATATACAAAAGAGGCCAGG - Intronic
997529938 5:134575903-134575925 ATAAATAAACAGATGTGGCCAGG + Intronic
997541397 5:134665988-134666010 ATTAATAAACAGGGCTGGCCAGG + Intronic
997802596 5:136881007-136881029 AATAATAAACAGTAGAGACTTGG + Intergenic
997934439 5:138098099-138098121 AATAAAAAAGAGAGAAGGCTGGG + Intergenic
998437116 5:142120310-142120332 ATTTATAAACAGACGAGATTGGG - Intronic
999224026 5:150005020-150005042 ATTTATAAACAGAAGTTGCTTGG + Intronic
999459663 5:151747027-151747049 ATTAAAAAAAAAAGGTGGCTGGG - Intronic
999774150 5:154798787-154798809 ATTAATCAAAAAAGCAGGCTGGG - Intronic
999857640 5:155612524-155612546 ATTATAGACCAGAGGAGGCTGGG + Intergenic
999857912 5:155615145-155615167 ATTATAGACCAGAGGAGGCTGGG - Intergenic
1000489064 5:161886472-161886494 ATTAATAATAAGAGTAGGCCTGG + Intronic
1000766656 5:165299783-165299805 AATAATAAAGAGTGGAGGTTGGG + Intergenic
1001791886 5:174464759-174464781 ATTAGTAAACAGAAAAGGGTAGG + Intergenic
1002038853 5:176495804-176495826 ATTAATAGAAAGTTGAGGCTGGG - Intronic
1002172057 5:177380654-177380676 ATAAATAAATAAAAGAGGCTGGG - Intronic
1002352927 5:178597121-178597143 ATTAAAAGACTGAGGAGGCTAGG - Intergenic
1002547702 5:179961985-179962007 ATTCATAAACAGATAATGCTAGG - Intronic
1003692480 6:8368121-8368143 ATTAAAAAACAGAACAGGCTGGG + Intergenic
1003849544 6:10207778-10207800 ATAAAGAAACAGAGCAGGCTGGG + Intronic
1004004993 6:11630257-11630279 AATAATCATCAGAGGAGGCCAGG + Intergenic
1004940321 6:20549900-20549922 ATAAATGTAAAGAGGAGGCTGGG - Intronic
1005050875 6:21683007-21683029 AATAATAACAAGAAGAGGCTGGG - Intergenic
1005957123 6:30671976-30671998 TTTAATTAACAGAGGGGGCCGGG - Intronic
1006252098 6:32796402-32796424 ATAGATTAACGGAGGAGGCTGGG - Intergenic
1006754476 6:36403383-36403405 TTTAAGAAACAGAATAGGCTGGG + Intronic
1007048431 6:38800815-38800837 GTTAATAAGCACAGGAGGCAGGG - Intronic
1007162622 6:39804125-39804147 TCCCATAAACAGAGGAGGCTGGG - Intronic
1007417424 6:41700169-41700191 ATCAAGAAACAAAAGAGGCTGGG + Intronic
1008268671 6:49463374-49463396 ATTCGTAAACAGAGGAGACCCGG - Exonic
1008843302 6:55930759-55930781 ATTAAGAAACAGAAGAAACTTGG - Intergenic
1009032441 6:58076106-58076128 ATTAATAAAGAGAGCATGCACGG - Intergenic
1009208051 6:60827879-60827901 ATTAATAAAGAGAGCATGCACGG - Intergenic
1009295767 6:61944793-61944815 AGTAAAAAACATATGAGGCTGGG + Intronic
1009648535 6:66442540-66442562 CTGAATAAACAGAGGAGAGTAGG - Intergenic
1009783766 6:68303818-68303840 ATTAATAACAAGAGGAGTTTTGG + Intergenic
1010213617 6:73382654-73382676 ATAAACAAACATAGTAGGCTGGG - Intronic
1010249007 6:73689063-73689085 ATTAATTAACAGAAGCAGCTGGG - Intergenic
1011270552 6:85575004-85575026 ACAAATAAACAGAAGAGGATAGG + Intronic
1012184515 6:96196415-96196437 AATAATAAACAAAGGAGGGACGG + Intronic
1013212652 6:108000707-108000729 ATAAATAAATAAAAGAGGCTGGG + Intergenic
1015836683 6:137427737-137427759 ATTAATCAAGCCAGGAGGCTGGG - Intergenic
1016501019 6:144720778-144720800 ATAAATACACAGAGGAGGGAGGG - Intronic
1016679482 6:146811967-146811989 TTTAAAAAACACAGCAGGCTGGG - Intronic
1016680048 6:146818885-146818907 TTTAAAAAACACAGCAGGCTGGG - Intergenic
1016760436 6:147730370-147730392 AACAACAAACAGAAGAGGCTTGG + Intronic
1016829852 6:148423230-148423252 ATTAAAAAACACATGGGGCTGGG - Intronic
1016871958 6:148826406-148826428 ATGAATAAAAACAGGAGCCTGGG - Intronic
1017508367 6:155089500-155089522 CTTATTAAACAGATGAGGCCAGG - Intronic
1018171072 6:161143378-161143400 ATTAAGAAATAGGTGAGGCTGGG - Intronic
1018667600 6:166153601-166153623 ATCATTAAAAAGAAGAGGCTAGG - Intergenic
1018844035 6:167542602-167542624 ATTAATAATCACATCAGGCTGGG + Intergenic
1019475761 7:1243424-1243446 ATTAATAAAGACTGGAGGTTTGG - Intergenic
1019650730 7:2156520-2156542 ATAAATAGAGAGGGGAGGCTGGG + Intronic
1020163455 7:5789910-5789932 ATAAATAAATAAAAGAGGCTAGG + Intergenic
1020222785 7:6253830-6253852 ATAAATAAACAAAAGAGGCCAGG + Intronic
1020438976 7:8197257-8197279 ATTAAAAAAAAGAAGAGGCTGGG + Intronic
1020561470 7:9732735-9732757 ATTAATAAATAGAGGGGGCCGGG - Intergenic
1021894669 7:25222642-25222664 ATTAATAAACATGGGTGGCGGGG + Intergenic
1022109174 7:27217700-27217722 ATTTAAAAAAATAGGAGGCTGGG + Intergenic
1022209409 7:28194039-28194061 ATTAATAAAACGATGAGGCTGGG - Intergenic
1023296042 7:38715954-38715976 ATAAACAAACTGAGGAGCCTCGG - Intergenic
1023956172 7:44888553-44888575 AGAAATGAACAGAGGGGGCTGGG - Intergenic
1024700898 7:51902960-51902982 ATGCACAAACAGTGGAGGCTGGG + Intergenic
1024990708 7:55232802-55232824 GTCAATAAAAAGAGAAGGCTGGG - Intronic
1025010442 7:55393234-55393256 ATTAATAAACAGCATAGGCCAGG + Intronic
1026705780 7:72691771-72691793 ATTAATAACCAAAGAAGGCATGG + Intronic
1027182439 7:75950281-75950303 ATTAATAAATCGACGACGCTGGG - Intronic
1028032932 7:85940639-85940661 ATTAATCAAAAGAGAAGGCAGGG + Intergenic
1028626503 7:92883336-92883358 ATTAATAAAAAGAGGAACTTTGG + Intergenic
1028732312 7:94165719-94165741 ATAAATAATCAGAGAAGTCTGGG - Intergenic
1029855640 7:103514357-103514379 ATTAAAAATGAGAGGAGGATAGG + Intronic
1030198848 7:106881233-106881255 ACAAATAAACAAAGTAGGCTGGG - Intronic
1031519764 7:122749289-122749311 ATTATTATACAGTGGTGGCTGGG - Intronic
1031651964 7:124302554-124302576 ATTTATAAAGAAAGGAGACTGGG - Intergenic
1032007440 7:128314260-128314282 ATTTATAAAGAAAAGAGGCTTGG - Intronic
1032354454 7:131197041-131197063 AGAATTAAACAGAGGAGGATGGG - Intronic
1032510138 7:132465887-132465909 TTTTAGAAAAAGAGGAGGCTAGG + Intronic
1032746587 7:134792585-134792607 CTTTATAAGAAGAGGAGGCTAGG - Intronic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1033211120 7:139460964-139460986 ATTGAAAAAAAGAGGAGGTTGGG + Intronic
1033399822 7:141011850-141011872 ATCCATTAACAGAGGAGGCTGGG + Intronic
1033936972 7:146598066-146598088 ATGATTAAACAGAGTAGGCAGGG - Intronic
1037687343 8:21153775-21153797 AATAAGAAACAGTGGAGACTTGG + Intergenic
1038070285 8:24005953-24005975 AACAATACACAGAGGAGGGTGGG + Intergenic
1039524952 8:38206373-38206395 ATTATTAAACTGAGGATTCTGGG + Intronic
1039837369 8:41267511-41267533 ATCATTAAAAAGAGGGGGCTTGG - Intronic
1040516512 8:48139705-48139727 ATTAAAAAAAAGAAGTGGCTGGG - Intergenic
1041657132 8:60364080-60364102 ATTAATAAACTGAGCAGGACAGG + Intergenic
1041918397 8:63158496-63158518 ATAAATAAATGGGGGAGGCTGGG + Intergenic
1042633533 8:70847173-70847195 ATCAATAAAAAGAGGAACCTTGG + Intergenic
1042855991 8:73268182-73268204 TTTAAGAAACATAGCAGGCTGGG + Intergenic
1043999274 8:86858926-86858948 GTTGATGAACAGTGGAGGCTGGG - Intergenic
1044027237 8:87188432-87188454 ATAAATAAATGAAGGAGGCTCGG + Intronic
1045309571 8:100989193-100989215 ATTAATAGACAGAGGGGTCATGG + Intergenic
1046114346 8:109766983-109767005 TTTAATGACCAGAGTAGGCTGGG + Intergenic
1046555038 8:115764209-115764231 ATTAATTAACAGTGGAGGCCAGG + Intronic
1046569290 8:115942805-115942827 TTTAAGAAAAGGAGGAGGCTAGG - Intergenic
1046607231 8:116384851-116384873 ACAAAAGAACAGAGGAGGCTGGG + Intergenic
1046697707 8:117360514-117360536 ATGAAAAATCAGAAGAGGCTGGG + Intergenic
1046901768 8:119531054-119531076 ATTAATAGAAAAAGGAGGTTGGG - Intergenic
1050322174 9:4464204-4464226 TTTAATAAAGAGAGCAGGCCTGG + Intergenic
1052114342 9:24631192-24631214 ATTACTAAACAGAGGAGAAAGGG + Intergenic
1052460353 9:28754924-28754946 AGAAATAAACAGATAAGGCTGGG - Intergenic
1053162752 9:35824979-35825001 ATTATTAAACACAGAAGGGTCGG - Intronic
1053365699 9:37521122-37521144 ATGAATAAATACAGGAGGATTGG + Intronic
1053594884 9:39549684-39549706 ATTAGTACACAGAGGAAGCAGGG - Intergenic
1053852665 9:42304718-42304740 ATTAGTACACAGAGGAAGCAGGG - Intergenic
1054571370 9:66815283-66815305 ATTAGTACACAGAGGAAGCAGGG + Intergenic
1054976294 9:71149676-71149698 ATTAATAAACAAAAAAGCCTGGG + Intronic
1054984415 9:71245151-71245173 ATAAATACAAAGAAGAGGCTGGG + Intronic
1055584043 9:77737651-77737673 AATAATCAACAGAGCAGCCTTGG + Intronic
1055953350 9:81751204-81751226 ATTAAAAAATTAAGGAGGCTGGG - Intergenic
1056300278 9:85233114-85233136 ATTTAGAAACAGAGTATGCTAGG - Intergenic
1056797007 9:89665403-89665425 ATAAATAAATAAATGAGGCTAGG - Intergenic
1057990232 9:99761247-99761269 AAGAATAATCAGAGGAGGCATGG - Intergenic
1059313508 9:113404974-113404996 AGTAATCCACAGAGGAGACTAGG + Intergenic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1060946856 9:127574803-127574825 GTTAATAAAGAGAGGAGGTCCGG - Intronic
1061007952 9:127938802-127938824 ATTAAAAGGCACAGGAGGCTGGG - Intergenic
1061383342 9:130272856-130272878 ATGAATAAAAAGAAGATGCTCGG - Intergenic
1062688748 9:137829884-137829906 GTTAATAAACAGGGAAGGCATGG - Intronic
1203366388 Un_KI270442v1:261774-261796 AAAAATGAACAGAGGTGGCTGGG - Intergenic
1185815354 X:3150089-3150111 ATAAATAAACAGAAGAGGAGAGG - Intergenic
1185964531 X:4585845-4585867 CTTTATAAGAAGAGGAGGCTGGG + Intergenic
1186102445 X:6171410-6171432 ATTAATGCCCAGAGCAGGCTGGG - Intronic
1186801470 X:13096582-13096604 AAAAATATACAGAGGAGGCCGGG - Intergenic
1187072036 X:15898150-15898172 TTTAAAAAATAGAAGAGGCTGGG + Intergenic
1187274053 X:17803228-17803250 AGAAATAAACAAACGAGGCTGGG + Intronic
1187349399 X:18498391-18498413 AGTAATAAAAAGATCAGGCTGGG - Intronic
1187365809 X:18665086-18665108 TTTAGGAAAAAGAGGAGGCTTGG - Intronic
1187493541 X:19774991-19775013 ACTACTAAACAGAGAGGGCTTGG - Intronic
1188480859 X:30635661-30635683 ATTAAAAAATAGACTAGGCTGGG - Intergenic
1190487653 X:50943792-50943814 ATATTTAAACAGAAGAGGCTGGG - Intergenic
1190758984 X:53424078-53424100 ATAAATAAAGGGAGGAAGCTTGG + Intronic
1190770748 X:53512187-53512209 ATTAAAAAAAAAAGCAGGCTGGG + Intergenic
1190853090 X:54265746-54265768 ATTATTCAAGAGATGAGGCTGGG + Intronic
1192112302 X:68377389-68377411 ATAAAAAAAAAGAGAAGGCTGGG - Intronic
1192206757 X:69101450-69101472 ATCAGTAAACAGAGGAGGCAGGG - Intergenic
1192671483 X:73147591-73147613 ATTAATAACAAGAGGAGTTTTGG - Intergenic
1193492546 X:82166966-82166988 AAGAATGAACAGAAGAGGCTGGG + Intergenic
1195056024 X:101145742-101145764 ATTAGTAAAGAGAGGAAGCTGGG - Intronic
1195339203 X:103888949-103888971 AATAATAAACATTGGAGACTTGG + Intergenic
1195458661 X:105099249-105099271 ATTAAAAAATAGCTGAGGCTGGG + Intronic
1195530971 X:105957706-105957728 GTTAATAAAGAAAGGAAGCTGGG + Exonic
1196018662 X:110966229-110966251 ATTCATACACAAAGGAGGGTAGG + Intronic
1196095194 X:111791313-111791335 ATTCATAAGCAGAGGAGACATGG + Intronic
1196967505 X:121074003-121074025 ATTAATAAAAAGAGGAATTTTGG - Intergenic
1197260832 X:124315941-124315963 ATCAATAACAAGAGGAGCCTTGG + Intronic
1197271810 X:124432719-124432741 ATTCAAAAACAGAGTTGGCTGGG - Intronic
1197430322 X:126354936-126354958 ATTAAGAATCAGAAGAGGCAGGG + Intergenic
1197580787 X:128281003-128281025 ATCTATAAAAAAAGGAGGCTGGG + Intergenic
1198114446 X:133531573-133531595 AATAATAAACACTGGAGACTGGG - Intergenic
1198258955 X:134949383-134949405 ATAAATAAACAAAGGAGGCAGGG + Intergenic
1198450688 X:136764679-136764701 ATTAAGAAACAGAACAGGATTGG - Intronic
1198699734 X:139383686-139383708 TTTAAAAATCTGAGGAGGCTAGG + Intergenic
1199038340 X:143079719-143079741 ATTAAGAAATACATGAGGCTGGG + Intergenic
1199580978 X:149359404-149359426 ATTAATAACCAGAATAAGCTGGG - Intergenic
1200683557 Y:6241584-6241606 ATTAACAAACAAATGAGGCTGGG + Intergenic
1201049078 Y:9912802-9912824 ATTAACAAACAAATGAGGCTGGG - Intergenic
1201072301 Y:10158457-10158479 AAAAATGAACAGAGGTGGCTGGG + Intergenic
1201224397 Y:11803966-11803988 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
1201773162 Y:17638000-17638022 GTTAATATCCAGGGGAGGCTGGG + Intergenic
1201828393 Y:18267986-18268008 GTTAATATCCAGGGGAGGCTGGG - Intergenic
1201965780 Y:19733574-19733596 ATTTATAAACATAAGAGGCCAGG + Intronic
1202035557 Y:20631036-20631058 ATTAATAACAAGAGAAAGCTTGG - Intergenic