ID: 1150602848

View in Genome Browser
Species Human (GRCh38)
Location 17:66665458-66665480
Sequence AGGGAGCATCGCTGGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150602833_1150602848 17 Left 1150602833 17:66665418-66665440 CCATCCTCCCAACACCCTGCACA 0: 1
1: 0
2: 7
3: 72
4: 670
Right 1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 223
1150602839_1150602848 2 Left 1150602839 17:66665433-66665455 CCTGCACAGTGGAGATGCCCTGA 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 223
1150602834_1150602848 13 Left 1150602834 17:66665422-66665444 CCTCCCAACACCCTGCACAGTGG 0: 1
1: 0
2: 4
3: 36
4: 333
Right 1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 223
1150602838_1150602848 3 Left 1150602838 17:66665432-66665454 CCCTGCACAGTGGAGATGCCCTG 0: 1
1: 0
2: 1
3: 26
4: 241
Right 1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 223
1150602837_1150602848 9 Left 1150602837 17:66665426-66665448 CCAACACCCTGCACAGTGGAGAT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 223
1150602836_1150602848 10 Left 1150602836 17:66665425-66665447 CCCAACACCCTGCACAGTGGAGA 0: 1
1: 0
2: 1
3: 26
4: 185
Right 1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150602848 Original CRISPR AGGGAGCATCGCTGGGCTTG GGG Intronic
900642360 1:3693826-3693848 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642392 1:3693932-3693954 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642413 1:3694002-3694024 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642423 1:3694037-3694059 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642443 1:3694107-3694129 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642499 1:3694284-3694306 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642522 1:3694355-3694377 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642543 1:3694425-3694447 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642553 1:3694460-3694482 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642574 1:3694530-3694552 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642584 1:3694565-3694587 AGGCTGCATGGCTGGGATTGCGG - Intronic
900642636 1:3694740-3694762 AGGCTGCATGGCTGGGATTGCGG - Intronic
900956266 1:5888022-5888044 AGGAAGCATGGCTGGGGTAGAGG + Intronic
901905060 1:12401265-12401287 GAGCAGCATGGCTGGGCTTGTGG - Intronic
902192240 1:14771966-14771988 AGGCAGCATCTCTGGGCTGCAGG + Intronic
902787675 1:18743618-18743640 AGGCAGCATCTCTGTGCTTCTGG + Intronic
905630959 1:39518370-39518392 AGGGACTATGGCTGGGGTTGGGG + Intronic
905666801 1:39767806-39767828 AGGGACTATGGCTGGGGTTGGGG - Intronic
907924629 1:58944080-58944102 GAAGAGCATGGCTGGGCTTGTGG + Intergenic
908826293 1:68135782-68135804 AGCAAGCACTGCTGGGCTTGTGG - Intronic
910324628 1:85991440-85991462 TGGGAGGAGAGCTGGGCTTGTGG + Intronic
911691084 1:100835541-100835563 AGGAAGCATGGCTGGGGTGGGGG - Intergenic
912616883 1:111110729-111110751 AGAGAGAATCTCTGTGCTTGGGG - Intergenic
913068786 1:115281588-115281610 AAGGAGCATCCCTGGGTTGGAGG + Intergenic
915459415 1:156060954-156060976 AGTGTGCATTGCTGGGCTTCTGG - Intergenic
917632638 1:176904982-176905004 AGAGAGCATTGCTGGGCTGATGG - Intronic
918795926 1:188897046-188897068 AGGGAGCATTGCAGGGCTTGTGG - Intergenic
920223946 1:204424559-204424581 AGGGAGCAATGCTTGGTTTGGGG - Exonic
921055239 1:211538237-211538259 AGGGCGTAGTGCTGGGCTTGGGG - Intergenic
922730569 1:227947010-227947032 AGGGACCCTCGCTGCGCTTTGGG - Intronic
924439211 1:244072649-244072671 CAGGAGCAGCGCTGGCCTTGGGG + Intergenic
1063814986 10:9760975-9760997 AGAGAGCATCCTTTGGCTTGGGG - Intergenic
1067803869 10:49380041-49380063 AGGGAACCACGCTGGGGTTGAGG + Intronic
1069618824 10:69823775-69823797 AGGGAGCTTCCCAGGGCTTCTGG - Intronic
1069745062 10:70709882-70709904 AGTGAGCATCCCTGGGCTAAAGG + Intronic
1072762922 10:98072633-98072655 AGGGAGCAACCCTGGCCTTTGGG + Intergenic
1073040231 10:100599194-100599216 TGGCACCATGGCTGGGCTTGGGG + Intergenic
1073475831 10:103752584-103752606 AGGGAGGAACTCTGGGCCTGGGG - Intronic
1075541340 10:123316934-123316956 AGGGAGCATGGCAGGCCTTAGGG + Intergenic
1076065113 10:127442353-127442375 AGTGGGCAGCTCTGGGCTTGGGG - Intronic
1076366801 10:129926549-129926571 GGGAAGCATCTCAGGGCTTGGGG + Intronic
1078927953 11:15891319-15891341 AGGGGGCAACGCTGGGATTCTGG - Intergenic
1079318452 11:19430063-19430085 AGGGAGCAATGGTGGGCATGAGG + Intronic
1079837360 11:25350919-25350941 AGGGAGCTGCACTGGGCTGGAGG + Intergenic
1083254309 11:61486824-61486846 AGGGAGGGTCGCTGGGGCTGTGG + Intronic
1083505947 11:63157362-63157384 AGGGAGCATCTCTGGGCACTGGG - Intronic
1084927205 11:72523124-72523146 TGGGAGCTTCACTGGGCTAGAGG - Intergenic
1085750778 11:79159197-79159219 AGTCAACATCGCTGGGTTTGGGG + Intronic
1086485081 11:87291632-87291654 AGGGAGAATCGCTGGAACTGGGG - Intronic
1089396610 11:118140293-118140315 AGGTAGCAGCGCTGGGGCTGGGG - Intronic
1090188369 11:124752412-124752434 TGGGAAAAGCGCTGGGCTTGGGG + Intergenic
1091937648 12:4446040-4446062 AGGGAGCATCTCTGGGGGAGGGG + Intergenic
1091946891 12:4554208-4554230 AGGGTGCATTTCTTGGCTTGTGG + Intronic
1094411015 12:30169206-30169228 AGGGAGCAAAGGTGGGCGTGGGG + Intergenic
1094500471 12:31016611-31016633 AGGGACTATTGCTGGGCTTCTGG - Intergenic
1096470983 12:51875494-51875516 AAGTAGCTTCTCTGGGCTTGGGG + Intergenic
1097276235 12:57815374-57815396 AGGCATCATCGCTGGGTTTTAGG + Intronic
1099092701 12:78333622-78333644 AGTGGGCATTCCTGGGCTTGTGG - Intergenic
1099174912 12:79409800-79409822 AGCGAGTTTCTCTGGGCTTGTGG + Intronic
1102380540 12:112462128-112462150 AGGGAGGATCGCTGGACCTCAGG + Intronic
1103330568 12:120151123-120151145 GGTGAGCATCTCTGAGCTTGGGG - Exonic
1104944901 12:132411136-132411158 AGGGAGCACCTCTGGGGTGGCGG + Intergenic
1105403280 13:20113904-20113926 AATGAGTATCGCTGGGCTTGTGG - Intergenic
1105463103 13:20609921-20609943 GGGGACCATGGCTTGGCTTGTGG + Intronic
1105705748 13:22966536-22966558 AGGGAGCCTCGCGGGGCAGGAGG - Intergenic
1107946647 13:45422793-45422815 AGGGAGTATCCCTGTGTTTGGGG - Intergenic
1114497387 14:23142441-23142463 AGGGAGCTTCCCTGGGGTTGGGG + Intronic
1114664396 14:24369395-24369417 AGGGAGCATAGAAGGACTTGCGG + Intronic
1118868200 14:69719560-69719582 AAGGAGCATTACCGGGCTTGGGG + Intergenic
1118876790 14:69792983-69793005 AGGGAGCATCCCTGGGAATTTGG - Intronic
1120206018 14:81588603-81588625 AGGGAGCAGGGCAGGGCTGGGGG + Intergenic
1121012961 14:90532827-90532849 AGGAAGCCTCCATGGGCTTGGGG + Exonic
1121326683 14:93024272-93024294 AGGGAGCACCTCTGTGCTTGAGG - Intronic
1122857891 14:104568643-104568665 AGGCAGCATCGCTGAGCTCCTGG - Intronic
1122959979 14:105089895-105089917 AGGGAGCATCCCTGGCCTTCGGG - Intergenic
1126598149 15:50402309-50402331 AGGGTGCATAACTTGGCTTGTGG - Intergenic
1127965838 15:63922436-63922458 AGGGAGGATGGCTGGCCCTGGGG - Intronic
1128127334 15:65202801-65202823 CTGGAGCATCTCTGGTCTTGGGG - Intronic
1129329650 15:74820534-74820556 AGGGAGGAAGGCTGGGCTCGTGG + Intronic
1131168849 15:90162181-90162203 AGGGAGCAGGCCAGGGCTTGTGG - Intronic
1131188006 15:90292149-90292171 AGGGAGGAGGGCTGGGGTTGGGG - Intronic
1132699449 16:1216112-1216134 TGGGAACATGGCTGGGCTGGTGG - Intronic
1133128494 16:3662252-3662274 AGGGAGCAGCGCTGGTCCAGGGG - Exonic
1133528311 16:6628061-6628083 AGGGAGCCTGGCTGGGCTCATGG - Intronic
1134108143 16:11498763-11498785 AGGTGGCATCGATCGGCTTGTGG - Intronic
1134161593 16:11894715-11894737 TGGGAGGATCACTGGACTTGAGG - Intronic
1135407392 16:22207731-22207753 AGGGAGCTTCTGTGGGCCTGGGG - Intronic
1136551351 16:30984151-30984173 AGGCTCCCTCGCTGGGCTTGGGG - Exonic
1136553330 16:30993297-30993319 TGGGAGCCTCCCTGGGCCTGAGG - Intronic
1139503758 16:67388732-67388754 AGGGAGCCTCTCTGGTCCTGAGG - Intergenic
1139518695 16:67467129-67467151 ATGGTGCATCCCTGGGGTTGGGG + Intronic
1142261086 16:89042705-89042727 AGGGTGCAGCGATGGGCGTGGGG + Intergenic
1142486858 17:253110-253132 AGGGAACCACGGTGGGCTTGGGG + Intronic
1143034049 17:3984306-3984328 AGGGGCCATCCCAGGGCTTGGGG - Intergenic
1143140893 17:4741169-4741191 AGGGAGGATGGCTGGGCAAGGGG - Intronic
1143289794 17:5820142-5820164 AGGGAGAATGGGTGGGCATGGGG - Intronic
1143338242 17:6189621-6189643 AGTGGGCAGTGCTGGGCTTGGGG - Intergenic
1144958379 17:19031163-19031185 AGGGAGCATGTCTGAGCTGGCGG - Intronic
1144976779 17:19143361-19143383 AGGGAGCATGTCTGAGCTGGCGG + Intronic
1146308187 17:31746652-31746674 AGGGGACATCACTGGGCCTGTGG + Intergenic
1148824274 17:50380675-50380697 AGGGTGCTACGCTTGGCTTGGGG - Intronic
1150550241 17:66203426-66203448 AGGGAGAATCTGTGTGCTTGGGG + Intergenic
1150602848 17:66665458-66665480 AGGGAGCATCGCTGGGCTTGGGG + Intronic
1152273719 17:79341547-79341569 AGGCAGCATGGCTGGGGCTGGGG + Intronic
1153756517 18:8288886-8288908 AGGAAGCATCGCTGTGCAGGTGG + Intronic
1154441823 18:14396575-14396597 AGAGAGTATCGCTGGGCCAGTGG + Intergenic
1159104267 18:63987565-63987587 ATGGAGCATCTCAGGGCTTCAGG + Exonic
1160611143 18:80086192-80086214 AGGAGGCATGGCTGGGGTTGGGG - Intronic
1160938776 19:1610322-1610344 GGGGAGCATCCCTGGGCCTGGGG - Exonic
1161001345 19:1912652-1912674 GGGCAGCAGCGCGGGGCTTGCGG + Exonic
1161328764 19:3676290-3676312 ACGGCGACTCGCTGGGCTTGGGG - Intronic
1161466393 19:4433039-4433061 AGGGAACATGGGTGGGCATGAGG - Intronic
1161602542 19:5193349-5193371 AGGCAGCCTCGCTGTGTTTGGGG - Intronic
1161960315 19:7519646-7519668 GGGGAGCACCGCGGGGCTGGTGG - Exonic
1164402303 19:27910666-27910688 AGGTAGCATCGCTCTGCTGGTGG + Intergenic
1165418598 19:35711047-35711069 AGGGAGCATCAGTGGGCTTTCGG - Intronic
1165730378 19:38141262-38141284 AGGGAGCATTGCTGCGGTAGGGG - Exonic
1166876416 19:45900505-45900527 AGGGAGCAGGGCTGGGGTAGGGG - Intronic
1167220069 19:48193515-48193537 GGGGAACATCCCTGTGCTTGTGG + Intronic
1167946745 19:52994164-52994186 CGGGAGGATCGCTGAGCCTGGGG + Intergenic
1168003383 19:53467177-53467199 CGGGAGGATCGCTGAGCCTGGGG - Intergenic
1168567932 19:57440250-57440272 AAGGAGCATTGCTAGGCCTGGGG + Intronic
1168589112 19:57618049-57618071 AGGCAGAATCCCTGTGCTTGGGG + Intronic
1168599298 19:57705297-57705319 AGGTGGCAGCCCTGGGCTTGGGG - Intronic
1168659599 19:58155388-58155410 AGGGAGCACCGCGGGGTTTCAGG - Intergenic
925886873 2:8401126-8401148 GAGAAGCATTGCTGGGCTTGGGG + Intergenic
926213883 2:10891568-10891590 AGGGAGCATGGCTTGGCAAGGGG + Intergenic
926621412 2:15049757-15049779 AGGGTGCGTGGCTGGCCTTGTGG - Intergenic
927244384 2:20945322-20945344 AGGGAGCATCTGTGTGCATGTGG - Intergenic
928194896 2:29208483-29208505 AGGAAGGAACGCTGAGCTTGTGG + Intronic
928852031 2:35759637-35759659 AGAGAGCATCTCTGGGCATTAGG - Intergenic
929605459 2:43231203-43231225 ACAGAGCATCTCAGGGCTTGGGG + Exonic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
933596316 2:84287093-84287115 GGGAAGCATTGCTGGGCTTTGGG - Intergenic
934765739 2:96879149-96879171 GGGGAGCATCCCAGGGCGTGAGG + Intronic
937206165 2:120238533-120238555 AGGGAGCAGGGCTGGGGTGGAGG + Intergenic
937895875 2:126976563-126976585 AGGGAGCATCCCAGAGCATGAGG + Intergenic
938766291 2:134462423-134462445 ACAGAGCATGGCAGGGCTTGAGG - Intronic
943378228 2:187108769-187108791 AGGAAGAATCTCTGAGCTTGGGG - Intergenic
946712750 2:222523062-222523084 ATGGAACATCCCTGGGCTTCTGG - Intronic
947637033 2:231685396-231685418 AGGAAGCATGGCTTGGATTGGGG + Intergenic
948599360 2:239099667-239099689 GGGGAGCACCGCTGGGGCTGGGG - Intronic
1169230983 20:3888958-3888980 CGGGAGCACTGCTGGGCTGGAGG + Intronic
1171114788 20:22515791-22515813 AGGGAGGCTGGCTGGGGTTGTGG - Intergenic
1171429542 20:25072809-25072831 AGGCAGCATCTCAGGACTTGAGG - Intronic
1173668150 20:44777748-44777770 ATGGAGCCTCTCTTGGCTTGAGG - Intronic
1175295250 20:57903904-57903926 AGGGAAAATCACTGGGGTTGGGG - Intergenic
1176254796 20:64146291-64146313 AGGGGGCTTGGCTGGGCCTGGGG + Intergenic
1177245792 21:18521319-18521341 AGGGAGCAATGCTGGGCGTCAGG + Intergenic
1178783923 21:35634650-35634672 AGGGTGCATTTCTGTGCTTGAGG - Intronic
1180060822 21:45384024-45384046 AGGGAGCCTCAATGGGCTGGCGG - Intergenic
1180955899 22:19741067-19741089 AGGGAGTATCCCTGGGCTCTGGG - Intergenic
1180996929 22:19970426-19970448 AGGGTGCCTGGCTGGGCTTTGGG - Exonic
1181590780 22:23883726-23883748 AGGGACCATGGCTGGGTGTGTGG + Intronic
1183696714 22:39427867-39427889 AGGGGGCCCCACTGGGCTTGGGG + Intronic
1184267530 22:43357161-43357183 AAAGAGCATAGCTGGCCTTGGGG - Intergenic
1184294947 22:43517264-43517286 AGGGAGCATCCCTGCCCCTGTGG - Intergenic
1184513014 22:44943997-44944019 AAGGAACAGCGCTGGGCCTGGGG + Intronic
1184683455 22:46085327-46085349 AGGGAACATAGCAGGGCCTGGGG + Intronic
1185171066 22:49294938-49294960 AGGGAGCAGGGCTGGGACTGCGG + Intergenic
950434834 3:12973221-12973243 AGGGATCATAGCTGGGAATGAGG - Intronic
950520850 3:13496865-13496887 GGGGGGCATGGCTGGGCTGGGGG + Intronic
950640661 3:14346220-14346242 GGGGAACCCCGCTGGGCTTGGGG - Intergenic
951679844 3:25283279-25283301 AAAGAGCAGAGCTGGGCTTGTGG + Intronic
953929102 3:46997118-46997140 GGGGAGCAGCGCTGTGCCTGGGG + Intronic
954401175 3:50320590-50320612 TGGGAGCATAGATGGGCTTGAGG - Exonic
958958326 3:100485636-100485658 AGGGAGGATCAGAGGGCTTGGGG + Intergenic
960095545 3:113686316-113686338 AGAGAGAATCGCTGTGCTTGGGG - Intronic
961159014 3:124706235-124706257 ATGGAGCATCCCTGCCCTTGGGG + Intronic
962437746 3:135382322-135382344 AGTCAGCACCGCTGGCCTTGGGG - Intergenic
963364928 3:144323000-144323022 AGAGAGCATCTCTGGGCTCTGGG + Intergenic
965343748 3:167521385-167521407 AGGTAGCATTGCTGTTCTTGAGG - Intronic
968662152 4:1803138-1803160 AGCGAGCAGGGCTGGGCGTGCGG - Intronic
969682200 4:8649623-8649645 AGGGAGCCCCGCTGGCCTGGGGG - Intergenic
969856801 4:10006575-10006597 AGGTAGCACTGCTGGGATTGTGG - Intronic
969967070 4:11007979-11008001 AGGGAGCATCGCTGTGGAGGTGG + Intergenic
972272330 4:37523307-37523329 AGAGAGCATCTCTGGGCATCTGG - Intronic
973610014 4:52627071-52627093 AGGGAGCAGCACTAGGCTTCTGG - Intronic
973632407 4:52831838-52831860 GTGAAGCATGGCTGGGCTTGAGG - Intergenic
977706642 4:100079280-100079302 AGGGAGCAAAGCTGGGGTAGCGG - Intergenic
985295220 4:188430663-188430685 TGGGAGCATGGCTGGGAGTGGGG - Intergenic
986027790 5:3866575-3866597 ACGCAGCATCGCTGGCTTTGAGG - Intergenic
986044239 5:4022406-4022428 AGGGACCAGCGCTGCCCTTGTGG + Intergenic
987644399 5:20649376-20649398 AGGGAGCATAGCTGCAATTGTGG + Intergenic
990320737 5:54627766-54627788 AGGGAGCATGGCTTGGCCAGTGG - Intergenic
994614678 5:102089514-102089536 AGAGAGCATCTCTGGGCATTGGG - Intergenic
997256506 5:132432619-132432641 AAGGAGAATCGCTGGAATTGAGG - Intronic
997291430 5:132738518-132738540 AGGGAGGATTGTAGGGCTTGTGG - Intergenic
1000073830 5:157766142-157766164 AGGGTTCATCTCTGGGCCTGGGG - Intergenic
1000270980 5:159682809-159682831 ACACAGCATCCCTGGGCTTGTGG + Intergenic
1001952998 5:175829333-175829355 AGGGAGCATGGCTGAGCAGGTGG - Intronic
1002465750 5:179407602-179407624 AGGCAGCAGGGCTGGGCTTGTGG + Intergenic
1003724656 6:8747266-8747288 AGGAAGAATAACTGGGCTTGTGG + Intergenic
1005993622 6:30918848-30918870 AGGCAGCGTCTCTGGCCTTGTGG - Exonic
1006431536 6:34000308-34000330 GGGGAGCCCTGCTGGGCTTGGGG + Intergenic
1006673314 6:35743631-35743653 AGGGAAGATCCCTGTGCTTGTGG + Intronic
1007072817 6:39049127-39049149 AGGGCGCCTCGCTGGGGTTGGGG - Intronic
1014028650 6:116676929-116676951 TGGGAGCATTCCTGGACTTGGGG + Intergenic
1017739853 6:157397482-157397504 ACGGAGCCTCGCTGGCTTTGAGG - Intronic
1018051828 6:160015977-160015999 AGGAAGCATAGCTCGGCTTCTGG - Intronic
1019371821 7:666118-666140 GGGGAGCATCGCTGAGCTCCTGG - Intronic
1019578081 7:1747087-1747109 AGTGGGCATCGCCGGTCTTGGGG - Exonic
1019843815 7:3476763-3476785 AGGGTCAATCGCTGGGCCTGGGG - Intronic
1019947178 7:4339090-4339112 AGGAAGCATGGCTGGGCCTCAGG + Intergenic
1021078284 7:16331750-16331772 AGGAAGAATCTCTGAGCTTGAGG + Intronic
1022466019 7:30653633-30653655 AGGGACCAACCCTGGGCTTCTGG + Intronic
1023057345 7:36300741-36300763 AAGAAGCATCGCTGGTCTTGGGG + Exonic
1023244317 7:38184407-38184429 AGGAAGCATGGCTCGGCTTTTGG + Intronic
1026913953 7:74108703-74108725 AAAGAGCATCGCTGGGGGTGGGG + Intronic
1029365125 7:100111837-100111859 AGGGAGAAGTGCTGGGCATGGGG + Intronic
1030096621 7:105906435-105906457 AGGGTGCAGAGCTGTGCTTGAGG + Intronic
1030391404 7:108932236-108932258 AGAGAGAATCCCTGAGCTTGTGG - Intergenic
1031721806 7:125186621-125186643 AGAGAGAATCTCTGTGCTTGGGG + Intergenic
1034417956 7:150975051-150975073 AGGAAGCATGGCTGGGACTGGGG + Intronic
1038901045 8:31844256-31844278 AGGGAGTATCGCTGTGCTAAAGG + Intronic
1039042103 8:33417852-33417874 GGGGAGCCTCTCTGGGCTTCCGG - Intronic
1047983030 8:130203371-130203393 GGGGAGCATGGCTGGACTTCAGG - Intronic
1049452939 8:142672107-142672129 ATGGAGCAAGGCTGGGCTGGAGG - Intronic
1052772735 9:32704528-32704550 AGGGAGGAGCCCTGGACTTGGGG + Intergenic
1053301996 9:36958957-36958979 AGGGAGCAGGGCTGGGGTTCTGG - Intronic
1054869570 9:70036868-70036890 AAGGACCATCGCTGGCCTCGGGG + Intergenic
1056558808 9:87711972-87711994 CTGGAGCATAGCTGGGCTTTGGG + Intergenic
1057251850 9:93509328-93509350 AGGGAGCATGGATGGCCTCGGGG + Intronic
1057691247 9:97288532-97288554 AGGGAGCAAGGCAGGGCTGGTGG - Intergenic
1061119728 9:128635434-128635456 AGTGAGCAGCGCTGGGATTCTGG - Intronic
1061543259 9:131289661-131289683 ATGGCTCATCCCTGGGCTTGGGG - Intergenic
1061570907 9:131476919-131476941 AGGGGGCATCGCTGGCCTCGTGG + Intronic
1061926958 9:133810617-133810639 CGGGACCAGCGCTGGGCATGAGG + Intronic
1062025605 9:134338842-134338864 AGGGAGGATCTCTGGGCTCTGGG - Intronic
1062720875 9:138043353-138043375 AGGGAGCCTCTGTGGGTTTGTGG + Intronic
1189375992 X:40466719-40466741 AGGTAGTATCCCTGGGTTTGAGG - Intergenic
1190110736 X:47587468-47587490 AGGGAGGATGGCAGAGCTTGGGG - Intronic
1190292396 X:49001466-49001488 AGGGAAGATCACTGGGCTTTGGG - Intronic
1190452735 X:50597227-50597249 AGGGACCACCACTGGGCTTGGGG + Intronic
1192310792 X:70012725-70012747 AGGCAGCTTTGCTGGGCTCGGGG - Intronic
1192369576 X:70502092-70502114 AGGCAGGATTGCTGGGTTTGGGG + Intronic
1193016302 X:76737954-76737976 AGGGAGCTTCTCTGGGCTCTAGG + Intergenic
1199664152 X:150083271-150083293 AGGGAGAATACCTGGGTTTGAGG + Intergenic