ID: 1150601597

View in Genome Browser
Species Human (GRCh38)
Location 17:66655534-66655556
Sequence TAAAGGGCATGGAGAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 626}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150601597 Original CRISPR TAAAGGGCATGGAGAGAAAG TGG (reversed) Intronic
900160895 1:1223292-1223314 TAAAGGCCATAGCGAGAAGGAGG - Exonic
901461341 1:9393600-9393622 GAAAGGACACGGAGAGAGAGGGG + Intergenic
901751654 1:11413732-11413754 TAAAGGGTAGGGAGAGAAATTGG + Intergenic
901875237 1:12163726-12163748 TAAAGGCCATGGAGAGCCATGGG + Intergenic
902466302 1:16620654-16620676 CAAAGGGCAAGAAGAGCAAGGGG + Intergenic
902508378 1:16952652-16952674 CAAAGGGCAAGAAGAGCAAGGGG - Intronic
902723642 1:18321297-18321319 TAAAGGGCAGGCAGAGTGAGTGG - Intronic
902802133 1:18837118-18837140 TAAAAGGCATCATGAGAAAGAGG + Intergenic
903573608 1:24323912-24323934 TCAAGGGCAGGGACCGAAAGGGG + Intronic
904092898 1:27957485-27957507 TAAATGGCATCAAGTGAAAGTGG + Intronic
904226998 1:29029945-29029967 TCAGGGGTATGGAGAGAAAAAGG + Intronic
905202513 1:36323687-36323709 AAAAGGGCTGGGAGAGGAAGGGG + Intronic
905205364 1:36340229-36340251 GATGGGGCATGGGGAGAAAGGGG + Exonic
905224983 1:36473024-36473046 AGAAGGGCATAGAGAGAGAGGGG - Intronic
905266159 1:36755641-36755663 TAAAGGGGAGGGAGAGAAGAAGG - Intergenic
905320252 1:37111071-37111093 TAAACGGCATAGAGGGAAAATGG + Intergenic
906045338 1:42825748-42825770 TAAAAAGCATGAAGAGAGAGAGG - Intronic
907163046 1:52385553-52385575 TAAAGGGCATCAAAACAAAGAGG + Intronic
907408394 1:54268100-54268122 TAGAGGTCAGGGAGAGAGAGGGG - Intronic
907490400 1:54805666-54805688 GAAAGGGCAAGGAGAGCCAGAGG - Intergenic
907594005 1:55703306-55703328 TAAAAGGCATGAAAAGAAACGGG - Intergenic
908009285 1:59759241-59759263 TAAAGGAAATGAAAAGAAAGTGG - Intronic
908226493 1:62061128-62061150 GAAGAGGCAAGGAGAGAAAGAGG - Intronic
908648594 1:66307306-66307328 TGAAAGCCATGGAGAGCAAGAGG + Intronic
908731258 1:67228888-67228910 AAAAGGGAATTGAGAGGAAGTGG - Intronic
908910144 1:69063694-69063716 TGAAGGACATGAAGAAAAAGGGG - Intergenic
909549849 1:76885731-76885753 TAAACAGCAGGGAAAGAAAGGGG - Intronic
909598173 1:77430223-77430245 AAAAGGGGACAGAGAGAAAGAGG + Intronic
910448647 1:87325289-87325311 TAAAAGGTGTGGAGAGAAAAGGG - Intergenic
911312076 1:96305643-96305665 TGAAGGGAATGAAGATAAAGAGG - Intergenic
911484392 1:98487551-98487573 TTAAGGGCATGGAGAAGAAGAGG + Intergenic
911948294 1:104138770-104138792 GAAAGGGAAAGGAGAGAAAGAGG - Intergenic
912202548 1:107474721-107474743 TGAAGGGCAGAGAGAGAAAGAGG + Intronic
913067219 1:115267224-115267246 GAAAGGGGAAGGAGTGAAAGGGG - Intergenic
913090066 1:115470532-115470554 TAAAGGCAATGGAGAAAGAGTGG - Intergenic
915085490 1:153385411-153385433 TATAGGGGATGAGGAGAAAGAGG + Intergenic
915085583 1:153386375-153386397 TAAAGGGCATGGAGAGAATCTGG - Intergenic
916461956 1:165034522-165034544 TGAAAGGCAGAGAGAGAAAGAGG + Intergenic
916474147 1:165152673-165152695 TACAGGGCATGGTGGGAATGGGG - Intergenic
916773454 1:167936234-167936256 TCGAGGGCATGGGGAGAAGGAGG - Intronic
916896228 1:169165445-169165467 TATATGGCAAGAAGAGAAAGAGG - Intronic
916901488 1:169228851-169228873 CAAAGGCCATTGAGAGAAATTGG - Intronic
916907972 1:169309583-169309605 TAAAGGACATGAAAAGCAAGAGG - Intronic
917262280 1:173183180-173183202 TAAAGGGGTGGCAGAGAAAGAGG + Intergenic
917332339 1:173894486-173894508 TAGACTTCATGGAGAGAAAGAGG - Exonic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918745992 1:188200526-188200548 TAAACAGCATGGACAGAAATAGG + Intergenic
919779566 1:201213284-201213306 TGAAGGGCAGGGAGTGGAAGAGG + Exonic
920088416 1:203434790-203434812 TGAAGGGCTTGGAGAAGAAGAGG + Intergenic
920195944 1:204227353-204227375 TAAAGGGAGAGGAGAGACAGTGG - Intronic
920646478 1:207807643-207807665 CAAAGAGGAAGGAGAGAAAGTGG - Intergenic
920937933 1:210453529-210453551 TATGGGGGAAGGAGAGAAAGGGG - Intronic
920963910 1:210686588-210686610 AAAAGGGGAAGGAGAGAAATGGG + Intronic
921250538 1:213293372-213293394 TAATGGGGGTAGAGAGAAAGGGG - Intergenic
921290899 1:213656357-213656379 TAAAGTGGATGGGTAGAAAGAGG + Intergenic
922068969 1:222172165-222172187 TTAAAGGCATGCAGAGAAAAAGG + Intergenic
922534201 1:226367920-226367942 TAAAAGGCAGGGAGGGAAAATGG + Intronic
922659271 1:227415343-227415365 TCAAGGGCATTGTAAGAAAGGGG + Intergenic
923503566 1:234586336-234586358 TTAAGGGCATGGACAAGAAGGGG - Intergenic
924206641 1:241718820-241718842 CAAATGGCAGGGAGAGAGAGGGG + Intronic
1062894803 10:1095070-1095092 TAATGGGCATGGAGAGAGGAGGG + Intronic
1062894811 10:1095113-1095135 TAATGGGCATGGAGAGAGGAGGG + Intronic
1062922922 10:1293280-1293302 GAAAGAGCAGGGAGAGAAGGGGG + Intronic
1062975029 10:1676845-1676867 TGAAGAGGATGGAGAGAAGGTGG + Intronic
1063225432 10:4011127-4011149 GAAATGACATGGAGAGAAGGAGG - Intergenic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1064407932 10:15080991-15081013 CAAAGGCCTAGGAGAGAAAGTGG + Intronic
1065125774 10:22572762-22572784 TCAAAGGCTTGGAGATAAAGGGG - Intronic
1065129438 10:22605743-22605765 AAAAGGACGTGGAGAGAAGGAGG + Intronic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1068420377 10:56783814-56783836 CAAATGGCAGGGAGAGAATGGGG - Intergenic
1069852486 10:71419137-71419159 TAGAGGGCAGGGAGAGGAAGTGG - Intronic
1070478356 10:76852745-76852767 TAAAGAGGAGGTAGAGAAAGAGG + Intergenic
1070890162 10:79937140-79937162 AAATGGTCAAGGAGAGAAAGAGG + Intergenic
1071188277 10:83069549-83069571 TAAGAGGCAGGGAGAGAAATGGG + Intergenic
1071684897 10:87744256-87744278 CACAGGGCATGGAGAGTAACTGG - Intronic
1071792963 10:88975528-88975550 GAAGGGGCATGGAGAGCAAAGGG + Intronic
1071987247 10:91064272-91064294 CAAAGGGCATAGATAGAAAAGGG + Intergenic
1072288726 10:93942382-93942404 AAAATGGCATGGAGAGAAAAAGG + Intronic
1072861312 10:99007933-99007955 TACAGGGCATGGGGAGAGGGTGG - Intronic
1072873275 10:99143901-99143923 GAAAGGGCATACACAGAAAGAGG + Intronic
1072876366 10:99176854-99176876 TAAAGGGCAGCCAGAGAAAAAGG + Intronic
1073178802 10:101571540-101571562 TAAGGGGGAAGGAGGGAAAGAGG + Intronic
1074576937 10:114678965-114678987 CAAAGGGCATGGATATAAGGAGG - Intronic
1074726677 10:116317451-116317473 TAAATGGAATGAATAGAAAGTGG - Intergenic
1075267966 10:121021598-121021620 GAAAGAGCATGGAGAGACAGGGG - Intergenic
1075883582 10:125876719-125876741 TAAAGGACAGGGAGAGACTGGGG + Intronic
1075917061 10:126176876-126176898 GAAAAAGCATGGAGAGAAATTGG + Intronic
1076037527 10:127213027-127213049 TAAAGGGGATGGATAGAAAGGGG - Intronic
1076134460 10:128036032-128036054 TAAAGGGTGAGGAGAGAGAGGGG + Intronic
1076228421 10:128799759-128799781 AAAGGGACATGGAGAGGAAGTGG + Intergenic
1078365772 11:10705233-10705255 AAAATGCCATGGAAAGAAAGTGG + Intergenic
1078538778 11:12196895-12196917 CAAATGGCATGCTGAGAAAGAGG - Intronic
1078751367 11:14167473-14167495 TAAATGGCAGGGAAAAAAAGGGG - Intronic
1078882319 11:15464326-15464348 CAAAGGGCAGGTACAGAAAGAGG + Intergenic
1078885360 11:15494518-15494540 TAAAGGAAATGGAGGGAAAGTGG + Intergenic
1079233461 11:18669989-18670011 TAGAGGGCAGGGAGAGGGAGTGG - Intergenic
1079490507 11:20983929-20983951 TAATGTGAATGGAGACAAAGAGG - Intronic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1080121413 11:28682124-28682146 TGAAGGTAAAGGAGAGAAAGGGG - Intergenic
1081220056 11:40448881-40448903 TAAAGGGGATGTAGAGAAATAGG - Intronic
1081306380 11:41516855-41516877 TAAAAGGAATTGAGAAAAAGGGG - Intergenic
1081577496 11:44328328-44328350 GAAGGGGCAGGGAGGGAAAGTGG - Intergenic
1081766232 11:45612304-45612326 GAAAGGGCAAGGAGAGGAGGGGG - Intergenic
1083106678 11:60365053-60365075 AAAAGGGCATGAAGACCAAGAGG + Intronic
1083479844 11:62936770-62936792 TGAAGGACCTGGAGAGAAGGTGG - Intronic
1083727126 11:64634426-64634448 GAAAGGGCAGGGAAAGAAAAGGG + Intronic
1083961882 11:66019131-66019153 CAAAGGACATGGACTGAAAGGGG - Intronic
1084109334 11:67003209-67003231 TAAGGGGCAGGGAGAAAAACTGG + Intergenic
1084234466 11:67777818-67777840 TAAAGGAGATGGAGAGGAAGGGG + Intergenic
1084863927 11:72040817-72040839 TAAAGGGGAGGGAGAGAAGAGGG - Intronic
1086032955 11:82382945-82382967 AAAAGGCCAAGAAGAGAAAGGGG + Intergenic
1086616146 11:88822804-88822826 AAAAGGGGAGGGAGAGAAGGAGG - Intronic
1086938912 11:92774855-92774877 GAAAGGGCATTGAGAGCAGGAGG + Intronic
1087355493 11:97088382-97088404 TAAAGGGCAAAGAGATAAGGAGG + Intergenic
1087746478 11:101953526-101953548 TAAAGGACAGGCAAAGAAAGAGG + Intronic
1089766684 11:120772727-120772749 GAGAGGGCATGGGAAGAAAGGGG + Intronic
1089848132 11:121474457-121474479 TAAAGAGGAGGGAGAGAAAGGGG - Intronic
1089911100 11:122101496-122101518 AAAAGGGAAGGGAGAGAAAAAGG - Intergenic
1090643625 11:128749795-128749817 TAAAGGGCAGGGAGGGAAAAGGG - Intronic
1090733866 11:129594404-129594426 AATAGGGCATGAAGAGAAGGGGG + Intergenic
1091078176 11:132640847-132640869 TAAAGGGCAGGGAGAGGGTGGGG + Intronic
1091213900 11:133887833-133887855 TAAGGGGCAGGCAGAGAAAAGGG - Intergenic
1091618512 12:2067846-2067868 GGAAGGGCATGGAAAGACAGGGG - Intronic
1091803925 12:3342678-3342700 TAAAGGGCAGAGCCAGAAAGAGG - Intergenic
1093051306 12:14507964-14507986 AAAAGGGCCAGGAGAGAATGTGG - Intronic
1093060900 12:14602319-14602341 TAATGAGGATGTAGAGAAAGAGG - Intergenic
1093114375 12:15191375-15191397 TGAGTGGCTTGGAGAGAAAGTGG - Intronic
1093396662 12:18691512-18691534 TTAAGGGAAGGCAGAGAAAGAGG + Intronic
1093410340 12:18857872-18857894 GAAAGGGCATGGAATGAAAGAGG - Intergenic
1093520336 12:20042769-20042791 TATAGGTCATGGAGAAAAAGTGG - Intergenic
1093614441 12:21205767-21205789 TAAAGTGAAAGCAGAGAAAGAGG - Intronic
1093771300 12:23021612-23021634 AAAAGGGCATCTAGAGAATGGGG - Intergenic
1094145180 12:27221211-27221233 TAAGGGGGAGAGAGAGAAAGAGG + Intergenic
1095789736 12:46151714-46151736 TAAATGACAGGGAGAAAAAGGGG + Intergenic
1096509988 12:52122302-52122324 TGACGGGCAGGGAGAGAAGGAGG + Intergenic
1096690867 12:53321109-53321131 TAGAGGGAATGGAGAGAATGAGG - Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096926014 12:55147456-55147478 AAAGGAGCAGGGAGAGAAAGAGG + Intergenic
1097309017 12:58098354-58098376 TGAAGGGAGTGGGGAGAAAGTGG - Intergenic
1097591269 12:61578409-61578431 TAAAAGCCATGGAGAGATAATGG - Intergenic
1098099275 12:66996626-66996648 AAAATGGCATGTAGAGAAAATGG + Intergenic
1098207736 12:68131207-68131229 TAAAGAGGAAGTAGAGAAAGAGG - Intergenic
1098395480 12:70012393-70012415 TAAAGAGGAGGTAGAGAAAGAGG + Intergenic
1098497423 12:71152266-71152288 TTAAGGGAATGGGGAAAAAGTGG - Intronic
1098510682 12:71310616-71310638 GAAAGGGTATGCAGAGGAAGGGG + Intronic
1098870602 12:75813084-75813106 TAAAGGGCAGATGGAGAAAGGGG - Intergenic
1099213599 12:79825106-79825128 TACAGGTCATTAAGAGAAAGTGG + Intronic
1099568788 12:84286244-84286266 ATAAGGGAATGGAGAGAAATAGG - Intergenic
1100013112 12:89977287-89977309 AAAAGGAGATGGAGTGAAAGTGG + Intergenic
1100161728 12:91868251-91868273 AAAAAGGCACGGAGAGAAAGGGG + Intergenic
1100180551 12:92080939-92080961 TGAATGACATGGAGAGAAATTGG + Intronic
1100354158 12:93813454-93813476 AAAAGGCCATGGAAAGACAGAGG - Intronic
1100398108 12:94202508-94202530 TAAATGTCATGGAGACACAGAGG + Intronic
1101699708 12:107160834-107160856 CAAAGGGCATGTACAGGAAGAGG - Intergenic
1101986612 12:109452001-109452023 TCAAGGGGATGCAGAGAAACAGG + Intronic
1102100569 12:110275315-110275337 TCATGGGCATGTAGAAAAAGTGG + Intergenic
1103960472 12:124606173-124606195 TGTAGGACATGGGGAGAAAGAGG - Intergenic
1104190192 12:126474385-126474407 GAAAGGGGAACGAGAGAAAGGGG + Intergenic
1104198123 12:126561019-126561041 TAAAGGGTATGTGGAGAATGAGG - Intergenic
1104618291 12:130289551-130289573 TAAAGGCCGTGGAGAGACAGCGG - Intergenic
1104707882 12:130961380-130961402 GAAAGGGCAGAGAGAAAAAGGGG - Intronic
1105071904 12:133239336-133239358 TAAAGAGCATGGAGGGAAAGGGG - Intergenic
1105387847 13:19948597-19948619 TATAGGGCAGGGAGAGAGATAGG + Intergenic
1106316821 13:28601669-28601691 TAAAGGGAAAGAAGGGAAAGTGG - Intergenic
1107248061 13:38321015-38321037 TAAAGGCTATTGAGAGAGAGAGG + Intergenic
1107323109 13:39210416-39210438 TTAAGGCAATGGAGAGAATGGGG + Intergenic
1107326346 13:39247113-39247135 TAAAGTGCATGGAGTGTAATGGG + Intergenic
1108027673 13:46195510-46195532 CAAGGGGCATGGGGAGCAAGAGG + Intronic
1108088451 13:46820124-46820146 TAAAGTGCTTGAAGAGAGAGAGG + Intergenic
1108162686 13:47658435-47658457 AAAAGGGAGTGGAGAGAGAGAGG - Intergenic
1108249386 13:48549774-48549796 TGAAGGGCAGGGAGAGAGAAGGG + Intergenic
1109238337 13:59851397-59851419 AAAAGGTCCTGTAGAGAAAGTGG - Intronic
1109959877 13:69616119-69616141 GAAAGGCCCTGGGGAGAAAGTGG + Intergenic
1110020570 13:70464173-70464195 TAATGGGCATGAAGAAAATGAGG + Intergenic
1110252968 13:73401517-73401539 CAAAGGGGATGGAGTGAAATGGG - Intergenic
1110255639 13:73430937-73430959 TAAAGGACATGCAGAGATGGAGG + Intergenic
1110264949 13:73527011-73527033 ATAGGGGCATGGAGAGAATGGGG + Intergenic
1110592018 13:77274483-77274505 GAAAGGGAAGGGAGAGAAGGAGG + Intronic
1110598221 13:77341916-77341938 GAAGGGGCATAGAGAGGAAGTGG - Intergenic
1111956190 13:94761215-94761237 CAAAGGAGATGGGGAGAAAGGGG - Intergenic
1112330571 13:98474393-98474415 GAAGGGGCCTGTAGAGAAAGGGG - Intronic
1112626874 13:101114894-101114916 AAAATGGCATGGAGAGAACGAGG - Intronic
1112843852 13:103613677-103613699 TAAGAGGCATGGAAAGAAAAGGG + Intergenic
1113256136 13:108508205-108508227 TACAAGGCATACAGAGAAAGAGG - Intergenic
1114061695 14:19023974-19023996 AAAAGGGGAAAGAGAGAAAGAGG - Intergenic
1114100566 14:19376032-19376054 AAAAGGGGAAAGAGAGAAAGAGG + Intergenic
1114335587 14:21686081-21686103 TAGAGGTCATGAAGAGAAAGAGG - Intergenic
1114522385 14:23347553-23347575 TAAGGGTCATGGAGAGAAGAAGG + Exonic
1114604394 14:23984980-23985002 TAAAGGAGATAGGGAGAAAGGGG + Intronic
1115910689 14:38254424-38254446 TAAAGGGAATTTAGAGGAAGGGG + Exonic
1116748542 14:48851961-48851983 TAATGTGCAAGGAGATAAAGTGG - Intergenic
1116940210 14:50783730-50783752 TAAAAAGCAGGGAGAGAAGGAGG + Intronic
1117002684 14:51387025-51387047 GAAAGGGAAGGGAGAGAAGGAGG - Intergenic
1117266305 14:54090932-54090954 TAAAAGGCATACAGAAAAAGAGG + Intergenic
1117397590 14:55326261-55326283 TAATGTGAATGGGGAGAAAGGGG - Intronic
1117823917 14:59680282-59680304 TAACTGGTATGGAGGGAAAGAGG - Intronic
1118056130 14:62081519-62081541 TAGAGGGCATGGAGAAAAACAGG + Intronic
1118322523 14:64761604-64761626 TAAAGTGAATGGAGGGGAAGGGG + Intronic
1118824365 14:69367067-69367089 TAAGAGGCATGGAGAGATTGTGG + Intergenic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119153977 14:72391555-72391577 TAAAGGAGATGGAGGAAAAGTGG - Intronic
1119485536 14:74984534-74984556 TAGAGGGCAGGCAGAGAAGGAGG - Intergenic
1119672157 14:76528049-76528071 CAAAGGGCATGGTGAGAAAGTGG - Intergenic
1120024213 14:79564277-79564299 AAGAGGGCATTGAGAGAAAGTGG + Intronic
1120463612 14:84827692-84827714 TAAAGGGAATAGAAAGAAAAGGG - Intergenic
1121281602 14:92703029-92703051 GGGAGTGCATGGAGAGAAAGAGG - Intergenic
1121600534 14:95199880-95199902 TAGAGGGGAGGGAGACAAAGAGG + Intronic
1121865059 14:97355182-97355204 TAAGGGGCATACAGAGAATGAGG - Intergenic
1121994400 14:98591042-98591064 TGGCGGGGATGGAGAGAAAGCGG - Intergenic
1122007619 14:98718435-98718457 GAAAGGGCAGGAAGAGAAACTGG + Intergenic
1122412156 14:101531115-101531137 TCCAGGGCATGGACAGAAAGTGG - Intergenic
1123111899 14:105875429-105875451 TAAAGAGGAGGTAGAGAAAGAGG - Intergenic
1125008900 15:34849137-34849159 TAAAGGAGAGGGAGAGAAAGAGG - Intergenic
1125171416 15:36770278-36770300 AAAAGGGGAGGGAGCGAAAGAGG + Intronic
1125232374 15:37470612-37470634 TAGAGAGGATGCAGAGAAAGGGG + Intergenic
1125451638 15:39814195-39814217 AAAAGAGAATGAAGAGAAAGAGG - Intronic
1125812078 15:42550004-42550026 TCAAGGGCATTGAGAAAAATGGG + Intronic
1125977179 15:43964961-43964983 TAAAGGGCAAGCAAAGAAAGAGG + Intronic
1126405599 15:48319620-48319642 TAAAGGGGAAGGAGAGAAGAGGG + Intergenic
1126432605 15:48602103-48602125 TTAGGGGCAAGGAGACAAAGAGG - Intronic
1128042735 15:64589627-64589649 TAAAGGGGATGAAGATAAATAGG - Intronic
1128306088 15:66599941-66599963 TCTGGGGCAAGGAGAGAAAGGGG - Intronic
1128724257 15:69976162-69976184 TAGAGGGCATGGGGAGGCAGGGG - Intergenic
1130127974 15:81110389-81110411 TAAAGGGGATGGAGGGAGTGGGG - Intronic
1130134850 15:81173984-81174006 TAAAGGGCAAGGACAGGAACAGG + Intronic
1130685850 15:86036785-86036807 TATAGGACAAGGAGAGAGAGGGG + Intergenic
1131724214 15:95204261-95204283 CAAAGGGGTTGAAGAGAAAGTGG + Intergenic
1131762646 15:95641171-95641193 TAAAAGGAATGGGGAGGAAGGGG - Intergenic
1132028824 15:98424187-98424209 TACAGGGCAGGGCCAGAAAGTGG - Intergenic
1132066955 15:98739262-98739284 AACAGAGCATGCAGAGAAAGAGG - Intronic
1134139423 16:11704724-11704746 TAAAGGACAAGGAAAGACAGAGG + Intronic
1134377674 16:13693056-13693078 TAAAAGAGATAGAGAGAAAGGGG + Intergenic
1136029621 16:27493221-27493243 GAATGGGCCTGGGGAGAAAGCGG + Exonic
1136644151 16:31595105-31595127 CAAAGGGCATGGATAGAGAGAGG + Intergenic
1136660923 16:31761167-31761189 CAAAGGGCATGGATACAGAGAGG - Exonic
1137034810 16:35560860-35560882 TAAAGGAGATAGGGAGAAAGAGG - Intergenic
1137689714 16:50414425-50414447 GGAAGGGAAGGGAGAGAAAGGGG - Intergenic
1137924990 16:52532195-52532217 AGAAGGGCATGGATAGACAGAGG - Intronic
1137968349 16:52959057-52959079 TAAAGGGAGAGGAGAGAAAGAGG - Intergenic
1139373623 16:66483540-66483562 TGGAGGGCATGGAAAGGAAGAGG - Intronic
1139665583 16:68453241-68453263 TAGGGGGCAAGTAGAGAAAGAGG + Intergenic
1139729346 16:68929370-68929392 TAATGGCCATGGAAATAAAGAGG - Intronic
1140132399 16:72175097-72175119 TGAAAGGTATTGAGAGAAAGAGG + Intronic
1140157917 16:72453580-72453602 TAAAGAGGAGGTAGAGAAAGAGG - Intergenic
1140565443 16:76036341-76036363 TGAAGGCCATGGAGTGAATGGGG - Intergenic
1141355211 16:83339108-83339130 TGAGGGGGATGGAGAGAAAAGGG + Intronic
1141804948 16:86336316-86336338 GGAAGGGAAGGGAGAGAAAGAGG - Intergenic
1142243894 16:88959673-88959695 GAAAGGCGATGGAGAGAAAACGG + Intronic
1142338625 16:89506814-89506836 TGAAGGGCAGGGAGAGGGAGGGG + Intronic
1142844042 17:2658249-2658271 TAAAGGTCTAAGAGAGAAAGGGG - Intronic
1143183955 17:4999618-4999640 TAGAGGACAGAGAGAGAAAGAGG - Intronic
1143700789 17:8658663-8658685 TTGAGGGCAAGGGGAGAAAGTGG + Intergenic
1144050010 17:11490378-11490400 GAAGGGACATGGAGACAAAGGGG + Intronic
1144396156 17:14845153-14845175 GAAAGGGAAAGGAGAGAAAAAGG + Intergenic
1144787602 17:17840531-17840553 TAAGAGGCTTGGAGAGGAAGCGG - Intergenic
1145742045 17:27282957-27282979 AAAAGGATATGGAAAGAAAGTGG - Intergenic
1145912596 17:28551293-28551315 AAAGGTGCATGGAGAGACAGTGG - Intronic
1146127718 17:30241845-30241867 TAAAAGGCAAAGAAAGAAAGGGG + Intergenic
1146609454 17:34291351-34291373 TAACAGGCAAGGAGAGGAAGAGG - Intergenic
1146721931 17:35129965-35129987 TCAAGGGCATTGAAAGAAATAGG + Intronic
1147001659 17:37367689-37367711 AAAGGAACATGGAGAGAAAGGGG - Intronic
1147536056 17:41323949-41323971 GGAAGGGCATGGGGAGAATGAGG + Intergenic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1148684650 17:49494865-49494887 TGAAGGGCAGGGAGGGCAAGCGG + Intergenic
1149068897 17:52516475-52516497 AAAAGTACATGGAAAGAAAGTGG + Intergenic
1149591336 17:57831944-57831966 TGAAGGGCATGGGGAGGCAGTGG - Intergenic
1150130938 17:62668626-62668648 TAAAGGGCATGGTGAAGAAGAGG + Intronic
1150168901 17:62971239-62971261 AAAAGGCCACGGAGAGAAATAGG + Intergenic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1153413237 18:4817306-4817328 AAAATAGCATGGAGAGAGAGAGG + Intergenic
1153450117 18:5217599-5217621 TGAATGGTATGGAGAAAAAGTGG + Intergenic
1155053149 18:22165411-22165433 TAACAGGCTTGGAGAGAGAGCGG + Intergenic
1155282318 18:24252117-24252139 TAAAGAGGAGGTAGAGAAAGAGG + Intronic
1155347732 18:24875341-24875363 GAAAGGGCATGGGGATAAGGGGG + Intergenic
1155500138 18:26479535-26479557 CAAGGGGTGTGGAGAGAAAGAGG + Intronic
1155535032 18:26808248-26808270 TTAAGGGTATTGAGACAAAGAGG - Intergenic
1156549113 18:37996421-37996443 AACAGAGCAAGGAGAGAAAGTGG - Intergenic
1156731838 18:40203721-40203743 TAAAGGGCATGGTGAAATAATGG + Intergenic
1156840550 18:41605436-41605458 GAAAGGGAAGGGAGAGAAAGTGG + Intergenic
1157104787 18:44763855-44763877 TAGAGGTCAGGGAGATAAAGAGG - Intronic
1157691758 18:49688549-49688571 TAAAGTTCATGTAGAGAAACAGG + Intergenic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158612363 18:58953026-58953048 TGAAAGGCATGAAGAGAAAAAGG + Intronic
1158954633 18:62526122-62526144 TGGAGGGCAAGTAGAGAAAGGGG + Intronic
1160269115 18:77367986-77368008 AAATGAGCATGCAGAGAAAGCGG - Intergenic
1161370594 19:3908815-3908837 GAAAGGGGAGGAAGAGAAAGAGG - Intronic
1162067152 19:8132843-8132865 GAAGGGGCAGGGAGAAAAAGAGG - Intronic
1162211879 19:9098455-9098477 TTAAAGGTATGTAGAGAAAGAGG - Intergenic
1162622315 19:11853432-11853454 TAAAGGGGATAGAGAGAAGCGGG + Intronic
1163156676 19:15443442-15443464 TGAAGGGCCAGGAGAGAGAGGGG - Intronic
1163570560 19:18079540-18079562 TACCGGGGATGGAGAGAAGGAGG - Intronic
1164056640 19:21627692-21627714 TAAAGGAAATAGGGAGAAAGGGG - Intergenic
1165893263 19:39127269-39127291 TAAAGGGGCTGGGGAGAAATGGG - Intronic
1166638211 19:44470762-44470784 TAAAGGGGATGGGGATAAAAAGG - Intergenic
1166664702 19:44672006-44672028 TAAAGGCCAAGGGGAGAAATGGG + Intronic
1166925696 19:46265618-46265640 TCAAGGACAGGGAGAGAAATAGG - Intergenic
1167565323 19:50252444-50252466 TAGAGGGGAAGGAGAGAGAGGGG + Intronic
1167631190 19:50627234-50627256 CAAAGGCCAAGGAGAGATAGAGG - Intronic
1168346265 19:55651568-55651590 GGAGGGGCTTGGAGAGAAAGGGG - Intronic
926440793 2:12886483-12886505 CAAAGGACATGGATACAAAGAGG - Intergenic
926871021 2:17417303-17417325 GACAGGGCATGGAGCCAAAGAGG - Intergenic
927866429 2:26590851-26590873 CAAGGGGCCTGGAGAGAGAGTGG + Intronic
928176422 2:29037115-29037137 TGATGGGCAGGGAGGGAAAGTGG + Intronic
928276604 2:29906426-29906448 AAAAGGGATAGGAGAGAAAGAGG + Intronic
931057805 2:58492405-58492427 TAAAGGTCATAGGGAGTAAGAGG - Intergenic
931180739 2:59898036-59898058 AAAAAGGGAGGGAGAGAAAGAGG + Intergenic
931265178 2:60654055-60654077 CAAAGAGGAGGGAGAGAAAGTGG + Intergenic
931270038 2:60693508-60693530 ATAAGGGATTGGAGAGAAAGAGG + Intergenic
931784162 2:65604248-65604270 TGAAGGGAAGGGAGAGAAAGCGG + Intergenic
932447973 2:71792148-71792170 TAAAGGGGGAGCAGAGAAAGTGG + Intergenic
933063995 2:77771676-77771698 TAGAGAGCAAGGTGAGAAAGTGG - Intergenic
933198185 2:79416732-79416754 AATAAGACATGGAGAGAAAGAGG + Intronic
933800071 2:85953614-85953636 GAAAGGGCAGGAAGAGAACGAGG - Intergenic
933890586 2:86765678-86765700 TAAACAGCATGGAGAGAAAAGGG - Intronic
934666750 2:96176990-96177012 ATAAGGGCAGGGACAGAAAGTGG + Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934881867 2:97989462-97989484 TTAAGGGTAGGGAGAGAAATAGG + Intronic
935075363 2:99737797-99737819 TAAGAGACATGGAGATAAAGTGG - Intronic
935101351 2:99998806-99998828 TAAATGGCATGCAGAGAAAAAGG + Intronic
936626969 2:114158783-114158805 CAAAGGGCATGTAGTGATAGAGG - Intergenic
936806864 2:116344497-116344519 TAAAGTCCAAGGAGAAAAAGGGG - Intergenic
937394733 2:121524929-121524951 GAAAGGGCCTGGAGAGCAAGAGG + Intronic
937573346 2:123390926-123390948 TGAAGAGTATGGAGAGGAAGAGG - Intergenic
937696009 2:124809273-124809295 TAAAGGTAATGGAGAAACAGAGG + Intronic
937870837 2:126784940-126784962 CATGGGGCATGGAGAGGAAGAGG - Intergenic
937895571 2:126974661-126974683 TAAGGGGCTGGGAGGGAAAGGGG + Intergenic
938578641 2:132626587-132626609 TAAAGAGAAAGGAGAGAAATAGG + Intronic
938823749 2:134983868-134983890 TCACTGGGATGGAGAGAAAGGGG + Intronic
938840331 2:135155293-135155315 TAAAGGGCATTGAAGAAAAGTGG + Intronic
939087984 2:137744516-137744538 TAAAGGACATGGAATAAAAGAGG + Intergenic
939447935 2:142334293-142334315 TGCAGGGCATGGAGTCAAAGGGG - Intergenic
939988906 2:148858991-148859013 CACATGGCATGGAGAGAGAGAGG + Intergenic
940092015 2:149931281-149931303 GAAGGGGCATGGAGAGAGGGAGG + Intergenic
940854511 2:158719265-158719287 TAAAGGGCATGGATTCAGAGAGG + Intergenic
941565191 2:167097956-167097978 TTAAGGGCAGCCAGAGAAAGAGG - Intronic
941672404 2:168309233-168309255 TAAAGAGGAGGTAGAGAAAGAGG - Intergenic
941719659 2:168799881-168799903 CAAAGGGCATAGAGACAGAGAGG - Intronic
942079530 2:172386850-172386872 TAAAGGGCTTGGGGTGAGAGGGG - Intergenic
943007232 2:182400659-182400681 CTAAAGGCATGAAGAGAAAGCGG + Intronic
944467196 2:200014390-200014412 TACAGTGCAAAGAGAGAAAGGGG + Intergenic
945425353 2:209694162-209694184 AAAAGTGTATGGAGAGAAAAGGG + Exonic
945602520 2:211886022-211886044 TATAAAGCATAGAGAGAAAGAGG + Intronic
946144067 2:217715365-217715387 TTAAGGGCATGGATACAAGGAGG - Intronic
946335033 2:219030585-219030607 CCAAAGGCATGGAGAGAAAGGGG + Intronic
947130859 2:226923617-226923639 GAAAGAGGATGGAGAGAGAGAGG - Intronic
947181751 2:227417402-227417424 TTGAGGGCATGGGGAGAAAGAGG + Intergenic
947689128 2:232118297-232118319 TACAGGGCATGAAGACCAAGAGG + Intronic
947821264 2:233072580-233072602 TAAATGGCATTGAGAAGAAGTGG - Intronic
948603469 2:239120566-239120588 GAAAGGGCAAGGGGAGAAGGAGG + Intronic
948881350 2:240858916-240858938 TACAGGGCATCAAGTGAAAGTGG - Intergenic
1169161512 20:3383129-3383151 GGATGGGCATGGAGAGAATGGGG - Intronic
1169352624 20:4881348-4881370 GGAAGTGCATGGAGAGAAGGGGG + Intronic
1169415503 20:5412856-5412878 TGTAGGGCATGGAGACAGAGGGG - Intergenic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1169617755 20:7469648-7469670 TAAAGAGGAGGTAGAGAAAGAGG - Intergenic
1169969900 20:11258670-11258692 TAAAGGGCATGGATATAGAGAGG - Intergenic
1170799528 20:19579613-19579635 TAAATGACATAGAGAGAAATGGG + Intronic
1170946643 20:20896709-20896731 GAAAGGGCATGGAGGGAGAGAGG + Intergenic
1171055641 20:21903839-21903861 CAAAGGAAATGGAGGGAAAGTGG - Intergenic
1171779568 20:29407162-29407184 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1171820727 20:29835733-29835755 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1171823023 20:29872964-29872986 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1171897083 20:30817348-30817370 TAAAGAAGATGTAGAGAAAGGGG - Intergenic
1171897092 20:30817426-30817448 TAAAGAAGATGTAGAGAAAGAGG - Intergenic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1172776217 20:37408726-37408748 AAAAGGGGATGGAGACAGAGGGG + Intergenic
1172915829 20:38442990-38443012 TAAGGGTCAGGGGGAGAAAGAGG + Intergenic
1173580571 20:44143923-44143945 AATAGGGGATGGAGACAAAGAGG + Intronic
1173685087 20:44917714-44917736 TCAGGGCCATGGAGAGAAGGTGG + Intronic
1175031488 20:55959196-55959218 TCAAGGGCATGGAGAAGAAAGGG - Intergenic
1175533171 20:59688644-59688666 AAAAGGTCAGGGAGAGAATGAGG - Intronic
1175544865 20:59771597-59771619 AAAAGGGCTGGGAGAGAGAGTGG - Intronic
1176631436 21:9142385-9142407 TAAAGGGCATCCAGAGAGAAAGG - Intergenic
1177453033 21:21296707-21296729 TAAAGGGCAAGGAAATGAAGAGG + Intronic
1177674808 21:24283049-24283071 TAAGGGCCATGAAGAAAAAGAGG - Intergenic
1177962319 21:27682603-27682625 TAGAGGTCAAGGAGAGAAGGAGG + Intergenic
1178419907 21:32435146-32435168 TAAAGGAGATGGAGAGGAAGGGG - Intronic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
1179423401 21:41253906-41253928 GAAAGGGAATGGAAAGCAAGTGG - Intronic
1180324766 22:11360678-11360700 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1180480183 22:15746587-15746609 AAAAGGGGAAAGAGAGAAAGAGG - Intergenic
1181770373 22:25120746-25120768 TAAAGGATATAAAGAGAAAGAGG - Intronic
1181886039 22:26023149-26023171 GAAATGAGATGGAGAGAAAGAGG - Intronic
1182031594 22:27163289-27163311 AAAAGGGAAGGGAGGGAAAGGGG + Intergenic
1182076970 22:27501472-27501494 AAAGGGGAAGGGAGAGAAAGGGG - Intergenic
1182369554 22:29801325-29801347 TGAATGGCATGCAGAGAATGAGG - Intronic
1182505919 22:30782268-30782290 AAAAGGGCATGAAGAGAATTTGG - Intronic
1182774542 22:32821098-32821120 TGAAGGGTTTGGAGAGACAGTGG + Intronic
1182847461 22:33443361-33443383 TAAAGGGCACAGAGAGGAAGGGG + Intronic
1182960384 22:34466719-34466741 TAAAGGACAGAGAGAGAAGGGGG - Intergenic
1183285775 22:36962185-36962207 TAAAGACAATGGAGAGAATGAGG - Intergenic
1183352287 22:37341055-37341077 AAAGAGGGATGGAGAGAAAGAGG + Intergenic
1183760924 22:39816754-39816776 TAAAAGCCATGAAGAAAAAGAGG + Intronic
1183841837 22:40504643-40504665 TAAATGACAAGGAAAGAAAGAGG + Intronic
1184889086 22:47368615-47368637 TGGCGGGCATGGAGGGAAAGGGG - Intergenic
949668140 3:6365518-6365540 TGAGGGGGAAGGAGAGAAAGTGG - Intergenic
949728673 3:7081074-7081096 TAAATGGTATGGAGACAACGAGG - Intronic
949789207 3:7774382-7774404 TAGAGGGCAGGGAGAGGAAATGG + Intergenic
950010314 3:9718294-9718316 CAAAGGGCATGTAGAGGAACAGG + Intronic
950115915 3:10450325-10450347 TTAAGGGTAGTGAGAGAAAGAGG - Intronic
951273774 3:20659827-20659849 TGAAGGGGAAGGGGAGAAAGAGG - Intergenic
951404001 3:22271557-22271579 TTAAGGGTATGAAGAGAATGTGG - Intronic
952035163 3:29191548-29191570 TAAAGAGAATGTAGAGAAAGGGG - Intergenic
953557098 3:43954815-43954837 TAAAGGGCAGGCTGACAAAGTGG + Intergenic
954171062 3:48802764-48802786 TTAAAGGTATGGAGAGAAAAAGG + Intronic
954260251 3:49433508-49433530 TGAAGGGGCTGGAGTGAAAGTGG - Intergenic
955027374 3:55182828-55182850 AAAAGGGCAAGGGGAGAAGGGGG - Intergenic
955584574 3:60462631-60462653 TAAAGGGCTTGGAGAGCAGGAGG + Intronic
955989329 3:64609302-64609324 TAAAAGACATGCAAAGAAAGCGG + Intronic
956797145 3:72727462-72727484 CAAAGGGGAGGAAGAGAAAGAGG + Intergenic
957136624 3:76296552-76296574 TAAATGCCATAGGGAGAAAGGGG - Intronic
957285137 3:78208050-78208072 TAATAGGCATGTAGAAAAAGTGG - Intergenic
957622734 3:82615541-82615563 TCAAGGACATGCAGAGAATGGGG + Intergenic
957626471 3:82659126-82659148 GAAAGGGAAGGGAGAGAAATAGG - Intergenic
958181129 3:90062222-90062244 TAAAGGGCATGATGAGTCAGTGG - Intergenic
958573337 3:95914564-95914586 TAAATTACATGGAGAGAAACTGG - Intergenic
958741442 3:98078235-98078257 TAAATCACATGGAGAGAGAGAGG - Intergenic
958993362 3:100873419-100873441 TCCAGGGCAGGGAGGGAAAGGGG + Intronic
959498856 3:107081949-107081971 TGAAGGACATGGAAAGCAAGAGG + Intergenic
962131645 3:132684950-132684972 AAAAGGGCAGGAAGAGATAGGGG - Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
962743687 3:138381890-138381912 TGAAGGGCAGGGAGAGGAAAAGG + Intronic
963179680 3:142340469-142340491 TAAAGAGAAGGTAGAGAAAGAGG + Intronic
963276684 3:143338424-143338446 TGAAACCCATGGAGAGAAAGAGG + Intronic
965502806 3:169476680-169476702 TAAAGGGAAGGGGGAGAAGGGGG - Intronic
965951561 3:174314692-174314714 AAAAAGGCAGGGAGAGAAAAAGG + Intergenic
965969826 3:174541187-174541209 TAATAGGTATTGAGAGAAAGGGG - Intronic
966224963 3:177588238-177588260 TAATGGGCAGAGACAGAAAGAGG - Intergenic
966248712 3:177837779-177837801 TACAGTGTATGGAGAGAGAGGGG - Intergenic
966484909 3:180457633-180457655 TAGAGGCAAGGGAGAGAAAGAGG - Intergenic
967233174 3:187360192-187360214 TGAAGGGCTGGCAGAGAAAGAGG + Intergenic
967458624 3:189719806-189719828 TAAAGTTCATAGAGAAAAAGAGG - Intronic
968315393 3:197720059-197720081 AGAAGGGCATGGAGAGAGATCGG - Intronic
968315406 3:197720151-197720173 AGAAGGGCATGGAGAGAGATTGG - Intronic
969820682 4:9717925-9717947 TAAAAGAGATGGAGAGGAAGGGG - Intergenic
970631472 4:17951602-17951624 TAAATGCCATGGAGACAAAATGG - Intronic
971362445 4:25950544-25950566 GAAGGGGCATGGGGAGGAAGTGG + Intergenic
971836630 4:31772864-31772886 TCAAGGTCATGGAGACAAAAGGG + Intergenic
972426666 4:38939752-38939774 TAAAGGGATTGGAGAGAGAGAGG - Intronic
972926299 4:44013300-44013322 TAAAAGGGCTGGAGAGAATGAGG + Intergenic
973822336 4:54673309-54673331 TAAAAGGATTTGAGAGAAAGTGG - Intronic
973833656 4:54787867-54787889 AAAAGGGATTGGACAGAAAGTGG + Intergenic
973930745 4:55790910-55790932 GAAAGGGGATGGATACAAAGAGG - Intergenic
974000410 4:56506075-56506097 TAAGGGACAAGAAGAGAAAGGGG + Intronic
974083801 4:57238592-57238614 TTACTGGCATGTAGAGAAAGTGG + Intergenic
975598818 4:76078001-76078023 TAAAGGTCAAGGAGAGAAACTGG - Intronic
975737165 4:77392416-77392438 TAAAGGAGATAGGGAGAAAGAGG + Intronic
976220622 4:82754187-82754209 GACAGTGCAGGGAGAGAAAGCGG + Intronic
976545896 4:86335567-86335589 GGCAGGGCATGGGGAGAAAGAGG - Intronic
976912665 4:90326764-90326786 GAAAGGGCCTGGGGAGCAAGAGG - Intronic
977890905 4:102310102-102310124 TAAAGGCCATGTTGAGAAGGGGG - Intronic
978634450 4:110787211-110787233 TTAAGGACATGGAGAAAAAAGGG + Intergenic
978832365 4:113103932-113103954 TCAAAGGCATGGAGGAAAAGGGG - Intronic
979384501 4:120048594-120048616 TACATGGCAGGGAGAGAGAGAGG + Intergenic
979403034 4:120274313-120274335 TTAAGCACATGGAGAGAAACAGG + Intergenic
980599613 4:135004373-135004395 TAAAATGTATGCAGAGAAAGGGG + Intergenic
981038359 4:140195539-140195561 TAAAGGGCAAGCAGAGAGAGTGG - Intergenic
981039266 4:140207939-140207961 GAAAGGATATGGAGAGAAAAGGG - Intergenic
981111475 4:140939435-140939457 TAAAAGGAAAGAAGAGAAAGAGG + Intronic
981851731 4:149239479-149239501 TTAAGTGCCTGGACAGAAAGGGG + Intergenic
982340013 4:154286754-154286776 TAAAGGGAAAGTAGAGAAAGAGG + Intronic
982714329 4:158791053-158791075 TTAATGGAATGGAGAGAGAGGGG + Intronic
983252998 4:165365974-165365996 GAAAGTTCAAGGAGAGAAAGAGG + Intronic
983567860 4:169173881-169173903 TAAAAGACTTGGTGAGAAAGAGG - Intronic
984331483 4:178325909-178325931 AAAAGGGGAAGAAGAGAAAGAGG + Intergenic
984953424 4:185023008-185023030 AAAGGGGCAAAGAGAGAAAGGGG - Intergenic
985444439 4:190014048-190014070 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
985953174 5:3238671-3238693 GGAATGGCATGGGGAGAAAGTGG + Intergenic
986168616 5:5297188-5297210 TAAAGGGCATCCAGAGCCAGTGG - Intronic
986359348 5:6961046-6961068 TAAGGGGTATGGAGAGGATGGGG - Intergenic
986365813 5:7029646-7029668 TAAAGATTATGGAGAGGAAGAGG - Intergenic
986516568 5:8570796-8570818 TAAAAGGGAGGGGGAGAAAGTGG + Intergenic
986830673 5:11573806-11573828 TGAAGGAGTTGGAGAGAAAGAGG - Intronic
987362646 5:17121125-17121147 CAAAGAGAATGGAGAGAAGGTGG + Intronic
987481409 5:18463408-18463430 TAACGGGCATAGAGAGTAGGAGG + Intergenic
987823265 5:22992819-22992841 TAAAGAGGAGGTAGAGAAAGTGG + Intergenic
988083325 5:26440962-26440984 TGAAGGGGATGGGGAGAAAGTGG + Intergenic
989334612 5:40301148-40301170 TTAAGGGCAGCCAGAGAAAGAGG - Intergenic
990254811 5:53956396-53956418 TATAAGGCATGCAAAGAAAGAGG + Intronic
990254815 5:53956450-53956472 TATAAGGCATGCAAAGAAAGAGG - Intronic
990655395 5:57949548-57949570 TAAAAGGCCTGGAAAGAAAAAGG + Intergenic
990823894 5:59875558-59875580 TAAAGTGCAAGGAGGAAAAGAGG - Intronic
992079609 5:73222788-73222810 TACAGGGCAAGAAGAGAAAGAGG - Intergenic
992334844 5:75756088-75756110 TCCAGGGCATGGGGAGAGAGTGG + Intergenic
993705542 5:91165621-91165643 GAAATGTCATGGAGAAAAAGAGG - Intergenic
993744607 5:91581461-91581483 CAAAGGGCAAGGAAGGAAAGGGG - Intergenic
993877042 5:93319439-93319461 TAAGGGCCATAGAGAGACAGGGG + Intergenic
994851418 5:105058498-105058520 TCAAGGAAATGGAGAGAAATGGG - Intergenic
995155471 5:108907192-108907214 AAAAGGAAATGGAGAAAAAGGGG - Intronic
995266795 5:110171518-110171540 CAAAGGGCATGGAAAGAAAGAGG + Intergenic
995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG + Intergenic
995847017 5:116504204-116504226 TGAAGGGCATGAAAAAAAAGTGG + Intronic
996788033 5:127262067-127262089 CAAAGGGCATTAAGAAAAAGTGG - Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
997586892 5:135048675-135048697 CACAGGGCATGGAGAGCCAGAGG - Intronic
998704571 5:144743928-144743950 GAAAGGGAAGGGAGAGAATGAGG - Intergenic
999149088 5:149414944-149414966 GAAAGAGCATGGAGAGACGGAGG + Intergenic
999335901 5:150716219-150716241 TTAAGGGGATGGGGAGAAATGGG + Intronic
999641495 5:153677659-153677681 TAAAGGGCAGGGATAGAAAATGG + Intronic
999889865 5:155965742-155965764 TAAAGGAGATAGGGAGAAAGGGG - Intronic
1000620401 5:163479005-163479027 TGAAGTGGATGGTGAGAAAGGGG - Intronic
1000716576 5:164651862-164651884 CTAAAGGCATGGAGAAAAAGAGG - Intergenic
1000748684 5:165067772-165067794 TACAAAGCATGGAGAGATAGAGG - Intergenic
1001029864 5:168254433-168254455 GAAAGGGGAGGGAGAGGAAGAGG + Intronic
1001493010 5:172168858-172168880 TGAAGGCCACGGAGGGAAAGAGG - Intronic
1001623998 5:173114994-173115016 TACGGGGCAGGGAGAGAAAAGGG - Intronic
1001772819 5:174308763-174308785 CACAGGGAATGGACAGAAAGAGG + Intergenic
1002847534 6:961492-961514 AACAGGGGAGGGAGAGAAAGGGG - Intergenic
1002984277 6:2173442-2173464 TACAGGGCATGGAGGGAAGGAGG + Intronic
1003367693 6:5491731-5491753 TAAAGGGACTAGCGAGAAAGAGG - Intronic
1003555692 6:7137784-7137806 TCCAGGGCAGGGAGAGGAAGAGG - Intronic
1004914066 6:20315167-20315189 CAAAGGGCATGAAGAGATACAGG + Intergenic
1005061098 6:21777744-21777766 TAAGAGGTATGGAGAGAGAGGGG + Intergenic
1005301592 6:24476376-24476398 TGAGGGGCATGGAGGGAAGGAGG - Intronic
1005705813 6:28451731-28451753 TAATGAGGATGCAGAGAAAGGGG - Intergenic
1005772531 6:29089583-29089605 TAAAGGGCATGGAATAAAAGAGG + Intergenic
1005822004 6:29606308-29606330 TAGAGGGCTTGGAGGGAGAGGGG - Intronic
1005848716 6:29802431-29802453 TAGAGGGCCTGAAGTGAAAGAGG + Intergenic
1005898016 6:30195033-30195055 TCAAGGGAAGGGAGAGAAAATGG - Intronic
1006182721 6:32163793-32163815 GAATGGGCATTGAGAGAGAGCGG - Intronic
1006560390 6:34906319-34906341 GAAAGGTCAAGAAGAGAAAGAGG + Intronic
1007080208 6:39095440-39095462 TAAAGGACATGGAGATATGGGGG + Intergenic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1007709898 6:43816064-43816086 AAAAAGCCAAGGAGAGAAAGGGG + Intergenic
1008679513 6:53857261-53857283 TCAAGGGAAAGCAGAGAAAGAGG + Intronic
1009564456 6:65294159-65294181 GAAGGGGGCTGGAGAGAAAGAGG + Intronic
1009963476 6:70552792-70552814 AAAAGGGTAGGGAGAGAGAGAGG + Intronic
1010445160 6:75941270-75941292 TAAAGGCCAGGGAGAGGAACAGG + Intronic
1010521428 6:76842955-76842977 TAAAAGGCATGATGAAAAAGAGG + Intergenic
1011027969 6:82890306-82890328 TATAGGGCATGAAGGGAAAAGGG - Intergenic
1011309710 6:85968461-85968483 AGAAGGGCATGGAGAGGAATTGG - Intergenic
1011416917 6:87131550-87131572 CACATGGCAGGGAGAGAAAGAGG + Intergenic
1011918522 6:92541335-92541357 GAAACAGAATGGAGAGAAAGAGG + Intergenic
1012069661 6:94597599-94597621 TGAGGGGCATGGAGGGAAAAGGG - Intergenic
1012243915 6:96904912-96904934 AAATGGGAATGGAGAGCAAGGGG - Intergenic
1013127790 6:107201924-107201946 AAATGGTCATGGAGAGAAAGGGG - Intronic
1013671974 6:112414046-112414068 CAAAGGACAAGGGGAGAAAGTGG + Intergenic
1013701309 6:112773511-112773533 TAAATGAAATGGAGAGAAACAGG - Intergenic
1013906315 6:115223791-115223813 TTAAGGGCATTCAGAGAGAGAGG + Intergenic
1013988654 6:116227599-116227621 TAAAGAGCATGTGGAGAAAAGGG - Intronic
1014810117 6:125875596-125875618 TAACGAACATGGAGAGTAAGGGG - Intronic
1015151833 6:130048686-130048708 TAAAGAGCAGTGAAAGAAAGAGG + Intronic
1015236433 6:130976544-130976566 CAAGGGGTATAGAGAGAAAGTGG + Intronic
1016185570 6:141194482-141194504 TAAAGAGGAGGTAGAGAAAGAGG - Intergenic
1016509036 6:144819310-144819332 GAAGGGGAATGGATAGAAAGTGG + Intronic
1016979789 6:149843596-149843618 TAAAGGTCCTAGAAAGAAAGGGG - Intronic
1017537251 6:155361974-155361996 TTAAGGGCATGGGGAGATGGTGG + Intergenic
1017764545 6:157595909-157595931 GAAAGGGAAAGGAGAGGAAGTGG + Intronic
1018725827 6:166612800-166612822 TCAAGGGCATGGAGAGAGAGAGG - Intronic
1019025615 6:168960506-168960528 AAAGGGACAGGGAGAGAAAGTGG + Intergenic
1019632604 7:2057939-2057961 AAAGGGGCATGGAGAGAAGCAGG + Intronic
1020698594 7:11448328-11448350 GAAATGGCATAGGGAGAAAGTGG - Intronic
1021298473 7:18939754-18939776 TAAAGGGTTTGGAGGGAAACTGG - Intronic
1021534726 7:21690305-21690327 TGAAAGGTATGGAGGGAAAGAGG + Intronic
1024003801 7:45210684-45210706 GAAAGAGGATGGAGAGAAGGTGG - Intergenic
1024034514 7:45495850-45495872 TTCAGGACATGGTGAGAAAGGGG - Intergenic
1024146639 7:46523529-46523551 AAAAGGGAAAGGAGAGAAAGAGG - Intergenic
1024181411 7:46899146-46899168 GAAAGGGCATGCATAGAATGTGG - Intergenic
1024507008 7:50170363-50170385 GAAAGGGAAAGGAGAGAAGGAGG + Intergenic
1024705722 7:51957862-51957884 TAAAGAGGAGGTAGAGAAAGAGG - Intergenic
1026019128 7:66694513-66694535 CAAAGGGCATTGAGCTAAAGAGG + Intronic
1027411106 7:77918740-77918762 TAAAGAGGATGGAGAGAGGGAGG - Intronic
1027717685 7:81693468-81693490 TGAAGGGCAAGGAGAGATTGGGG + Intergenic
1028063406 7:86350010-86350032 CAAGAGGCCTGGAGAGAAAGGGG + Intergenic
1028128326 7:87140797-87140819 TAAAGGGCAAGAAGACAAATTGG + Intergenic
1028582077 7:92419162-92419184 TTAAGGGTAGGGAGAAAAAGGGG - Intergenic
1028835733 7:95373111-95373133 TAGGGGACATGGAGAGGAAGTGG - Intronic
1029220239 7:98982934-98982956 CAAAGGGCATGGACAGCAGGAGG + Intronic
1029647016 7:101863742-101863764 TCAAAGGCATAGAGACAAAGTGG - Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030210157 7:106987989-106988011 GAAACAGCATGGAGAGATAGAGG - Intergenic
1030214260 7:107027833-107027855 TAAAGGGGAAGGAAGGAAAGAGG + Intergenic
1030307448 7:108033354-108033376 TAAAGGGGTTGGATAGGAAGAGG - Intronic
1031446143 7:121857229-121857251 TGAAGGGCATTGACGGAAAGAGG + Intergenic
1031852442 7:126881431-126881453 TGGAGGGCAGGAAGAGAAAGAGG - Intronic
1031868994 7:127071992-127072014 CAAAGGGAATGGAGAGAAACTGG - Intronic
1031950084 7:127882622-127882644 TGAAAGGGAGGGAGAGAAAGTGG + Intronic
1032286606 7:130542345-130542367 TAAAGGGCATGGCGAGACGATGG + Intronic
1032341368 7:131076390-131076412 TAAAAGTCATGGACAAAAAGGGG - Intergenic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1032719344 7:134538012-134538034 TAAGGTGAAGGGAGAGAAAGAGG + Intronic
1032724313 7:134576781-134576803 TAAGGTGAAGGGAGAGAAAGAGG + Intronic
1033177713 7:139140827-139140849 TCAAGGAAATGCAGAGAAAGTGG + Intronic
1033636016 7:143211899-143211921 GAGAGGGAATAGAGAGAAAGTGG - Intergenic
1033783682 7:144703819-144703841 TAAATGCAATGTAGAGAAAGTGG - Intronic
1033790577 7:144788580-144788602 GGCAGGGCAGGGAGAGAAAGCGG + Intronic
1034811444 7:154135712-154135734 ATAAGTGCATAGAGAGAAAGTGG - Intronic
1035732104 8:1860460-1860482 TCAGGGGCATGGAGAGGAGGAGG - Intronic
1035900541 8:3454721-3454743 TAAAGGGCAGGCAGAGAGAAAGG - Intronic
1036477172 8:9103899-9103921 TAGAAGGGATGGAGAGAAAAAGG - Intronic
1036678723 8:10854977-10854999 AAAAGGGAATGGAGAGAACAGGG + Intergenic
1037018621 8:13940454-13940476 TTAAAGGCATGGAGGGAAGGGGG + Intergenic
1037414460 8:18634610-18634632 TAAAGGACAGGGAGAGACTGAGG - Intronic
1037704486 8:21307722-21307744 AAAAGGGAAGAGAGAGAAAGAGG - Intergenic
1037729131 8:21508607-21508629 CACAGGGCATGGAGAGACTGAGG + Intergenic
1038111371 8:24503384-24503406 TAGAGAGAATGGAGAGAAATAGG + Intronic
1038284226 8:26192355-26192377 TTCAGGGTAGGGAGAGAAAGTGG + Intergenic
1039126192 8:34204254-34204276 TAAAGGGCATGAAGAGATACGGG + Intergenic
1039219330 8:35311123-35311145 TAAAAGGAGAGGAGAGAAAGGGG + Intronic
1041439337 8:57877286-57877308 AAAAGGGCATGAAGAGAGAAAGG - Intergenic
1041497869 8:58506989-58507011 TCAGGGGGAGGGAGAGAAAGAGG + Intergenic
1041846401 8:62334383-62334405 TAAAGGCCATGTAAAGATAGAGG - Intronic
1042593960 8:70425517-70425539 TAAAAGGAATGGAGTGAAAGTGG - Intergenic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1043488038 8:80718372-80718394 TAAAGGGGATGGAGACAGGGAGG - Intronic
1043506232 8:80906109-80906131 TTCAGGGTAAGGAGAGAAAGTGG + Intergenic
1043970561 8:86524021-86524043 TAATGTGAATGGAGAGAAAATGG + Intronic
1044434470 8:92145947-92145969 TTTAGGGCAGGGAGGGAAAGTGG + Intergenic
1044452135 8:92349056-92349078 TAAAGATCTTGGATAGAAAGAGG - Intergenic
1044607957 8:94063500-94063522 AAAAGGGTTTGGAGAGGAAGAGG - Intergenic
1045385668 8:101668855-101668877 TAAAGAGGCTGGAGAGAGAGGGG - Exonic
1045733185 8:105265171-105265193 TAAAGAGGAGGAAGAGAAAGGGG - Intronic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1046562758 8:115860101-115860123 GAAAGGCCAAGCAGAGAAAGTGG + Intergenic
1047090177 8:121565911-121565933 GAAAGGGAATGGAGAGGAAATGG + Intergenic
1047212823 8:122853751-122853773 AAAAGGGCATGGGGAGATAGTGG - Intronic
1047415800 8:124663552-124663574 TAAAGAGTGTGGGGAGAAAGGGG - Intronic
1048158758 8:131991661-131991683 GTGAAGGCATGGAGAGAAAGAGG + Intronic
1048486557 8:134853166-134853188 CAAAGGGCATGAAGACATAGGGG - Intergenic
1049091891 8:140521728-140521750 TAATGGCCATGGACAGAAAGGGG - Intergenic
1049484516 8:142847442-142847464 TAAAGGTCAAGGACAAAAAGAGG - Intronic
1050148726 9:2597959-2597981 TTAACAGCACGGAGAGAAAGTGG + Intergenic
1050746078 9:8877948-8877970 GAAATAGCATGGAAAGAAAGAGG + Intronic
1050889392 9:10804696-10804718 AAAAGGGCATGGTGAGAGGGAGG + Intergenic
1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG + Exonic
1052411935 9:28132633-28132655 TAAGGGGCTTTGACAGAAAGTGG - Intronic
1052557715 9:30039200-30039222 CAAAGGCCCTGGAGTGAAAGAGG + Intergenic
1053096050 9:35329080-35329102 TAAAAGGCAAGGGAAGAAAGGGG - Intronic
1053141129 9:35683281-35683303 GAAAGGGAGTGGAGGGAAAGAGG + Intronic
1053317538 9:37064757-37064779 TGAAGGGCACAGAGAGAAAGTGG + Intergenic
1053749655 9:41239172-41239194 TAAAGAAGATGTAGAGAAAGAGG - Intergenic
1053749662 9:41239250-41239272 TAAAGATGATGTAGAGAAAGAGG - Intergenic
1054255159 9:62803509-62803531 TAAAGAAGATGTAGAGAAAGAGG - Intergenic
1054336151 9:63812097-63812119 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1054876820 9:70106217-70106239 AAAAGGGGAGGGAGAGAAAAGGG + Intronic
1054962902 9:70989356-70989378 TAAAGGAGATGGAGTGAAAGAGG - Intronic
1055555824 9:77472448-77472470 TAAAAGGCATCCAGAGAAAAAGG + Intronic
1056036578 9:82612654-82612676 TATAAGGCATGTAGAGAAAGTGG + Intergenic
1056346696 9:85703703-85703725 TAATAGGCATGGAGATACAGAGG + Intronic
1057194059 9:93106881-93106903 GGAAGGGCATGGAGAGGATGGGG - Intronic
1057315727 9:93967155-93967177 TGCAGGGCATGGAGAGGGAGGGG - Intergenic
1057429064 9:94977897-94977919 AAAAGTTCATGGAGGGAAAGAGG - Intronic
1057553798 9:96071830-96071852 TTAAGGGCAATGGGAGAAAGGGG - Intergenic
1057904108 9:98971288-98971310 AAAATGGCACGGAGAAAAAGGGG - Intronic
1058232667 9:102448385-102448407 TAAAGAACAGGTAGAGAAAGAGG + Intergenic
1059266301 9:113034605-113034627 TGAAAGGAATGGAGAGAAAGAGG - Intergenic
1059770570 9:117420141-117420163 TGAAGGGAATGAAGAGAAATGGG - Intergenic
1060913446 9:127369455-127369477 CAAAGGGAAGGGAGAGACAGAGG + Intronic
1061292718 9:129660956-129660978 GAAAGGGAAGGGAAAGAAAGAGG - Intergenic
1203754267 Un_GL000218v1:109990-110012 TAAAGGGCATCCAGAGAGAAAGG - Intergenic
1203372417 Un_KI270442v1:321241-321263 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1203376077 Un_KI270442v1:379437-379459 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1203376083 Un_KI270442v1:379515-379537 TAAAGAAGATGTAGAGAAAGAGG + Intergenic
1185499134 X:584292-584314 GAAGGGGGAGGGAGAGAAAGAGG + Intergenic
1185649118 X:1635916-1635938 TAAAGGAGGAGGAGAGAAAGAGG + Intronic
1185662061 X:1735666-1735688 GAAAGAGGAGGGAGAGAAAGAGG - Intergenic
1185662064 X:1735681-1735703 GAAAGAGGAGGGAGAGAAAGAGG - Intergenic
1185863929 X:3605761-3605783 TGATGGGCATGGAGAGGGAGTGG + Exonic
1186039937 X:5464523-5464545 GAAAGGGAATGGAGAGAGGGAGG + Intergenic
1186452293 X:9683851-9683873 GAAAGGGCAGGGAGAGAGGGAGG - Intronic
1186671659 X:11773306-11773328 TGAAGGCCAAGGAGAGAAAGTGG - Intronic
1187295771 X:17999198-17999220 CACAGGGCAGGGTGAGAAAGGGG - Intergenic
1187308042 X:18114992-18115014 CAAAGGGCATGGATAAAGAGAGG + Intergenic
1187375460 X:18748965-18748987 CAAAGAGCATGGATAGAAGGTGG + Intronic
1187413454 X:19071058-19071080 TGGAGGGCATGGAAAGAAAGGGG + Intronic
1188147047 X:26626864-26626886 TAAAAGAAAGGGAGAGAAAGAGG - Intergenic
1189098109 X:38161129-38161151 TACAGGACATGGAGAGACTGAGG + Intronic
1189233667 X:39471501-39471523 TACAGGGCATGGAGAGAGGCTGG + Intergenic
1189295778 X:39916619-39916641 AAAGGGGCAGGGAGAGAAGGGGG - Intergenic
1189896622 X:45663476-45663498 TAAAGAGCATGGCAAGAAAAGGG + Intergenic
1190145450 X:47887573-47887595 AACAGGGCATCAAGAGAAAGAGG + Intronic
1190417982 X:50199821-50199843 GAAAGGGGAGGGGGAGAAAGGGG - Intronic
1190435402 X:50419518-50419540 TAAAGGTCTTAGAGATAAAGGGG - Intronic
1190461776 X:50683919-50683941 TAAGGGGCAAGTAGAGGAAGAGG + Intronic
1191027403 X:55929004-55929026 TAAAGAGCATGTGGAGAAATAGG - Intergenic
1192322050 X:70097893-70097915 TGAGTGCCATGGAGAGAAAGTGG + Intergenic
1192841342 X:74859060-74859082 TAAAGAGAAGGTAGAGAAAGAGG + Intronic
1192855807 X:75010640-75010662 TAAAGAGAATGTAGAGAAAGAGG - Intergenic
1193963467 X:87953701-87953723 TGAAAGGCATGCAGAGAAAATGG + Intergenic
1194149517 X:90306415-90306437 TAAGAGGTATGGAGAGACAGTGG - Intergenic
1194329357 X:92561698-92561720 TAAAGGGGAGGTAGGGAAAGAGG + Intronic
1194439394 X:93912091-93912113 TAGAGGGCACAGAGAAAAAGAGG - Intergenic
1194957728 X:100200430-100200452 TAACGTGCATGGAGATGAAGCGG - Intergenic
1195079360 X:101356322-101356344 TAAAGGGGCTGGGGAGGAAGGGG + Intronic
1197826515 X:130596107-130596129 CAAAGAGCCTGGAGAGGAAGAGG + Intergenic
1197969334 X:132098609-132098631 TAAAGAGCAGGTAGAGGAAGAGG + Intronic
1197969356 X:132098819-132098841 TAAAGAGCAGGTAGAGGAAGAGG + Intronic
1198179188 X:134188690-134188712 TAAATGGCATTGAGACACAGAGG - Intergenic
1198234818 X:134726956-134726978 TAAAGAGGAGGGAGAGAAAGGGG - Intronic
1198713753 X:139533896-139533918 TAAGGGCCATGGAGAGGAACAGG + Intronic
1200495894 Y:3883150-3883172 TAAGAGGTATGGAGAGACAGTGG - Intergenic
1200638057 Y:5680888-5680910 TAAAGGGGAGGTAGGGAAAGAGG + Intronic
1200800235 Y:7380172-7380194 TGATGGGCATGGAGAGGGAGTGG - Intergenic
1201065948 Y:10094064-10094086 TAAAGAAGATGTAGAGAAAGAGG - Intergenic
1202275747 Y:23117970-23117992 AAAAGGGCATGGAGTGAGATGGG + Intergenic
1202290281 Y:23302721-23302743 AAAAGGGCATGGAGTGAGATGGG - Intergenic
1202428739 Y:24751689-24751711 AAAAGGGCATGGAGTGAGATGGG + Intergenic
1202442052 Y:24918400-24918422 AAAAGGGCATGGAGTGAGATGGG - Intergenic