ID: 1150612831

View in Genome Browser
Species Human (GRCh38)
Location 17:66747911-66747933
Sequence TGGCCCGGCACCCCCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 327}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612831_1150612843 11 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612843 17:66747945-66747967 CCAGAGGAGAGCTGGGAGGAGGG 0: 1
1: 0
2: 2
3: 88
4: 767
1150612831_1150612844 17 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612844 17:66747951-66747973 GAGAGCTGGGAGGAGGGCCTTGG 0: 1
1: 2
2: 3
3: 103
4: 760
1150612831_1150612848 26 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612848 17:66747960-66747982 GAGGAGGGCCTTGGGGCTGGAGG 0: 1
1: 0
2: 9
3: 109
4: 944
1150612831_1150612839 7 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612831_1150612846 19 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612846 17:66747953-66747975 GAGCTGGGAGGAGGGCCTTGGGG 0: 1
1: 1
2: 4
3: 66
4: 633
1150612831_1150612847 23 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612847 17:66747957-66747979 TGGGAGGAGGGCCTTGGGGCTGG 0: 1
1: 1
2: 10
3: 114
4: 1057
1150612831_1150612837 3 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612837 17:66747937-66747959 AGAGGAGCCCAGAGGAGAGCTGG 0: 1
1: 2
2: 10
3: 91
4: 822
1150612831_1150612835 -5 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612835 17:66747929-66747951 GGCCAGAAAGAGGAGCCCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 451
1150612831_1150612838 4 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612838 17:66747938-66747960 GAGGAGCCCAGAGGAGAGCTGGG 0: 1
1: 0
2: 6
3: 71
4: 567
1150612831_1150612845 18 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612845 17:66747952-66747974 AGAGCTGGGAGGAGGGCCTTGGG 0: 1
1: 0
2: 4
3: 45
4: 512
1150612831_1150612841 10 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612831 Original CRISPR TGGCCCGGCACCCCCCGGCC TGG (reversed) Intronic