ID: 1150612828

View in Genome Browser
Species Human (GRCh38)
Location 17:66747901-66747923
Sequence GGGCACTGTTCCAGGCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612811_1150612828 30 Left 1150612811 17:66747848-66747870 CCCAGCACGTGGGCATCGATCTG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1150612828 17:66747901-66747923 GGGCACTGTTCCAGGCCGGGGGG 0: 1
1: 0
2: 2
3: 28
4: 317
1150612812_1150612828 29 Left 1150612812 17:66747849-66747871 CCAGCACGTGGGCATCGATCTGT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1150612828 17:66747901-66747923 GGGCACTGTTCCAGGCCGGGGGG 0: 1
1: 0
2: 2
3: 28
4: 317
1150612818_1150612828 -10 Left 1150612818 17:66747888-66747910 CCCCCCGAGTGCTGGGCACTGTT 0: 1
1: 0
2: 4
3: 31
4: 270
Right 1150612828 17:66747901-66747923 GGGCACTGTTCCAGGCCGGGGGG 0: 1
1: 0
2: 2
3: 28
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612828 Original CRISPR GGGCACTGTTCCAGGCCGGG GGG Intronic