ID: 1150612822

View in Genome Browser
Species Human (GRCh38)
Location 17:66747892-66747914
Sequence CTGGAACAGTGCCCAGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 2, 1: 0, 2: 9, 3: 84, 4: 459}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612822_1150612841 29 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612822_1150612829 -8 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612829 17:66747907-66747929 TGTTCCAGGCCGGGGGGTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 240
1150612822_1150612830 -7 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612830 17:66747908-66747930 GTTCCAGGCCGGGGGGTGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 200
1150612822_1150612837 22 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612837 17:66747937-66747959 AGAGGAGCCCAGAGGAGAGCTGG 0: 1
1: 2
2: 10
3: 91
4: 822
1150612822_1150612835 14 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612835 17:66747929-66747951 GGCCAGAAAGAGGAGCCCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 451
1150612822_1150612833 4 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223
1150612822_1150612839 26 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612822_1150612843 30 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612843 17:66747945-66747967 CCAGAGGAGAGCTGGGAGGAGGG 0: 1
1: 0
2: 2
3: 88
4: 767
1150612822_1150612838 23 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612838 17:66747938-66747960 GAGGAGCCCAGAGGAGAGCTGGG 0: 1
1: 0
2: 6
3: 71
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612822 Original CRISPR CTGGAACAGTGCCCAGCACT CGG (reversed) Intronic