ID: 1150612821

View in Genome Browser
Species Human (GRCh38)
Location 17:66747891-66747913
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 369}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612821_1150612835 15 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612835 17:66747929-66747951 GGCCAGAAAGAGGAGCCCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 451
1150612821_1150612837 23 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612837 17:66747937-66747959 AGAGGAGCCCAGAGGAGAGCTGG 0: 1
1: 2
2: 10
3: 91
4: 822
1150612821_1150612839 27 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612821_1150612829 -7 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612829 17:66747907-66747929 TGTTCCAGGCCGGGGGGTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 240
1150612821_1150612838 24 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612838 17:66747938-66747960 GAGGAGCCCAGAGGAGAGCTGGG 0: 1
1: 0
2: 6
3: 71
4: 567
1150612821_1150612833 5 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223
1150612821_1150612841 30 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612821_1150612830 -6 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612830 17:66747908-66747930 GTTCCAGGCCGGGGGGTGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612821 Original CRISPR TGGAACAGTGCCCAGCACTC GGG (reversed) Intronic