ID: 1150612833

View in Genome Browser
Species Human (GRCh38)
Location 17:66747919-66747941
Sequence GGGGGTGCCGGGCCAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612819_1150612833 7 Left 1150612819 17:66747889-66747911 CCCCCGAGTGCTGGGCACTGTTC 0: 1
1: 0
2: 4
3: 23
4: 234
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223
1150612822_1150612833 4 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223
1150612818_1150612833 8 Left 1150612818 17:66747888-66747910 CCCCCCGAGTGCTGGGCACTGTT 0: 1
1: 0
2: 4
3: 31
4: 270
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223
1150612821_1150612833 5 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223
1150612820_1150612833 6 Left 1150612820 17:66747890-66747912 CCCCGAGTGCTGGGCACTGTTCC 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612833 Original CRISPR GGGGGTGCCGGGCCAGAAAG AGG Intronic