ID: 1150606653

View in Genome Browser
Species Human (GRCh38)
Location 17:66697351-66697373
Sequence ATGGACAAGAGTGTCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 11, 3: 43, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150606649_1150606653 9 Left 1150606649 17:66697319-66697341 CCCTGTAGACGCATCAATGTTGA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG 0: 1
1: 1
2: 11
3: 43
4: 228
1150606647_1150606653 18 Left 1150606647 17:66697310-66697332 CCATCATTCCCCTGTAGACGCAT 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG 0: 1
1: 1
2: 11
3: 43
4: 228
1150606650_1150606653 8 Left 1150606650 17:66697320-66697342 CCTGTAGACGCATCAATGTTGAC 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG 0: 1
1: 1
2: 11
3: 43
4: 228
1150606648_1150606653 10 Left 1150606648 17:66697318-66697340 CCCCTGTAGACGCATCAATGTTG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG 0: 1
1: 1
2: 11
3: 43
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150606653 Original CRISPR ATGGACAAGAGTGTCTTTGT AGG Intronic
901702252 1:11051800-11051822 GGGGACTAGACTGTCTTTGTAGG - Intergenic
902912223 1:19608220-19608242 ATGGACAAAAGTGTCATTGAAGG - Intronic
903083912 1:20837650-20837672 AAGGACAATACTATCTTTGTAGG + Intronic
904441767 1:30536379-30536401 AAGGACATGAGTGGCATTGTGGG + Intergenic
906003488 1:42447560-42447582 ATGAAGGAGAATGTCTTTGTGGG - Intronic
906347633 1:45029076-45029098 GTGTAGGAGAGTGTCTTTGTAGG - Intronic
915278691 1:154807616-154807638 CTGGAGAAGAGTGTATTTTTAGG + Intronic
916214132 1:162381736-162381758 AAGTTCAAGAGTGTCTTTGCTGG + Intronic
917782331 1:178411665-178411687 ATGGACAAAAGTGTCACTGAAGG - Intronic
918307251 1:183258585-183258607 AGGGACTAGATTGACTTTGTAGG + Intronic
918613086 1:186513912-186513934 ATGGTCAAAAGTGTCTCTGCAGG - Intergenic
919305206 1:195823525-195823547 ATGGACTAAAGTGTCATTGTGGG - Intergenic
920530193 1:206696141-206696163 ATGGACAAAAGTGTCATTGAAGG + Intronic
922096138 1:222444622-222444644 TTGGACAAAAGTGTCTGTGGTGG - Intergenic
1064891656 10:20181879-20181901 ATGGAGAACAGAGTTTTTGTTGG + Intronic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1067399836 10:45961249-45961271 ATGGAAAACAGTGCCTTTGCTGG - Intergenic
1067868165 10:49930540-49930562 ATGGAAAACAGTGCCTTTGCTGG - Intronic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1071045274 10:81366303-81366325 ATTGACAAGAGTACTTTTGTGGG - Intergenic
1072041995 10:91615652-91615674 ATGTACAAGAGTTTCTTTGTAGG + Intergenic
1074819695 10:117168740-117168762 GTGGACAAGAGGGTGTTTGGTGG - Intergenic
1079613051 11:22456986-22457008 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1081698044 11:45132057-45132079 ATGCACAAGAATGACTTTGAGGG - Intronic
1081715084 11:45244393-45244415 AGGGACAAGAGTGAGTTTCTGGG + Intronic
1085769998 11:79316446-79316468 ATGGACAAGTGAGTCTGTGTGGG + Intronic
1087024213 11:93633865-93633887 AAGGACTAGATTGCCTTTGTAGG - Intergenic
1087132901 11:94684261-94684283 ACGGACAAAAGTCTCCTTGTGGG + Intergenic
1087245910 11:95836527-95836549 ATGTACAAGAGTGGAATTGTTGG - Intronic
1087619218 11:100523176-100523198 ATGAACACGAGTATCTTTGCAGG + Intergenic
1088017176 11:105075022-105075044 ATGGCCAAGAGTATTTTTGGAGG + Intronic
1089920920 11:122208918-122208940 ATGGACAAGAGGGTCTCTGGTGG + Intergenic
1090071222 11:123546225-123546247 ATGGACAGAAGTGTCTGTGGGGG + Intronic
1090114661 11:123955833-123955855 ATGGATGAGAATATCTTTGTGGG + Intergenic
1092852422 12:12642058-12642080 ATGGGCAAGAGTGTACTTCTTGG + Exonic
1093706771 12:22283134-22283156 CTGGAAATGAGTGTCTATGTGGG + Intronic
1093805834 12:23431944-23431966 ATTGACATGAGTCTGTTTGTGGG + Intergenic
1095215663 12:39544414-39544436 GGGGACTAGATTGTCTTTGTAGG - Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1097706786 12:62877011-62877033 TTGGGCAACAGTGTGTTTGTAGG - Intronic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1099564093 12:84217858-84217880 GGGGACAAGCCTGTCTTTGTAGG - Intergenic
1101156720 12:101934644-101934666 ATGGACAAGAGTTTCTGTTTGGG + Intronic
1101527784 12:105547510-105547532 ATGGACCATGGTGTCTTTGTTGG + Intergenic
1101562727 12:105874102-105874124 ATTGAAAAGACTGTCTTTATGGG - Intergenic
1101922043 12:108940980-108941002 GTGGACAAGGGTATCTCTGTGGG + Intronic
1102230905 12:111261568-111261590 ATGGACAAGAGTGAGTTTCTGGG - Intronic
1103243113 12:119431578-119431600 GGGGACTAGATTGTCTTTGTAGG - Intronic
1105607252 13:21936384-21936406 ATGGGGAAGAGTGTGTGTGTAGG + Intergenic
1106659724 13:31785939-31785961 GTGGACAATATTGTCTTGGTTGG + Intronic
1107192952 13:37611803-37611825 ATGAAGAAGAGTGTCTCTGCTGG - Intergenic
1107560831 13:41555443-41555465 ATGGAGAAGAGTGTTTTTTGAGG - Intergenic
1111303902 13:86381948-86381970 AAGGACTAGACTGCCTTTGTAGG + Intergenic
1111419558 13:87994479-87994501 ATAGACAATAGTGTCTTGGAAGG - Intergenic
1111785703 13:92784076-92784098 ATGGACAAGAGAGTGTTTCATGG + Intronic
1112224093 13:97520648-97520670 ATGTACAAGAGTATCTGTTTTGG - Intergenic
1114530888 14:23395467-23395489 ATGTATAAGAGTTTCTCTGTAGG + Intronic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1118088220 14:62442845-62442867 GGGGACTAGACTGTCTTTGTGGG + Intergenic
1118379809 14:65208454-65208476 AGGGACTAGATTGCCTTTGTAGG - Intergenic
1118406358 14:65427799-65427821 ATGGACAAGAATGGGTTTTTTGG - Intronic
1119556026 14:75553256-75553278 ATGGACAAGCGTGTCAGGGTAGG - Intergenic
1119743803 14:77030221-77030243 ATGGAAAAGAGAGATTTTGTGGG - Intergenic
1120212484 14:81647137-81647159 ATGTATAAGGGTGTCTGTGTAGG + Intergenic
1120998250 14:90433180-90433202 AGGGACTAGATTGCCTTTGTAGG + Intergenic
1121702385 14:95964448-95964470 ATGGACATGTGTGTCTTCCTGGG - Intergenic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1125342507 15:38688774-38688796 GGGGACCAGAATGTCTTTGTAGG + Intergenic
1130680676 15:85993508-85993530 ATGCACAAGAGTGTCATTATGGG + Intergenic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1133957237 16:10455174-10455196 ATGGTGAAAAGAGTCTTTGTAGG + Intronic
1134512355 16:14858792-14858814 ATGGAGTAGAGTGGCTTTGAAGG + Intronic
1134699992 16:16257292-16257314 ATGGAGTAGAGTGGCTTTGAAGG + Intronic
1134971833 16:18537367-18537389 ATGGAGTAGAGTGGCTTTGAAGG - Intronic
1135344184 16:21674145-21674167 ATGCCCAAGAGTGTAATTGTTGG + Intergenic
1135578912 16:23608586-23608608 ATGTACAAGATTGTTTTTATGGG - Intronic
1137799224 16:51247315-51247337 ATGGACAAGGGTGTCTTTCCTGG + Intergenic
1138485218 16:57337270-57337292 ATGAACAAGAGTTTATTTCTGGG + Intergenic
1140281824 16:73562088-73562110 ATTGACTAGACTGTCTTTGAAGG - Intergenic
1142525710 17:539088-539110 ATGGACATGATTGGCTTTGGGGG - Intronic
1143222216 17:5272155-5272177 GGGGACTAGATTGTCTTTGTAGG + Intergenic
1143274276 17:5698567-5698589 GGGGACTAGACTGTCTTTGTAGG + Intergenic
1143865715 17:9921657-9921679 TGGGACAAGAATGCCTTTGTTGG + Intronic
1143872666 17:9968561-9968583 ATGGACAAGAGTGTTAATTTGGG - Intronic
1145975053 17:28979035-28979057 CTGGACAGGAGTGGCTTTGGGGG + Intronic
1146227034 17:31075924-31075946 GTGCACAAGTGTGTATTTGTGGG - Intergenic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1153084663 18:1270896-1270918 ATAGAAGATAGTGTCTTTGTAGG + Intergenic
1153401742 18:4689717-4689739 AAGGACAAGAGTGTCCAGGTAGG - Intergenic
1154053201 18:10983255-10983277 ATGGACATGAATATTTTTGTGGG + Intronic
1155249318 18:23940109-23940131 ATGGGCAAGAGGTTCATTGTGGG + Intronic
1155753706 18:29462767-29462789 ATGGTCAAGATAATCTTTGTGGG + Intergenic
1159460871 18:68721321-68721343 AGGGACAAGGGTGGTTTTGTGGG - Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159809667 18:73002644-73002666 ATGGACAATCTTGTCTTTGCGGG + Intergenic
1159843037 18:73423068-73423090 TTGTACAAAAGTGTCTTTTTAGG + Intergenic
1160511910 18:79457673-79457695 ATGGGCAAGGGTTTCTTTCTGGG - Intronic
1160928560 19:1558859-1558881 AGGGACATGAGTGTCAGTGTGGG + Intronic
1161206654 19:3044863-3044885 GTGGACAAGAGAATATTTGTTGG + Intronic
1162608207 19:11728171-11728193 ATGGAAAAGAGAGTCTTGGCCGG - Intronic
1166419883 19:42628413-42628435 AGGGACTAGAATGCCTTTGTAGG + Intronic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
1167869170 19:52353359-52353381 ATGGACAAAAGTGTATTTATAGG + Intronic
1167957331 19:53076736-53076758 ATGGACCAAATTGTCTTTGTGGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
926775724 2:16420634-16420656 TTGGACAAGAGTGGCATTGGTGG + Intergenic
927375394 2:22407398-22407420 ATGGACAAGACAGCGTTTGTCGG + Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
930016640 2:46975220-46975242 ATGAAGTAGAGTGTCTTTGGGGG - Intronic
930575500 2:53142281-53142303 ATGAAGAAGAGTGTCTCAGTTGG - Intergenic
931605410 2:64047791-64047813 AAGGACAAGAATATTTTTGTTGG - Intergenic
932128496 2:69166934-69166956 AAGGACAAGGTTCTCTTTGTGGG - Intronic
932919550 2:75895013-75895035 ATGGATAAGAGAGTTTTTGAAGG + Intergenic
933045394 2:77529003-77529025 GGGGACTAGAATGTCTTTGTAGG - Intronic
933350583 2:81147304-81147326 ATGTACAAAAGGGTCTTCGTGGG - Intergenic
933779222 2:85789968-85789990 ATGTACACGAGTGTGTGTGTGGG - Intergenic
933994057 2:87654996-87655018 ATGGACAAATGTGTCATTGAAGG - Intergenic
934701065 2:96440537-96440559 AGGGACTAGACTGCCTTTGTAGG + Intergenic
935977211 2:108590658-108590680 ATGGAAAAGAGTGTTGTTCTAGG + Intronic
936299807 2:111295918-111295940 ATGGACAAATGTGTCATTGAAGG + Intergenic
936786268 2:116097133-116097155 ATGGACAAGAGGGACTTTAAAGG - Intergenic
937411319 2:121679001-121679023 AGGGACTAGATTGTCTTTGTAGG + Intergenic
939745549 2:145961740-145961762 ATGGACAAGAGTACATTTGTGGG - Intergenic
939983552 2:148808982-148809004 ATGGGCAAGAGTATCTCTGCTGG - Intergenic
940082809 2:149823691-149823713 ATGAACAAGAGTGCCTTTTTTGG - Intergenic
941547905 2:166876914-166876936 ATGGAGAAGAGTGGCCATGTGGG + Intergenic
942428367 2:175883397-175883419 AAAGGCATGAGTGTCTTTGTGGG + Intergenic
942519738 2:176790986-176791008 ATGCACAAGAGTGGCCATGTTGG + Intergenic
944973960 2:205026098-205026120 ATGCACAAGAGTCTCTCTGATGG + Intronic
945862084 2:215135654-215135676 GAGGAGAAGAGTGTTTTTGTAGG - Intronic
948349455 2:237326708-237326730 ATGGAGAAGCATCTCTTTGTAGG - Intronic
1169511083 20:6264674-6264696 ATAGAAAAAAGTTTCTTTGTTGG + Intergenic
1169754210 20:9026012-9026034 AGAGACTAGACTGTCTTTGTAGG + Intergenic
1169824726 20:9754651-9754673 ATGAACCAGACTGCCTTTGTAGG - Intronic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1179362723 21:40727691-40727713 ATGGATGAGAGTGTGTGTGTAGG - Intronic
1183783169 22:40011881-40011903 ACGGCCAAGAGTGGCTTTGCTGG + Intronic
1184975301 22:48057526-48057548 AGGGAGAAGGGTGTCTTTCTGGG + Intergenic
1185268416 22:49917323-49917345 GGGGACAAGAGGGTCTTTGCAGG - Intronic
949288981 3:2441442-2441464 ATGAACAAGAGTCTCTTTCGGGG - Intronic
949575911 3:5339133-5339155 ATGTACAGGAGTGGCTTTGCTGG - Intergenic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
952086774 3:29832401-29832423 ATGGATGAGAGTACCTTTGTGGG + Intronic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
953673859 3:44985043-44985065 ATTGACAAGAAGTTCTTTGTGGG - Intronic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
955551566 3:60090690-60090712 ACTGACATGAGTGTCTTTGATGG + Intronic
963108091 3:141663785-141663807 AGGGACTAGACTGTCTTTGCAGG - Intergenic
963321146 3:143811005-143811027 ATGGGTAAGAGTCTATTTGTGGG + Intronic
963658659 3:148093833-148093855 ATGGAAAAGAATGATTTTGTAGG + Intergenic
964366244 3:155953630-155953652 AGGGACTAGATTGCCTTTGTAGG - Intergenic
964642623 3:158926347-158926369 ATGAGCAACAGTGCCTTTGTGGG + Intergenic
964945061 3:162211577-162211599 AGGGAAAACAGAGTCTTTGTTGG - Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
970598820 4:17624726-17624748 AGGGACTAGAGTGTCGTGGTGGG + Exonic
971735476 4:30443893-30443915 ATGAACAAGAGTAGTTTTGTGGG - Intergenic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
979115163 4:116814537-116814559 ATGGAGAACAGTGCCTGTGTGGG - Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
982166009 4:152614206-152614228 ATGGACAAAGGTGTCATTGAAGG + Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
986135460 5:4973541-4973563 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986135470 5:4973607-4973629 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986406667 5:7432291-7432313 CTGGACAAGAATGTGTGTGTGGG + Intronic
986515053 5:8552743-8552765 ATTGACAAGAGTGTCTTATGTGG + Intergenic
989830056 5:45905224-45905246 ATGGAGAAGATTGTTTTTGGAGG - Intergenic
990208785 5:53458859-53458881 AGGGACTAGATTGCCTTTGTAGG + Intergenic
991570797 5:68051333-68051355 ATGGACAGGACTGTGTGTGTCGG - Intergenic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993275795 5:85855858-85855880 ATGGACAAGAGTCTGGATGTTGG + Intergenic
993459444 5:88165199-88165221 ATGGACAAGAGTATTGTTGTTGG + Intergenic
993506758 5:88718076-88718098 ATGGATATGTGTGTCTGTGTGGG - Intergenic
994793158 5:104258041-104258063 ATGGACAAGAATACCTTTATGGG - Intergenic
995852684 5:116562665-116562687 ATGGACAAAAGTGTCATTGAAGG - Intronic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
997421365 5:133769520-133769542 ATGGACCAGAGTAGCTTTATGGG - Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
999294140 5:150447605-150447627 ATGGACAAAAGTGTCATTGAAGG + Exonic
1001427661 5:171634345-171634367 AAGAAAAAGAGTATCTTTGTTGG - Intergenic
1002311534 5:178318156-178318178 ATGAACAAGAGGGCCTTTTTTGG - Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1003580082 6:7332131-7332153 ATGGACACCACTGTCTTTGGAGG + Intronic
1005877167 6:30019836-30019858 ATGGAACAGAGGGTCTGTGTGGG + Intergenic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1007696384 6:43736716-43736738 ATGGGCAAGAGTGTTTTGGGAGG + Intergenic
1009694396 6:67081875-67081897 ATGGCCAAGTTTGTCTTTGGGGG + Intergenic
1011290545 6:85772483-85772505 ATGCACACGTGTGTCTTAGTGGG + Intergenic
1011347304 6:86385490-86385512 ATGGACAAGAGTGATTTTTAAGG + Intergenic
1011881926 6:92039587-92039609 ATGCATGAGTGTGTCTTTGTGGG + Intergenic
1013284095 6:108665297-108665319 ACGGACCAGAGAGTCTTTCTAGG - Intronic
1013857394 6:114590811-114590833 ATGTACAAGAGGATTTTTGTGGG - Intergenic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1015976036 6:138791815-138791837 TTGGACAAGAATGTCTTTGATGG + Intronic
1017341288 6:153325127-153325149 ATGTTCATCAGTGTCTTTGTAGG + Intergenic
1017610568 6:156182044-156182066 ATGGCCAAGAGTGTATTGATAGG + Intergenic
1018131664 6:160737725-160737747 ATGGAAAAGAGTCTCTTTAGGGG - Intronic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1019726005 7:2603058-2603080 ATGGACAAGGGTGTGTCTGTGGG - Intronic
1022071465 7:26919558-26919580 ATGTCCAACAGTTTCTTTGTGGG - Intronic
1023525309 7:41096392-41096414 ATTCAAAAGAGTGTCTATGTAGG - Intergenic
1024430141 7:49278919-49278941 ATGGAGAAGAGTGCCTTTCAAGG + Intergenic
1024661796 7:51502443-51502465 ATGGACAAGAATATTTTTATTGG + Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1026367016 7:69658749-69658771 ATAGACATCAGTATCTTTGTAGG + Intronic
1026370756 7:69696339-69696361 CTGGCCAAGGGTGTCTTTGCTGG + Intronic
1026441219 7:70446110-70446132 ATGGACAAGAGGGTTCTTGAGGG - Intronic
1028897428 7:96057955-96057977 ATGGACTGAGGTGTCTTTGTAGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031808981 7:126342442-126342464 TAGGAGAAGAATGTCTTTGTAGG + Intergenic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1035163861 7:156971971-156971993 TTTAACAAGAGTGTCTTTGCTGG + Exonic
1036162196 8:6399578-6399600 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1037639590 8:20730605-20730627 ATGGAGGAGAGTGTCTTTTCTGG - Intergenic
1037987370 8:23298431-23298453 AAGGAAAAAAGTGTCTTTATTGG + Intronic
1039222220 8:35345128-35345150 ATGGAGAAAAGTGTATTTTTAGG - Intronic
1043413546 8:80025433-80025455 ACTTACAAGAGTGTATTTGTAGG - Intronic
1044264229 8:90163592-90163614 AGGGAGAAGAGTGTCTGAGTAGG - Intergenic
1044509658 8:93059819-93059841 ATGGACAAGAATACTTTTGTAGG + Intergenic
1045690869 8:104758585-104758607 AGGGACTAGATTGCCTTTGTAGG - Intronic
1046696306 8:117343759-117343781 ATGGATGAGAGTACCTTTGTGGG + Intergenic
1048045099 8:130765539-130765561 AGAGAAAAGAGAGTCTTTGTGGG + Intergenic
1049777241 8:144412417-144412439 AAGGACAAGAGTGTCTTTACTGG + Exonic
1050126146 9:2358101-2358123 AGGGACAACAGGGTCTATGTGGG + Intergenic
1051631011 9:19140974-19140996 AGGGACTAGACTGCCTTTGTAGG + Intronic
1052998076 9:34562113-34562135 ATGGACAAGACTGACTGTGATGG - Intronic
1053024312 9:34717715-34717737 ATGGAGGAGAGGGTCTTTGCAGG + Intergenic
1053035711 9:34825456-34825478 ATGGAGGAGAGGGTCTTTGCAGG + Intergenic
1053597142 9:39574227-39574249 AGGGACTAGACTGGCTTTGTAGG - Intergenic
1053855171 9:42331181-42331203 AGGGACTAGACTGCCTTTGTAGG - Intergenic
1054569114 9:66790770-66790792 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1055473530 9:76638372-76638394 CTTGGCAAGTGTGTCTTTGTGGG + Intronic
1056213959 9:84391042-84391064 AGGGACTAGATTGTCTTTGTAGG - Intergenic
1056285636 9:85084970-85084992 AGGTACAAAATTGTCTTTGTTGG + Intergenic
1057318491 9:93989384-93989406 AGGGATTAGACTGTCTTTGTAGG + Intergenic
1059069580 9:111121075-111121097 ATGGACAAGAGGAACTTTCTGGG - Intergenic
1060437893 9:123610739-123610761 ATGGACAAGAATGGCTCTTTGGG + Intronic
1060778815 9:126396700-126396722 AAGGACCAGATTGTCTTTATAGG - Intronic
1061808161 9:133147973-133147995 TGGGACAAGACTGTCCTTGTTGG - Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1186036702 X:5430534-5430556 ATGGCCAATAGTGTCGGTGTGGG + Intergenic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1187689651 X:21852404-21852426 ATGAACAAGAGTCTATTTATTGG + Intronic
1188049665 X:25469184-25469206 ATGGAAAGTAGTGGCTTTGTAGG + Intergenic
1189129210 X:38480758-38480780 ATGGACAAGAATGGCCTTGAAGG - Intronic
1189409410 X:40756339-40756361 ACAGACAAAAGTGTCTTTGTGGG - Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190888031 X:54546389-54546411 ATGGGCAAGTGTGTGTTTGTAGG + Intronic
1192299512 X:69885622-69885644 ACAGACAAAATTGTCTTTGTAGG + Intronic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193961073 X:87925089-87925111 GGGGACTAGACTGTCTTTGTAGG + Intergenic
1194139530 X:90192737-90192759 ATTGCCAAGAGTGTAGTTGTTGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1194542499 X:95191363-95191385 ATAGACAAGAGTGCTTGTGTAGG + Intergenic
1195128083 X:101828649-101828671 ATGAACAACAGTGTATTTTTTGG + Intergenic
1196649069 X:118150342-118150364 GTGGACTAGACTGTCTTTGTAGG + Intergenic
1196870399 X:120108181-120108203 ATGGAGAAGAGCCTCTTTTTGGG + Intergenic
1197209639 X:123818214-123818236 GTGGACTAGACTGTCTTTGTAGG - Intergenic
1198731917 X:139740612-139740634 ATGGACAATAATGTATCTGTTGG + Intronic
1198797763 X:140417086-140417108 ATGGTCAAGATTGTTTTTGAGGG - Intergenic
1199200416 X:145081183-145081205 ATGGACAAAAGTGGCTGAGTTGG - Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1199456307 X:148033212-148033234 ATTGACTTCAGTGTCTTTGTGGG + Intergenic
1199475082 X:148236160-148236182 AGGGACAAGAGTGTTTTAGGTGG - Intergenic
1199827656 X:151515913-151515935 AGGGAAAAGAGAGTCTTTGAGGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200485272 Y:3761683-3761705 ATTGCCAAGAGTGTAGTTGTTGG + Intergenic
1200928155 Y:8673060-8673082 AAGGAGAAGTGTTTCTTTGTTGG - Intergenic
1200938967 Y:8762880-8762902 AAGAACAAGAGTTTCTTTGTTGG + Intergenic
1200972009 Y:9162730-9162752 ATAGACAATTCTGTCTTTGTGGG - Intergenic
1200981144 Y:9264287-9264309 AAGAACAAGAGTTTCCTTGTTGG + Intergenic
1201749024 Y:17412575-17412597 ATAGACTAGATTGCCTTTGTAGG + Intergenic
1201905773 Y:19084429-19084451 AAGGACAAGAGTGTCCAGGTAGG - Intergenic
1202129281 Y:21595453-21595475 AAGAACAAGAGTTTCCTTGTTGG - Intergenic